Whole Genome Sequence for Cancer

WHOLE GENOME SEQUENCING FOR CANCER 1 WGS WorkFlow CGTATCTAGGTACCCACGGACGATA CGTATCTAGGTACACACGGACGATA ATAGTCGTATCTAAGTACC ATAGTCGTATCTAAGTACCCACGG ATAGTCGTATCTAAGTACCCACGGATGATA ATAGTCGTATCTAAGTACCCACGGATGATAGCTTACG CTAAGTACCCACGGATGATAGCTTACGCTA TACCCACGGATGATAGCTTACGCTAAC 2 Applications Creative Biolabs WHAT WE DO: FEATURES: Whole Genome Sequencing Whole Exome Sequencing (WES) Up to 99.99% Accuracy Service for Cancer Service Identify Potential Causative Variants Target Sequencing Service Detect DNA Modifications without Bisulfite Whole Transcriptome Sequencing Treatment (WTS) Service Identify Large Structural Variants Immune Repertoire Sequencing Service Phase Alleles and Ariants © 2007 - 2019 Creative-Biolabs All Rights Reserved Email: [email protected] Tel: 1-631-381-2994