HB-36-4-book

AF Barros et al.Thirdly, studies by Zijlstra et al. (2000); Minas Gerais (Oliveira et al., 2007); and Nematodes were extracted fromRandig et al. (2002); Meng et al. (2004) M. ethiopia was reported in the Federal the roots containing galls. Roots wereand Tigano et al. (2010) using SCAR District (Carneiro et al., 2005). Based rinsed in standing water and dissectedmarkers were widely accepted by plant- on electrophoresis and SCAR markers, with tweezers and fine scalpels underparasitic nematode researchers. different species were identified in a stereoscopic microscope to release Brazil in association with potatoes, the milky-white females. The females Identifying Meloidogyne species such as M. javanica, M. incognita, M. were used for subsequent evaluationbased only on morphological arenaria, and M. ethiopica (Medina of the perineal pattern and isoenzymecharacteristics such as the perineal et al., 2017). Using only the perineal electrophoresis.pattern in females is not reliable, since pattern technique, M. incognita, M.the analysis may not reflect the species javanica, M. arenaria, and M. hapla Multiplication of Meloidogyne spp.diversity. For instance, Meloidogyne were detected in several potato-growing populationsincognita in coffee was characterized states in Brazil (Charchar, 1997), and M.for 22 years as M. incognita race 5 or incognita and M. javanica were found Samples with roots in an advancedbiotype IAPAR, which only occurred in in vegetable crops in Maranhão (Silva, rotting state and not containingBrazil; however, it was defined as a novel 1991). appropriate females for morphologicalspecies by electrophoresis (Carneiro and electrophoretic studies had the rootset al., 1996). The electrophoresis The combined use of enzymatic, washed in standing water. Subsequently,of isoenzymes is more precise and molecular, and morphological methods the samples were cut into 0.5-cm pieces,permits the identification of species in a better characterize the diversity of and the eggs extracted using the processmixture and characterization of atypical Meloidogyne species in vegetables described by Hussey & Barker (1973).populations (Carneiro et al., 2016). with higher identification reliability. Tomato seedlings (cv. Santa Clara)Nevertheless, identification using this Breeders and agribusiness consultants were inoculated with the eggs in atechnique is limited to the stage of adult benefit from these studies with respect greenhouse for nematode multiplicationfemales, but females are not always to the selection of genotypes for research for approximately two months, whensuitable for analysis due to the state of and the recommendation of cultivars it was possible to obtain appropriateroot degradation (Salgado et al., 2015). specific to the species of nematode. females for the study.SCAR markers, however, represent a Familiarization and validation offast and accurate tool with which to biomolecular protocols for Meloidogyne Morphological studies ofdetermine the identity of Meloidogyne tropic species are also important. Meloidogyne spp. populationsspecies, in addition to allowing thedetection of species in a mixture and Thus, the objectives of the present Ten milky-white females removedmaking it possible to identify species study were to: 1) evaluate the diversity from infected roots were immediatelybased on eggs and juveniles, which of Meloidogyne species associated with transferred to one drop of 45% lacticeliminates the problem of inadequate vegetables in various states in Brazil acid. The perineal area of each femalefemales (Salgado et al., 2015). Yet, using morphological, enzymatic, and was cut, cleaned, and mounted on slidesonly nine Meloidogyne species detected molecular characterization; and 2) with glycerol for identification using ain Brazil can be identified by SCAR validate the SCAR markers for the light microscope.markers (Carneiro et al., 2016). accurate identification of these species, with a view to such markers being used Isozyme characterization of The main Meloidogyne species in diagnostic laboratories in the future. Meloidogyne spp. populationsparasitizing Brazilian vegetables areMeloidogyne javanica, M. incognita, M. MATERIAL AND METHODS Adult females of milky-whitearenaria, and M. hapla. Another species color in early oviposition were takenof great importance, M. enterolobii, Collecting and obtaining females either from newly collected fieldhas also been detected in vegetables of Meloidogyne spp. samples or tomato roots resulting from(Carneiro et al., 2006; Almeida et al., greenhouse multiplication for 60 days.2008). Despite the importance of the Thirty-six populations of The females were transferred to 0.2-correct identification of Meloidogyne Meloidogyne were obtained from mL microfuge tubes containing 10 µLspecies, few studies in Brazil have vegetable-producing areas in seven protein extraction buffer, according tocharacterized these species based on different states in Brazil (Table 1). Five Davis (1964), and were subsequentlyesterase and SCAR markers. Using sub-samples were collected composing smashed with a rounded-end glasselectrophoresis analysis, M. enterolobii one sample of soil and roots removed rod in an ice block to prevent proteinwas found in the states of Mato Grosso, from the rhizosphere of plants with denaturation. Vertical polyacrylamideCeará, São Paulo, and eastern Minas root-knot symptoms at approximately gel electrophoresis was used with aGerais (Carneiro et al., 2006; Oliveira 20-cm depth. The samples were placed bis-acrylamide concentration of 8% foret al., 2007; Almeida et al., 2008; Silva in plastic bags, stored in styrofoam the stacking gel and 4% for the runninget al., 2016); M. incognita, M. javanica, boxes with identification labels, and gel. When electrophoresis was notand M. arenaria were found in eastern subsequently processed. performed on the same day, the females were kept in the freezer at a temperature474 of approximately-10°C. For electrophoresis, nine females Hortic. bras., Brasília, v.36, n.4, October-December 2018

Morphological, enzymatic and molecular characterization of root-knot nematodes parasitizing vegetable cropswere used for each population, e.g., SCAR markers were performed in diversity of Meloidogyne species in 36one female per well. The protein extract a final volume of 25 µL, containing soil samples and vegetable roots withfrom M. javanica was placed in the 1 µL DNA, 0.7 µL each primer (10 galls collected from seven differentfirst, sixth, and final well of each gel μM), 0.5 µL acetylated BSA (10 mg/ states in Brazil yielded six differentas a standard for comparison with the mL), 12.5 µL GoTaq Colorless PCR species: M. incognita, M. javanica, M.phenotypes found. Electrophoresis Master Mix (Promega, Madison, USA), hapla, M. arenaria, and M. morocciensiswas performed in a refrigerator at and 9.6 µL nuclease-free water. PCR (Table 1). The most frequent speciesapproximately 4°C, with a voltage of reactions were performed using a were M. incognita (55.5%) and M.80 V through the stacking gel for 15 My Cycler TMthermal cycler (BIO- javanica (44.4%), and the least frequentminutes and 200 V through the running RAD). The amplification conditions were M. arenaria (11.1%), M. haplagel for 30 minutes. Migration was for each primer set are described in (8.3%), and M. morocciensis (5.5%).monitored by means of displacement of Table 3. All primers were synthesized Mixed populations occurred in 22%the frontline of bromophenol blue, and by Sigma-Aldrich (Madrid, Spain). samples. The predominance of the M.electrophoresis was stopped when this The PCR products were subjected to incognita and M. javanica species inline was 1 cm from the bottom of the agarose gel electrophoresis at 0.7% vegetable crops and the lower frequencygel. After stopping the electrophoretic and stained with GelRed (Biotium®) to of M. arenaria and M. hapla found inrun, the gel was removed from the visualize the bands. The length of each the present study are in accordanceplate. The running gel was immersed amplified fragment was compared with with reports by Charchar (1997), Silvain a developing solution prepared the Axygen 1 kb DNA ladder. (1991), Oliveira et al. (2007), and Rosaimmediately prior to use, to study et al. (2013); however, only the latter twoesterase isozyme (EST) pattern. The RESULTS AND DISCUSSION references used electrophoretic patternprotein bands were compared with the of esterase for species identification.positions presented by the migration In the present study, analysis of the Nevertheless, to date, there have beenof the M. javanica esterase pattern, as no reports of M. arenaria parasitizingreported in the literature (Esbenshade& Triantaphyllou 1990; Carneiro et al., Figure 1. Phenotypes of esterase of Meloidogyne spp. associated with vegetable crops. A:2008a). phenotype I1 of M. incognita; B: phenotype I2 of M. incognita; C: phenotype A2 of M. arenaria; D: phenotype A3 of M. morocciensis; E: phenotype H1 of M. hapla; F: pheno- DNA extraction type J3 of M. javanica. Mj: phenotype of M. javanica used as comparing patterns. Lavras, UFLA, 2015. The extraction of genomic DNA wasperformed using the protocol describedby Holterman et al. (2006), with slightmodifications. To obtain nematodes,the roots were cut into 0.5-cm pieces,from which eggs were extracted usingthe procedure described by Hussey &Barker (1973). The eggs were placedin a hatching chamber, and 10 second-stage juveniles (J2) were transferred toPCR microtubes containing 50 µL HLBbuffer [0.2 M NaCl, 0.2 M Tris-HCl(pH= 8.0), 1%(v/v) β-mercaptoethanol,and 800 µL/mL proteinase K]. Thesamples were centrifuged at 14,000rpm for one minute, incubated at 65°Cfor 2 hours and 99°C for 5 minutes, andsubsequently stored at -20°C for lateruse in PCR reactions. Identification of Meloidogynespecies by SCAR markers Based on studies of perinealpattern and esterase phenotypes, aprior identification was carried out andconfirmed using SCAR markers. TheSCAR markers used to identify thespecies of Meloidogyne are listed inTable 2. Amplification reactions using theHortic. bras., Brasília, v.36, n.4, October-December 2018 475

AF Barros et al.scarlet eggplant (Solanum aethiopicum) showed the following characteristics: lateral lines, interrupting the streaksor M. morocciensis parasitizing pumpkin M. incognita had a high trapezoidal of ventral and dorsal fields, where few(Cucurbita pepo) and cabbage (Brassica dorsal arch and striae varying from fine or no striae crossed the lateral linesoleracea) in Brazil. to coarse; M. javanica had a distinct of the perineal pattern; M. hapla had perineal pattern with incisures on the smooth striae, a rounded dorsal arch, The species found in the present studyTable 1. Phenotype of esterase and species names of Meloidogyne associated to vegetable with galls in several states, Brazil. Lavras, UFLA,2015.Population Nematode species Geographical origin Host plant Phenotype ofCode esterase1 M. incognita Viçosa-MG Cucurbita pepo I12 M. arenaria Cajuri-MG Solanum aethiopicum A23 M. morocciensis Cajuri-MG A34 M. javanica and M. incognita Cajuri-MG Cucurbita pepo J3 and I15 M. javanica Cajuri-MG Solanum lycopersicum J36 M. incognita Cajuri-MG Solanum aethiopicum I27 M. incognita Santana da Vargem-MG I28 M. arenaria and M. incognita Santana da Vargem-MG Cucurbita pepo A2 and I19 M. incognita Santana da Vargem-MG Lactuca sativa I110 M. hapla Pouso Alegre-MG Lactuca sativa H111 M. javanica Lavras-MG Abelmoschus esculentus J312 M. javanica Lavras-MG Fragaria vesca J313 M. incognita Ijaci-MG Solanum tuberosum I114 M. javanica and M. hapla Rio Paranaíba-MG Lactuca sativa J3 and H115 M. javanica and M. incognita Rio Paranaíba-MG Cucurbita pepo J3 and I116 M. incognita Rio Paranaíba-MG Daucus carota I117 M. javanica and M. incognita Rio Paranaíba-MG Solanum tuberosum J3 and I218 M. incognita Muzambinho-MG Daucus carota I219 M. incognita Ibertioga-MG Daucus carota I220 M. javanica Piedade-SP Cucumis sativus J321 M. javanica Piedade-SP Arracacia xanthorrhiza J322 M. hapla Piedade-SP Beta vulgaris H123 M. incognita Piedade-SP Solanum lycopersicum I2 M. incognita, M. javanica Solanum lycopersicum24 and M. arenaria Piedade-SP Lactuca sativa I1, J3 and A2 M. incognita25 M. javanica and M. incognita Holambra-SP Cichorium endivia I126 M. morocciensis Casa Nova-Ba J3 and I127 M. incognita Solanum lycopersicum28 M. incognita Mucugê-Ba Cucumis melo A329 M. javanica Piracanjuba-GO I130 M. incognita Burite Alegre-GO Brassica oleracea I231 M. javanica Caldas Novas-GO Abelmoschus esculentus J332 M. javanica Bom Jesus-GO Solanum lycopersicum I133 M. javanica and M. incognita Morrinhos-GO Abelmoschus esculentus J334 M. javanica J335 M. arenaria Petrolina-PE Solanum aethiopicum J3 and I136 Petrolina-PE Abelmoschus esculentus J3 Venda Nova do Imigrante-ES Solanum lycopersicum A3 Pelotas-RS Beta vulgaris L. Solanum lycopersicum Solanum tuberosum476 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Morphological, enzymatic and molecular characterization of root-knot nematodes parasitizing vegetable cropsTable 2. Sequences of SCAR markers used for identifying species of Meloidogyne. Lavras, UFLA, 2015.SCAR Sequence (5’→ 3’) Size of the Identified species ReferencesPrimers SCAR (bp)FhN GCCTTCTTTGGATTCCTCTCA 420 M. hapla Zijlstra (2000)RhN GGCTCATCCTTGCTGTAAAT 420 M. arenaria Zijlstra et al. (2000) 670 M. javanica Zijlstra et al. (2000)Far TCGGCGATAGAGGTAAATGAC 399 M. incognita Randig et al. (2002)Rar TCGGCGATAGAGGTAAATGACFjav GGTGCGCGATTGAACTGAGCRjav CAGGCCCTTCAGTGGAACTATACinc-K14-F GGGATGTGTAAATGCTCCTGinc-K14-R CCCGCTACACCCTCAACTTCTable 3. Amplification conditions used for different primers in identification of Meloidogyne species. Lavras, UFLA, 2015.Primers     35 cycles       4oC /∞FhN/RhN 2 min/ 94oC 30 s/94oC 30 s/58o C 1 min/72oC 4oC /∞Far/Rar 2 min/ 94oC 30 s/94oC 30 s/61o C 1 min/72oC 4oC /∞Fjav/Rjav 2 min/ 94oC 30 s/94oC 30 s/64° C 1 min/72oC 4oC /∞inc-K14-F/inc-K14-R 5 min/ 940C 30 s/94oC 45 s/55oC 1 min/70oC 8 min/ 70oCand visible points near the end of the using esterase (Table 1; Figure 1). The specific primers for M. arenaria and M.tail; M. arenaria and M. morocciensis phenotypes were J3, characteristic of morocciensis is necessary.had a similar perineal pattern, becoming M. javanica; I1 and I2, characteristicimpossible to distinguish, with a low of M. incognita; H1, characteristic Several field samples showed mixedrounded dorsal arch, coarse striae, and of M. hapla; A2, characteristic of M. Meloidogyne populations (Table 1).some striae bent toward the vulva. All arenaria; and A3, characteristic of M. Since DNA was extracted from 10 J2perineal patterns were similar to those morocciensis. The phenotype I1 (66.7%) samples, some could have predominated,already described by Jepson (1987) and of M. incognita was more frequent such as sample 8, in which M. arenariaCarneiro et al. (2008a). than I2 (33.3%) of the same species. prevailed over M. incognita; thus, the Other studies have used isozyme sample DNA was not amplified using Although perineal patterns have electrophoresis to confirm identities the inc-K14-F/inc-K14-R primer pair.long been used for the identification of by perineal patterns (Oliveira et al.,Meloidogyne species, this method has 2007; Carneiro et al., 2008a; Barros et Root samples sometimes arriveshown inconsistent results, besides being al., 2011). already degraded to the laboratory,subjective and prone to many mistakes precluding withdrawal of females or(Carneiro et al., 2004). For instance, M. The pairs of SCAR markers even eggs; thus, DNA extraction from J2arenaria and M. morocciensis cannot usually employed in the diagnosis may facilitate diagnosis in laboratories,be distinguished by perineal patterns, of Meloidogyne species were more since J2 may be found in the soil.which has also been corroborated efficient in distinguishing the speciesby Conceição et al. (2012). Perineal M. incognita, M. javanica, and M. Isozyme electrophoresis inpatterns of M. incognita described here hapla associated with vegetable crops conjunction with SCAR markers waswere also similar to other species such (Figure 2); however, the primer pair efficient in diagnosing Meloidogyneas M. paranaensis, M. enterolobii (Syn. (Far/Rar) indicated for the identification species that parasitize vegetable crops,M. mayaguensis), and M. izalcoensis. of M. arenaria was inefficient, since expanding the pool of Meloidogyne no PCR product was detected even species in different states in Brazil. In the present study, the following optimization of the annealing Despite SCAR markers being efficient,electrophoretic pattern of esterase was temperature. In accordance, Carneiro only nine species could be identifiedsufficient to distinguish Meloidogyne et al. (2008a) found no amplification in Brazil by this method, whereasspecies, including M. arenaria and of DNA fragments of three populations there is a pattern of esterase for allM. morocciensis, leaving no doubt of of the M. arenaria phenotype A2 using species detected in Brazil, whichspecies identity. Of the 36 Meloidogyne the same primer pair. Therefore, the makes isoenzyme electrophoresispopulations assessed, we found six development of a novel pair of species- more advantageous (Carneiro et al.,phenotypes in electrophoretic analysis 2016). In the present study, we verified that the primer pair Far/Rar does notHortic. bras., Brasília, v.36, n.4, October-December 2018 477

AF Barros et al. do Estado de Minas Gerais (FAPEMIG) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). REFERENCESFigure 2. Specific amplification by PCR from DNA of Meloidogyne spp. associated with ALMEIDA, EJ; SOARES, PLM; SILVA, AR;vegetables crops: (A) inc-K14-F/inc-K14-R, (B) Fjav/Rjav and (C) FhN/RhN. M: 1 kb SANTOS, JM. 2008. Novos registros sobreplus ladder; 1-36 populations of Meloidogyne; NC: negative control; PC: positive control. Meloidogyne mayaguensis no Brasil e estudoLavras, UFLA, 2015. morfológico comparativo com M. incognita. Nematologia Brasileira 32: 236-241.identify M. arenaria, and there is no parasitizing scarlet eggplant and M.primer described for M. morocciensis; morocciensis parasitizing pumpkin ANWAR, AS; McKENRY, MV; LEGARI, AU.however, the inc-K14-F/inc-K14-R, and cabbage. The present findings will 2009. Host suitability of sixteen vegetable cropFjav/Fjav, and FhN/RhN primer pairs contribute to future studies regarding genotypes for Meloidogyne incognita. Journalwere validated to characterize M. genetic improvement and control of Nematology 41: 64-65.incognita, M. javanica, and M. hapla, methods.respectively. Molecular, enzymatic, BARROS, AF; OLIVEIRA, RDL; ZAMBOLIM,and morphological techniques must be ACKNOWLEDGMENTS L; FERREIRA, AO; COUTINHO, RR.used in combination to provide reliable 2011. Meloidogyne paranaensis attackingdiagnosis. The authors gratefully acknowledge coffee trees in Espirito Santo State, Brazil. the Brazilian financial supports Australasian Plant Disease Notes 6: 43-45. Our data allowed us to access provided by Conselho Nacionalthe diversity of Meloidogyne species de Desenvolvimento Científico e CARNEIRO, RMDG; ALMEIDA, MRA. 2005.associated with vegetables crops, and to Tecnológico (CNPq), through process n° Registro de Meloidogyne ethiopica em plantasverify that a plant may be infected with 457917/2014-8, and other supports, as de yacon e tomate no Distrito Federal domore than one species simultaneously. well as Fundação de Amparo à Pesquisa Brasil. Nematologia Brasileira 29: 285-287.Here, we report, for the first time inBrazil, the presence of M. arenaria CARNEIRO, RMDG; ALMEIDA, MRA; BRAGA, RS; ALMEIDA, CA; GIORIA, R. 2006. Primeiro registro de Meloidogyne mayaguensis parasitando plantas de tomate e pimentão resistentes à meloidoginose no estado de São Paulo. Nematologia Brasileira 30: 81-86. CARNEIRO, RMDG; ALMEIDA, MRA; MARTINS, I; SOUZA, JF; PIRES, AQ; TIGANO, MS. 2008b. Ocorrência de Meloidogyne spp. e Fungos Nematófagos em Hortaliças no Distrito Federal, Brasil. Nematologia Brasileira 32: 135-141. CARNEIRO, RMDG; CARNEIRO, RG; ABRANTES, MO; SANTOS, MSNA; ALMEIDA, MR. 1996. Meloidogyne paranaensis n. sp. (Nemata: Meloidogynidae), a root-knot nematode parasitizing coffee in Brazil. Journal of Nematology 28: 177-189. CARNEIRO, RMDG; MONTEIRO, JMS; SILVA, UC; GOMES, G. 2016. Gênero Meloidogyne: diagnose através de eletroforese de isoenzimas e marcadores SCAR. In: OLIVEIRA, CM; SANTOS, MA; CASTRO, LHS (eds) Diagnose de fitonematoides. Campinas: Millennium. p.71-93 CARNEIRO, RMDG; SANTOS, MFA; ALMEIDA, MRA; MOTA, FC; GOMES, ACMM; TIGANO, AS. 2008a. Diversity of Meloidogyne arenaria using morphological, cytological and molecular approaches. Nematology 10: 819-834. CARNEIRO, RMDG; TIGANO, MS; RANDIG, O; ALMEIDA, MRA; SARAH, JL. 2004. Identification and genetic diversity of Meloidogyne spp. on coffee from Brazil, Central America and Hawaii. Nematology 6: 287-298. CHARCHAR, JM. 1997. Nematóides associados à cultura da batata (Solanum tuberosum L.) nas principais regiões de produção do Brasil. Nematologia Brasileira 21: 49-60. CONCEIÇÃO, IL; TZORTZAKAKIS, EA;478 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Morphological, enzymatic and molecular characterization of root-knot nematodes parasitizing vegetable crops GOMES, P; ABRANTES, I; JOSÉ, M. for rapid and sensitive identification of three paranaensis e Meloidogyne exigua em 2012. Detection of the root-knot nematode major root-knot nematodes, Meloidogyne lavouras cafeeiras da região Sul de Minas Meloidogyne ethiopica in Greece. European incognita, M. javanica and M. arenaria. Acta Gerais. Coffee Science 10: 475-481. Journal of Plant Pathology 134: 451-457. Phytopathologica Sinica 34: 204-210. SILVA, GS. 1991. Identificação de espécies e raças de Meloidogyne associadas a hortaliças noDAVIS, BJB. 1964. Disk electrophoresis. II. MOENS, M; PERRY, RN; STARR, JL. 2009. estado do Maranhão. Nematologia Brasileira Method and application to human serum Meloidogyne species - a diverse group of novel 15: 51-58. proteins. Annals of the New York Academy of and important plant parasites. In: PERRY, RN; SILVA, MDCLD; SANTOS, CDG; SILVA, GSD. Sciences121: 404-427. MOENS, M; STARR, JL (eds). Root-knot 2016. Espécies de Meloidogyne associadas a Nematodes. Wallingford: CAB International. vegetais em microrregiões do estado do Ceará.ESBENSHADE, PR; TRIANTAPHYLLOU, AC. p.55-97. Revista Ciência Agronômica 47: 710-719. 1990. Isozyme phenotypes for identification of TAYLOR, AL; SASSER, JN. 1978. Biology, Meloidogyne species. Journal of Nematology NOLING, JW. 2012. Nematode management identification and control of rootknot 22: 10-15. in tomatoes, peppers and eggplant. ENY- nematodes (Meloidogyne spp.). North Carolina 032/NGO32, Entomology and Nematology State University Graphics Raleigh: Coop.HOLTERMAN, M; WURFF, AVD; ELSEN, Department, Florida Cooperative Extension Publ. Dep. Plant. Pathol. SVD; MEGEN, HV; BONGERS, T; Service, Institute of Food and Agricultural TIGANO, M; SIQUEIRA, K; CASTAGNONE- HOLOVACHOV, O; BAKKER, J; HELDER, Sciences, University of Florida, p: 1-15. SERENO, P; MULET, K; QUEIROZ, P; J. 2006. Phylum-wide analysis of SSU rDNA SANTOS, M; TEIXEIRA, C; ALMEIDA, reveals deep phylogenetic relationships OLIVEIRA, RDL; SILVA, MB; AGUIAR, M; SILVA, J; CARNEIRO, R. 2010. among nematodes and accelerated evolution NDC; BÉRGAMO, FLK; COSTA, ASV; Genetic diversity of the root-knot nematode toward crown clades. Molecular Biology and PREZOTTI, L. 2007. Nematofauna associada Meloidogyne enterolobii and development Evolution 23: 1792-1800. à cultura do quiabo na região leste de Minas of a SCAR marker for this guava-damaging Gerais. Horticultura Brasileira 25: 88-93. species. Plant Pathology 59: 1054-1061.HUSSEY, RS; BARKER, KR. 1973.Acomparison ZIJLSTRA, C. 2000. Identification of Meloidogyne of methods for collecting inocula of RANDIG, O; BONGIOVANNI, M; CARNEIRO, chitwoodi, M. fallax and M. hapla based on Meloidogyne spp. including a new technique. RMDG; CASTAGNONE-SERENO, P. 2002. SCAR-PCR: a powerful way of enabling Plant Disease Reporter 57: 1025-1028. Genetic diversity of root-knot nematodes from reliable identification of populations or Brazil and development of SCAR markers individuals that share common traits. EuropeanJEPSON, SB. 1987. Identification of root-knot specific for the coffee-damaging species. Journal of Plant Pathology 106: 283-290. nematodes (Meloidogyne species). 1st ed. Genome 45: 862-870. Wallingford: CAB International. ZIJLSTRA, C; DONKERS-VENNE, DTHM; ROSA, JMO; WESTERICH, JN; WILCKEN, FARGETTE, M. 2000. Identification ofMEDINA, IL; GOMES, CB; CORREA, VR; SR. 2013. Nematoides das galhas em áreas de Meloidogyne incognita, M. javanica and MATTOS, VS; CASTAGNONE-SERENO, cultivo de olerícolas no estado de São Paulo. M. arenaria using sequence characterised P; CARNEIRO, RMDG. 2017. Genetic Nematologia Brasileira 37: 15-19. amplified regions (SCAR) based PCR assays. diversity of Meloidogyne spp. parasitising Nematology 2: 847-853. potato in Brazil and aggressiveness of M. SALGADO, SML; GUIMARÃES, NMRB; javanica populations on susceptible cultivars. B O T E L H O , C E ; TA S S O N E , G AT; Nematology 19: 69-80. MARCELO, AL; SOUZA, SR; OLIVEIRA, RDL; FERREIRA, DF. 2015. MeloidogyneMENG, Q; LONG, H; XU, J. 2004. PCR assaysHortic. bras., Brasília, v.36, n.4, October-December 2018 479

ResearchPOOT-POOT, WA; DELGADO-MARTÍNEZ, R; CASTRO-NAVA, S; SEGURA-MARTÍNEZ, MT; CARREÓN-PÉREZ, A; HERNÁNDEZ-MARTÍNEZ, JG.. 2018. Effect of salicylic acid on pre-transplant acclimatization of native tomato populations. Horticultura brasileira 36: 480-485. DOI - http://dx.doi. org/10.1590/S0102-053620180409Effect of salicylic acid on pre-transplant acclimatization of native tomatopopulationsWilberth A Poot-Poot; Rafael Delgado-Martínez; Sergio Castro-Nava; Ma Teresa Segura-Martínez; AlejandroCarreón-Pérez; Jesús Guillermo Hernández-Martínez11Facultad de Ingeniería y Ciencias de la Universidad Autónoma de Tamaulipas, Ciudad Victoria, Tamaulipas, México;[email protected] (corresponding author) ABSTRACT RESUMO The aim of this study was to evaluate the effect of salicylic Efeito do ácido salicílico na aclimatização pré-transplante deacid (SA) application on pre-transplant acclimatization of native populações de tomate nativopopulations of tomato. SA is a growth regulator that modifies plantgrowth and development by inducing changes in cell processes, O objetivo deste estudo foi avaliar o efeito da aplicação do ácidophysiology and morphology. Five populations of native tomato salicílico (SA) na aclimatização pré-transplante de populações na-were sown in polystyrene trays. Peat moss was used as substrate tivas de tomateiro. SA é um regulador de crescimento que modificaand plants were maintained at field capacity continuously. After o crescimento e desenvolvimento das plantas, induzindo mudançasemergence, seedlings were applied during three weeks with different nos processos celulares, na fisiologia e morfologia das plantas. Cincoconcentration of SA (0.0, 0.01, 0.1, 0.5 and 1.0 μM). A completely populações de tomate nativo foram semeadas em bandejas de polies-random experimental design was used with five replications per tireno. Usou-se turfa como substrato. As plantas foram mantidas emtreatment. The growth parameters evaluated were height, stem capacidade de campo continuamente. Após a emergência, aplicou-diameter, number of leaves, hypocotyl length, shoot fresh and dry -se nas plântulas, durante três semanas, diferentes concentraçõesweight (leaves and stem), and root length and fresh and dry weight. de SA (0,0; 0,01; 0,1; 0,5 e 1,0 μM). O delineamento experimentalAn analysis of variance was carried out, and means were compared foi inteiramente casualizado, com cinco repetições por tratamento.with the Tukey test (5%) using SAS statistical software. The recorded Os parâmetros de crescimento avaliados foram altura, diâmetro dodata show that pre-transplant seedlings of each of the evaluated caule, número de folhas, comprimento do hipocótilo, massa fresca epopulations responded significantly (P=0.01) to the SA treatments. seca (folhas e caule) e comprimento da raiz e peso fresco e seco. OsAlso, the comparison of means of each of the factors under study dados foram submetidos à análise de variância e as médias foramshowed positive changes. With the concentrations of 0.5 and 0.1 μM comparadas pelo teste de Tukey (5%) usando o software estatísticoSA, higher values of the studied variables were obtained than with the SAS. Os dados registrados mostram que plântulas pré-transplante deconcentrations 0.01 and 1.0 μM SA. The native tomato populations cada uma das populações avaliadas responderam significativamentesprayed with SA at concentrations of 0.5 and 0.1 μM responded (P=0,01) aos tratamentos com SA. Ainda, a comparação das médiaspositively in terms of seedling growth and development. Based on de cada um dos fatores em estudo mostrou mudanças positivas. Comthese findings, SA treatments can help acclimatize and present better as concentrações de 0,5 e 0,1 μM SA, foram obtidos valores maisgrowth conditions to the seedlings before being transplanted. elevados das variáveis estudadas do que com as concentrações 0,01 e 1,0 μM SA. As populações de tomate nativas pulverizadas com SA em concentrações de 0,5 e 0,1 μM responderam positivamente em termos de crescimento e desenvolvimento de plântulas. Baseado nesses resultados, os tratamentos SA podem ajudar a aclimatar e apresentar melhores condições de crescimento às mudas antes de serem transplantadas.Keywords: Lycopersicon esculentum, stress tolerance, chlorophyll, Palavras-chave: Lycopersicon esculentum, tolerância ao estresse,carotenoids, growth regulators. clorofila, carotenóides, reguladores de crescimento. Received on August 24, 2017; accepted on October 30, 2018Production using transplanted horticultural sector is experiencing an substrates, fertilization programs for seedlings of vegetable crops is increasingly marked trend toward early seedlings, multiple cavities plug trays,an important method for vegetable or out-of-season production, seeking high value hybrids and the use ofgrowers. Healthy seedlings ensure the market niches that allow growers to greenhouses have contributed to thesuccessful development of the plants obtain better sales prices and improve growth of the industry, by increasingand ultimately result into more profits their economic capacity. Advances in the security of crops (Samaniego etfor the farmer (Gupta et al., 2012). The transplant, such as the use of special al., 2002). In this sense, it is expected480 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Effect of salicylic acid on pre-transplant acclimatization of native tomato populationsthat the production and consumption of on the vegetative growth of tomato abiotic stresses and other traits relatedcertain vegetables such as tomatoes will seedlings (Lycopersicon esculentum) whit yield and quality. Seeds werecontinue to increase and, to address the when sprinkled with low concentrations germinated in polystyrene trays withsustainability of this sector, intensive of SA (0.0001, 0.01, 1.0 μM), also peat moss substrate in blocks of 5 x 5 forresearch should be carried out to saw that the concentration of 1.0 μM a total of 25 cavities for each populationdevelop varieties with better agricultural improves the size of the stem and the and a total of 125 seeds for the wholecharacteristics and the maximization length of the roots. So, the application experiment. One seed was sown perof seedling technology (Gerszberg & of SA to native tomato seedlings could cavity and moistened with 100 mLHnatuszko-Konka, 2017). be a strategy to improve the quality water. The tray was then covered with and health of the seedling, improving black polyethylene bags to simulate The application of compounds its morphological and physiological a germination chamber and placed onknown as growth promoters or characteristics. For this reason, the aim metal tables where they were maintainedbioregulators is one of the strategies of this study was to evaluate the effect and supervised during the experiment.increasingly used in agricultural practice of SA application on seedlings native On the third day after sowing (DAS), theto stimulate the development of plants populations of tomato by measuring the bag was removed from the trays once itsand increase their resistance to abiotic growth parameters. objective of stimulating germination hadand biotic stresses (Bulgari et al., 2014) been fulfilled. From the fourth day on,improving the quality and health of MATERIAL AND METHODS the seedlings were hydrated only withplants. Plants employ many strategies water for 15 days.in response to abiotic stresses that The experimental work wasultimately enhance the plant growth and conducted during the summer 2016 on From day 16 on (seedlings withproductivity in stressful environments. the experimental field of the Laboratorio 10 cm height and two expandedThese phenomena include change in de Biotecnología Vegetal de la Facultad leaves) the seedlings were sprayedmorphological and developmental de Ingeniería y Ciencias at the with concentrations of SA (0 control,pattern (growth plasticity) as well as Universidad Autónoma de Tamaulipas, 0.01, 0.1, 0.5 and 1 µM) for 21 days,physiological and biochemical processes located in the municipality of Victoria, each 3 days. Time of application wasagainst several stresses (Tuteja, 2007). Tamaulipas, Mexico (23°42’52”N, between 7:00 and 8:00 hours while the 99°9’12”W, 316 m altitude). seedlings were in the trays. The nozzle Plant hormones play vital roles in of the hand-held sprayer was adjustedthe ability of plants to acclimatize to The treatments were distributed in an to deliver 0.5 mL of solution per sprayvarying environments by mediating experimental design of random blocks and two shots were done so that eachgrowth, development and nutrient with five replications per treatment; plant received 1 mL of SA (for each oneallocation (Fahad et al., 2015). Salicylic one seedling was the experimental of the concentrations) or distilled wateracid (SA) is a plant hormone that unit. The treatments consisted of five for control. The application was direct,not only mediates plant defense concentrations of SA [0 (control), 0.01, being all foliage sprayed. SA sprayingresponses against biotic and abiotic 0.1, 0.5 and 1 µM] and five native with an atomizer was alternated withstresses but also plays a crucial role tomato populations (LOB2, LOB4, auxiliary irrigation (100 mL water) toin regulating many physiological and LOB5, LOB6, LOB8), the combination maintain the level of moisture of thebiochemical processes during the entire of these were 25 treatments and 125 substrate in the trays, according to theplant lifespan (Zhang et al., 2017) experimental units in total, a seedling visual quality of the plants and theas well as multiple aspects of plant was a repetition. The salicylic acid climatic conditions.growth and development, including solutions (Merck) used in the presentseed germination, vegetative growth, study were prepared following the At 36 DAS (time required to performflowering, fruit yield, senescence, methodology defined by Gutiérrez- a transplant), the following parametersroot initiation/growth (Khan et al., Coronado et al. (1998). were determined for each one of the2015) some of these processes are seedlings, according to the Internationalinduced by SA in a concentration- Seeds from five native tomato Plant Genetic Resources Institutedependent manner, as they are activated populations (25 of each populations) (IPGRI, 1996) tomato descriptor: CH=by treatment with a low dose of SA and from the states of Puebla and Hidalgo, color of hypocotyl; CIH= color intensityinhibited by a high dose (Dempsey & Mexico were sown (Table 1). These of the hypocotyl; HP= hypocotylKlessig, 2017). seeds were provided by Dr. Ricardo pubescence; LPL= length of the primary Lobato Ortíz, specialist in the collection leaf (cm); PLWd= primary leaf width Induction of a larger number of roots of tomato genetic material plant genetic (cm); PH= plant height (cm); SD=in tomato seedlings is fundamental in the resources and plant breeding of tomato stem diameter (cm); NL= number ofpre-transplant stage since they depend on and related species as well as the use leaves; LL= leaf length (cm); LWd= leafadequate uptake of water and nutrients of Mexican native tomato landraces width (cm); RL= root length (cm); RV=for later development (Larqué-Saavedra and wild species as a source of new root volume (mL); LWg= leaf weight& Martín Mex, 2007). On the other allele combinations for biotic and (mg); SWg= stem weight (mg); RW=hand, Larqué-Saavedra et al. (2010) root weight (mg); Chla= chlorophyllreported similarly favorable effectsHortic. bras., Brasília, v.36, n.4, October-December 2018 481

WA Poot-Poot et al.a; Chlb= chlorophyll b; TotCar= total Table 1. Collection of native tomatoes from the states of Puebla and Hidalgo. Mexico,carotenoids. Plant height was measured Universidad Autónoma de Tamaulipas, 2016.from the base of the trunk to the firstterminal flower with a graduated ruler. Identification Growth habit Local name Municipality StateStem diameter was measured with amanual Vernier at 5 cm from the stem LOB2 Indeterminate Arriñonado Cuetzalan Pueblabase. Root volume was evaluated by LOB4 Indeterminate Arriñonado Cuetzalan Puebladisplacement of volume in water. The LOB5 Indeterminate Chino criollo Tehuacán Pueblaphotosynthetic pigments, chlorophyll a, LOB6 Indeterminate Chino criollo Tehuacán Pueblab and total carotenoids were quantified LOB8 Indeterminate Ojo de venado Zacualtipán Hidalgoaccording to the methodology reportedby Lichtenthaler (1987). LOB refers to Dr. Ricardo Lobato Ortiz, who provided the seed. Data were submitted to the analysisof variance (F test) and the Tukey testof comparison of means (5%), using thestatistical program SAS.RESULTS AND DISCUSSION The data analysis of variance show Figure 1. Height of seedlings (cm) from native tomato populations sprayed with differentthat the seedlings from native tomato concentration of SA. Mexico, Universidad Autónoma de Tamaulipas, 2016.populations respond significantly toSA treatments in all growth parameters(Table 2). The differences amongpopulations, SA application and theinteraction populations x SA applicationare visible in morphological parameterssuch as seedling height, root length,root volume, root weight principally(P≤0.01) and for length, width and leafweight, stem weight, and photosyntheticpigments as chlorophyll a, chlorophyllb and total carotenoids (5%). Thus theresponse to exogenous SA applicationis specific for each plant. Usually, SA atrelatively low concentrations enhanced,Table 2. Analysis of variance of the growth parameters, based on the effect of salicylic acid (SA) on seedlings from native tomato popula-tions (P). Mexico, Universidad Autónoma de Tamaulipas, 2016.FV CH CIH HP LPL PLWd PH SD NL LLP ** ** ** ** ** ** * * **SA ns ns ns ns ns ** ns ns *P*SA ns ns ns ns ns ** ns ns *CV (%) 14 25 35 14 25 22 31 26 36 LWd RL RV LWg SWg RWg Chla Chlb TotCarP ** ** ** * * ** * * *SA * ** ** * * ** * * *P*SA * ** ** * * ** * * *CV (%) 34 15 32 31 11 21 16 32 32ns; *, **: Not significant and significant (P ≤ 0.5, 0.1 respectively); CH: color of hypocotyl; CIH: color intensity of the hypocotyl; HP:hypocotyl pubescence; LPL: length of the primary leaf; PLWd: primary leaf width; PH: plant height; SD: stem diameter; NL: number ofleaves; LL: leaf length; LWd: leaf width; RL: root length; RV: root volume; LWg: leaf weight; SWg: stem weight; RWg: root weight; Chla:chlorophyll a; Chlb: chlorophyll b; TotCar: total carotenoids.482 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Effect of salicylic acid on pre-transplant acclimatization of native tomato populationsand at relatively high concentrations morphology is the result of many study SA was applied seven times, whiledecreased growth in diverse plant physiological processes that favor said in the comparative study of Yildirimspecies (Rivas-San Vicente & Plasencia, expression at the level of the organism. It & Dursun (2009) SA was applied four2011). Moreover, the differences is perhaps not surprising that conflicting times. Also, it is necessary to define theare due mainly to their geographic reports have been published concerning quantity of SA that penetrates the tissueorigin and type of tomato which are the effect of exogenously supplied SA and produces cascade effects that resultmorphologically different (Table 1). In on various plant processes (Dempsey in morphological changes that can bethis sense Dempsey & Klessig (2017) & Klessig, 2017). It is important to quantified and to define whether theremention that this type of conduct is conduct experiments to solve some is one or more receptors of SA since nonormal, given the wide range in basal SA methodological issues, such as the studies report this in the literature.levels between (and even within) plant number of applications necessary tospecies. The effect of SA on seedlings produce the desired effects since in our Height was modified by both genotype and SA application (FigureFigure 2. Content of chlorophylls a, b and total carotenoids in seedlings from native tomato 1). Within and between the nativepopulations in function of the effect of salicylic acid. Mexico, Universidad Autónoma de populations there were differences inTamaulipas, 2016. seedling height. Significant differences among populations due to level of SA application were also found (Table 2). The highest seedling height was presented in LOB6 (14.5 cm) with the concentrations 0.01 μM SA and 1.0 μM SA, followed by LOB2 (12.3, 11.8, 11.5 cm) with concentrations 0.5, 1.0 and 0.1 μM SA respectively and LOB8 (12 cm) with the concentration 0.01 μM SA. In LOB2 the concentration of 0.5 μM SA led to an increase in height of up to 38% compared to the control, which received only distilled water (Figure 1). Similar results were reported by Larqué- Savedra et al. (2010). Although not all treatments followed the same trend, there were exceptions such as the case of LOB8 which, with low doses (0.01 μM) of SA, presented seedlings up to 30% taller than those in high-dose (1.0 μM) of SA treatments. In this sense, Dempsey & Klessig (2017) indicate that the levels of SA vary greatly even within the same species of plant, depending on subcellular location, tissue type, developmental stage, and with respect to both time and location after an environmental stimulus and that this provides a tremendous flexibility and multiple mechanisms through which the SA can act in the plants. Chlorophyll a, chlorophyll b and total carotenoids content was different in seedlings of tomato native populations treated with different concentrations of SA (Figure 2). A clear difference among native populations is observed; the populations with the highest content of these photosynthetic pigments were LOB2 and LOB8. The rest of the populations (LOB4, LOB5Hortic. bras., Brasília, v.36, n.4, October-December 2018 483

WA Poot-Poot et al.Figure 3. Root weight (mg), root volume (mL) and root length (cm) in tomato populations and LOB6) did not have the samesprayed with different concentration of SA. Mexico, Universidad Autónoma de Tamaulipas, tendency, and therefore there were no2016. significant changes in the content of these pigments. However, for LOB2 the concentration 1.0 μM of SA increased the content of chlorophyll a, b and total carotenoids (74%, 84% and 79% respectively) with respect to the control. Similarly, in LOB8 the two highest concentrations of SA (0.5 μM and 1.0 μM) had the same effect with respect to the content of the photosynthetic pigments (0.3900, 0.2560, 0.4230 mg/ mL respectively for chlorophyll a, b and total carotenoids) increasing in a 38%, 60% and 44% respect to control; Therefore, the increase or decrease in the content of photosynthetic pigments (chlorophylls and carotenoids) after SA applications depend on the species and the cultivar (Arfan et al., 2007). In this sense, Zhang et al. (2007) reported that the chlorophyll content in leaves was a very important parameter for evaluating the physiological state of plants. All green leaves have a higher absorption capacity in the range of 400 – 700 nm; in this range transmission of electrons between chlorophylls and carotenoids occurs. Moreover, the content of photosynthetic pigments can change as a response to stress-causing factors, depending on the photosynthetic capacity or the development stage of the plant (Ustin et al., 1998). Generally, low concentrations of applied SA alleviate the sensitivity to abiotic stresses, and high concentrations of applied SA induce high levels of oxidative stress, leading to a decreased tolerance to abiotic stresses (Miura & Tada, 2014). The effect of SA on tomato seedlings of native populations with respect to root growth presented different responses (Figure 3). The same SA concentration (0.01 μM) stimulated root weight in LOB2 (724 mg), LOB5 (606 mg) but inhibit it in LOB4 (242 mg), LOB6 (364 mg) and LOB8 (390 mg). However, Yildirim et al. (2008) indicate that the application of SA increases root growth. On the other hand, for root volume, LOB2 and LOB5 populations obtained the highest values, which may indicate a greater root area, but not necessarily a greater length. In484 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Effect of salicylic acid on pre-transplant acclimatization of native tomato populationsthis sense, LOB4 was the population Does exogenous application of salicylic salicílico en el crecimiento de plántulas dewith the highest root length (8.2 cm) acid through the rooting medium modulate tomate (Lycopersicon esculentum Mill.).with the concentration of 1.0 μM SA, growth and photosynthetic capacity in two Revista Chapingo 16: 183-187.followed by LOB6 and LOB2 with 7.5 differently adapted spring wheat cultivarscm and 6.9 cm respectively. Khan et al. under salt stress? Journal of Plant Physiology LICHTENTHALER, HK. 1987. Chlorophyll(2015) reported that SA stimulated the 164: 685-694. and carotenoids: pigments of photosyntheticroot formation of some crops. In this biomembranes. Methods in Enzymology 148:sense, Larqué-Saavedra et al. (2010) BULGARI, R; COCETTA, G; TRIVELLINI, 331-382.indicate that the tomato is a species A; VERNIERI, P; FERRANTE, A. 2014.sensitive to SA, so, as the concentration Biostimulants and crop responses: a review. MIURA, K; TADA, Y. 2014. Regulation of water,increases, root formation is favored. Journal of Biological Agriculture & salinity, and cold stress responses by salicylicTherefore the productivity of plant Horticulture 31:1-17. acid. Frontiers in Plant Science 5: 1-12.crops cannot be considered withoutthe existence of good root apparatus. DEMPSEY, DA; KLESSIG, F. 2017. How does RIVAS-SAN, VM; PLASENCIA, J. 2011.It has been suggested that SA has the multifaceted plant hormone salicylic Salicylic acid beyond defense: its role ingreat agronomic potential to improve acid combat disease in plants and are similar plant growth and development. Journa oflthe stress tolerance of agriculturally mechanisms utilized in humans? BMC Biology Experimental Botany 62: 3321-3338.important crops. In commercial 15: 1-11.plantations SA can be expected to have SAMANIEGO, CE; QUEZADA, MMR; ROSA,an impact on productivity of these FAHAD, S; NIE, L; CHEN, Y; WU, C; XIONG, IM; MUNGUÍA, LJ; BENAVIDES, MA;highly economically important plants. D; SAUD, S; HONGYAN, L; CUI, K; IBARRA, JL. 2002. Producción de plántulas deHowever, the utility of SA is dependent HUANG, J. 2015. Crop plant hormones and tomate y pimiento con cubiertas de polietilenoon the concentration of the applied SA, environmental stress. Sustainable Agriculture reflejante para disminuir la temperatura enthe mode of application, and the state Reviews 15: 371–400. invernadero. Agrociencia 36: 305-318.of the plants (e.g., developmental stageand acclimation). GUPTA, MK; CHANDRA, P.; SAMUEL, DVK; TUTEJA, N. 2007. Mechanisms of high salinity SINGH, B; SINGH, A. GARG, MK. 2012. tolerance in plants. Methods in Enzymology ACKNOWLEDGEMENTS Modeling of tomato seedling growth in 428: 419-438. greenhouse. Agricultural Research 1: 362-369. We thank to PROMEP Mexico USTIN, SL; SMITH, MO; JACQUEMOUD, S;for the support grant for the project GERSZBERG, K; HNATUSZKO, K. 2017. VERSTRAETE, MM; GOVAERTS, Y. 1998.“Production, conservation and Tomato tolerance to abiotic stress: a review of Geobotany: Vegetation mapping for earthcapacitation of horticultural genetic most often engineered target sequences. Plant sciences. In: RENCZ, AN (ed). Manual ofresources”, which forms part of the Growth Regulators 83: 1-24. remote sensing: Remote sensing for the earthresearch network on horticultural sciences, 3rd ed. Hoboken: John Wiley. vol. 3,genetic resources. GUTIERREZ-CORONADO, MA; TREJO- (p189−248). LÓPEZ, C; LARQUÉ-SAAVEDRA, A. 1998. REFERENCES Effects of salicylic acid on the growth of roots YILDIRIM, E; TURAN, M; GUVENC, I. 2008. and shoots in soybean. Plant Physiology and Effect of foliar salicylic acid applications onARFAN, M; ATHAR, H; ASHRAF, M. 2007. Biochemistry 36: 563-565. growth, chlorophyll, and mineral content of cucumber grown under salt stress. Journal of IPGRI, International Plant Genetic Resources Plant Nutrition 31: 593-612. Institute. 1996. Descriptores de Tomate (Lycopersicon spp.). Roma: Ed. Instituto YILDIRIM, E; DURSUN, A. 2009. Effect of foliar Internacional de Recursos Fitogenéticos. 49 p. salicylic acid applications on plant growth and yield of tomato under greenhouse conditions. KHAN, MIR; FATMA, M; PER, TS; ANJUM, Acta Horticulturae 807: 395-400. NA; KHAN, NA. 2015. Salicylic acid-induced abiotic stress tolerance and underlying ZHANG, Y; CHEN, JM; THOMAS, SC. 2007. mechanisms in plants. Frontiers in Plant Retrieving seasonal variation in chlorophyll Science 6: 1-17. content of over story and understory sugar maple leaves from leaf level hyperspectral LARQUÉ-SAAVEDRA, A; MARTÍN-MEX, data. Canadian Journal of Remote Sensing R. 2007. Effects of salicylic acid on the 33: 406-415. bioproductivity of plants. In: HAYAT, S; AHMAD, A (eds). Salicylic acid a plant ZHANG, Y; ZHAO, L; ZHAO, J; LI, Y; WANG, hormone. The Netherlands :Springer. 401p. J; GUO, R; GAN, S; LIU, CJ; ZHANG, K. 2017. S5H/DMR6 encodes a salicylic acid LARQUÉ-SAAVEDRA, A; MARTÍN, MR; 5-hydroxylase that fine-tunes salicylic acid NEXTICAPAN, GÁ; VERGARA, YS; homeostasis. Plant Physiology 175: 1082- GUTIÉRREZ, RM. 2010. Efecto del ácido 1093.Hortic. bras., Brasília, v.36, n.4, October-December 2018 485

ResearchGONÇALVES, LSA; GOMES, GP; DAMASCENO JUNIOR, CV; QUEIROZ, RA; TAKAHASHI, LSA; COSTA, DS; NUNES, MPBA. 2018. Seed physiological potential of “dedo-de-moça” pepper in relation to maturation stages and rest periods of the fruits. Horticultura Brasileira 36: 486-491. DOI - http://dx.doi.org/10.1590/S0102-053620180410Seed physiological potential of “dedo-de-moça” pepper in relation tomaturation stages and rest periods of the fruitsLeandro SA Gonçalves; Gisely Paula Gomes; Clério Valentin Damasceno Junior; Robison Alessandro deQueiroz; Lucia SA Takahashi; Denis S da Costa; Maria PBA Nunes11Universidade Estadual de Londrina (UEL), Londrina-PR, Brazil; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected] ABSTRACT RESUMO One of the main problems in pepper seed production is the uneven Potencial fisiológico de sementes de pimenta “dedo-de-moça”maturation of the fruits due to the continuous flowering period of em função do estádio de maturação e do repouso dos frutosthe plant, making it difficult to harvest all the fruits at the sametime. Thus, studies on fruit maturation stage and seed physiological Um dos principais problemas na produção de sementes depotential are extremely important in order to identify the appropriate pimentas é a maturação desuniforme dos frutos. Isso ocorre devidoharvest time, avoiding seed deterioration. The aim of this study was ao florescimento contínuo da planta, dificultando que a colheita sejato evaluate the physiological potential of five genotypes of “dedo realizada de uma única vez. Dessa forma, estudos sobre o estádiode moça” pepper seeds (Capsicum baccatum var. pendulum) in de maturação dos frutos e o potencial fisiológico das sementes sãothree maturation stages (green, orange and red), with and without de grande relevância para se identificar o momento adequado de10-day rest period after harvest date. Physiological potential and colheita evitando a deterioração das sementes. O presente trabalhovigor of seeds were evaluated through germination tests (first count, teve como objetivo avaliar o potencial fisiológico de sementes deaccelerated aging and electrical conductivity). The observed results pimenta de cinco genótipos de “dedo-de-moça” (Capsicum baccatumwere submitted to variance analysis, comparing averages through var. pendulum) em três estádios de maturação (verde, alaranjado eTukey test and principal components analysis. In general, red fruits vermelho), sem e com repouso de 10 dias dos frutos a partir da co-reflected seed maturity since they provided maximum germination. lheita. As avaliações foram realizadas quanto ao potencial fisiológicoOn the other hand, even fruits harvested at a maturation stage prior representado pelos testes de germinação e vigor (primeira contagem,to red (green and orange), showed the benefits of the rest periods on condutividade elétrica e envelhecimento acelerado). Os resultadosgermination and vigor characteristics, being this result more evident observados foram submetidos à análise de variância e as médiasin green fruits which, initially, had lower physiological potential. The comparadas pelo teste de Tukey, bem como à análise de componentesevaluated genotypes showed lower physiological potential of fruits principais. De modo geral, a coloração vermelha dos frutos refletiuharvested at the green stage, without 10-day rest period. a maturidade das sementes por proporcionar a máxima germinação. Por outro lado, mesmo que os frutos sejam colhidos em estádio de maturação anterior ao vermelho (verde e alaranjado) o período de repouso mostrou-se benéfico para características de germinação e vigor, sendo este resultado mais evidente nos frutos verdes que inicialmente possuíam potencial fisiológico inferior. Os genótipos avaliados apresentaram potencial fisiológico inferior quando tiveram seus frutos colhidos verdes sem o repouso por 10 dias.Keywords: Capsicum baccatum var. pendulum, accelerated aging, Palavras-chave: Capsicum baccatum var. pendulum, envelhecimentogermination, vigor. acelerado, germinação, vigor. Received on June 12, 2017; accepted on June 22, 2018The genus Capsicum is a vegetable C. annuum, C. frutescens, C. chinense, pepper” is one of the most used in dedicated to fresh consumption C. pubescens and C. baccatum (DeWitt Brazilian cuisine due to its sensorialand condiments, spices and preserved & Bosland, 2009). quality (color, flavor and pungency).products (Moreira et al., 2013). Based This pepper is widely consumed both inon floral characteristics, such as shape The species C. baccatum is one of natura as well as processed, in the formof the calyx, color of the chorolla and the main peppers grown in Brazil by of sauces and dehydrated (Carvalho etnumber and orientation of flowers per family farmers (Villela et al., 2014). al., 2009; Cardoso et al., 2018).node, this genus is classified into 38 Among the different types of peppersspecies (USDA, 2011), considering that belonging to this species, “dedo-de- Although “dedo-de-moça” pepperonly five are considered domesticated: moça”, also known as “chifre-de- is a vegetable of great acceptance in veado”, “red pepper” and “Calabrian the Brazilian market, only four cultivars486 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Seed physiological potential of “dedo-de-moça” pepper in relation to maturation stages and rest periods of the fruitsare available for commercialization maturation stages (green, orange and dry paper mass, in Gerbox-type plastic(MAPA, 2016). According to Justino et red), without and with 10-day of post- boxes (11×11×3.5 cm). The samplesal. (2015), the lack of interest of seed harvest rest period. were kept in a germination chamber atproducing companies to develop new 30° C temperature and two evaluationsCapsicum spp. cultivars is related to MATERIAL AND METHODS were performed: the first called firstdeficiencies in production techniques, germination count at day 8 and thelow yield, difficulty of extraction and “Dedo-de-moça” pepper fruits were second at day 14 after sowing. Theproblems related to seed physiological harvested on May, 2015, from 60 plants normal seedling criterion was adoptedpotential. grown in a greenhouse at Centro de according to criteria established by the Ciências Agrárias from Universidade Rules for Seed Analysis (RAS) and the The uneven fruit ripening, resulting Estadual de Londrina (UEL), Londrina, results expressed in percentage (Brasil,from plant continuous flowering is one Paraná, Brazil (23º22’S, 51º10’W; 2009).of the main problems in production of altitude 585 m). Five genotypes wereCapsicum spp. seeds, since this makes used, being three commercial cultivars Accelerated aging test was installedit difficult to harvest the fruits at the (Horticeres, Hortivale and BRS Mari) distributing 1.0 g of single-layersame time. Thus, the knowledge about and two accessions from the germplasm seeds onto a stainless steel mesh traythe relationship fruit ripening and seed bank of UEL (UEL 110 and UEL 111). coupled with Gerbox-type plastic boxesripening is of great relevance, since (11×11×3,5 cm), containing 40 mLit determines the appropriate harvest During flowering phase, pepper distilled water. The seeds were kept in antime, avoiding lots of immature seeds flowers were dated daily, and from incubator at 42°C for 96 hours (AOSA,or under advanced deterioration process. anthesis, up to obtain from 40 to 60 1983). Right after, the seeds wereIn this context, several studies have fruits of each genotype. At harvest, placed to germinate and on the 8th daybeen carried out in order to determine fruits were removed from plants based evaluated; the results were expressedthe ripening process of pepper seeds on their coloration and classified as in percentage of normal seedlingsand identify the appropriate time for green [unripe fruits, 48 to 53 days after (Baalbaki et al., 2009).harvest, which results in production of anthesis (DAA)], orange (intermediate,high-quality seeds (Queiroz et al., 2011; 58 to 63 DAA) and red (ripe fruits, 67 For electrical conductivity test,Vidigal et al., 2011; Abud et al., 2013; to 72 DAA). the authors used four replicates of 50Pereira et al., 2014; Justino et al., 2015). seeds. These seeds were immersed in 25 Seeds were extracted manually, mL distilled water and kept in a BOD In addition to studies on maturation from one part of harvested fruits, right incubator at 25°C for 48 hours; usingand harvest time, other researchers point after harvest, washed in running water a portable digital conductivity meterout that seeds kept inside the fruit after and kept for drying for approximately (model HI98300, Hanna), the electricalharvest, for some time, continue the 48 hours under monitored closed conductivity of the imbibition solutionmaturation process, reaching high levels environmental conditions (25±2°C). was determined. Results were expressedof germination and vigor (Vidigal et al., The remaining fruits were kept at rest in µS.cm-1 g-1 of seeds (Vidigal et al.,2009; Ricci et al., 2013). For “dedo- for 10 days under 25°C temperature 2008).de-moça” pepper, Pereira et al. (2014), and 71% relative humidity, and then,evaluating fruits in four maturation the seeds were extracted manually, The obtained data were tested forstages [15, 25, 35 and 45 days after washed in water and dried under similar normality and homogeneity of variancesanthesis (DAA)] and submitted to rest conditions to ones described previously. by the Shapiro-Wilk and Bartlett tests,period for 0, 5 and 10 days, verified that respectively. Germination and firstthe best germination results occurred at The experiment was carried out in count variables were transformed by45 DAA and that post-harvest rest period a completely randomized design in afor 10 days improved seed physiological factorial scheme 3×2×5, being three arcsinpotential. On the other hand, Justino et maturation stages (green, orange andal. (2015), evaluating seven ripening red), two rest periods of the fruits (post- to meet the assumptions of the analysisstages (20, 30, 40, 50, 60, 70 and 80 harvest extraction or after 10 days) and of variance. Afterwards, data wereDAA) verified that seed physiological five genotypes, with four replicates. submitted to variance analysis andpotential occurred at 70 DAA, when averages compared using Tukey test atthe fruits showed red color. Thus, the Seeds were submitted to tests to 5%. Principal components analysis wasauthors verified differences in results for determine the degree of moisture, also used as database. All analyses wereripening of “dedo-de-moça” pepper, and germination and vigor (first count, done with the aid of program R (http://this fact may be the cause of genotypic accelerated aging and electrical www.r-project.org) using packageor environmental variation. conductivity). Germination test was ExpDes (Ferreira et al., 2014) and conducted in four replicates and 50 FactoMineR (Lê et al., 2008). Thus, in this study we aimed to seeds per treatment distributed onevaluate seed physiological potential two germitest paper sheets, moistened RESULTS AND DISCUSSIONof “dedo-de-moça” pepper (Capsicum with 0.2% potassium nitrate solutionbaccatum var. pendulum) in three (KNO3) equivalent to 2.5 times the Using variance analysis, the authorsHortic. bras., Brasília, v.36, n.4, October-December 2018 487

LSA Gonçalves et al.observed a significant effect for variation maturation and rest period of the period the seeds had completed theirsources: rest periods of the fruits (R), pepper fruits. Coefficients of variation maturation process (Table 1).maturation stage (EM) and genotypes were 11.62, 17.87, 8.39 and 14.15%(G) for the most evaluated variables. for germination, first count, ENV and Post-harvest extraction from greenA significant effect was observed for COND, respectively. and orange fruits interrupts the seedall variables, evaluating interactions maturation process resulting in seedsbetween R x EM and EM x G showing For germination and first count, with low physiological potential.differentiated behavior concerning rest higher values of post-harvest extraction However, the seeds remaining insideperiod and maturation stages and also were obtained from red fruits with 94 the fruits for 10 days allowed itsfrom genotypes and change in fruit and 89% germination, respectively, complete maturation. Similar resultsmaturity stage. For interactions R x G whereas for fruits under 10-day rest, were observed by Pereira et al. (2014)and EM x R x G, the authors verified a no differences were observed for the for “dedo-de-moça” pepper harvested insignificant effect only for accelerated three fruit maturity stages (Table 1). different maturation stages and stored foraging (ENV) and electrical conductivity On the other hand, the authors verified 0, 5 and 10 days; The 5 and 10-day post-(COND). These results show existence significant increase in germination harvest storage provided an increaseof genotypic variability regarding the and in the first count, after 10-day rest in seed germination. For bell pepper,types of treatments proposed to evaluate period, for seeds extracted from green another species of genus Capsicum, and orange fruits, showing that in this Teixeira et al. (2006) observed that the seeds extracted from yellowish greenTable 1. Average values of germination (%) and first germination count (%) of C. baccatum fruits, without storage, showed 40%var. pendulum seeds, “dedo-de-moça” type, extracted from fruits after 10-day rest period, and 90% germination after zero andin three maturity stages (green, orange and red). Londrina, UEL, 2016. seven-day storage, repectively. Thus, the results obtained in this study confirmedTreatments Green Maturation stages Red that early-harvested fruits, resting for Orange some days, result in better physiological potential.Post-harvest extraction 22 Cb Germination (%) 94 Aa 76 Bb Genotypical effect was verified using interaction EM x G, for germination and10-day rest period of fruits 93 Aa 97 Aa 94 Aa first count, in which no differentiation of genotypes in red fruit stage was First count (%) observed (Table 2). However, for green fruits, higher values were obtainedPost-harvest extraction 17 Cb 59 Bb 89 Aa for genotypes BRS Mari, Horticeres and Hortivale, whereas for orange10-day rest period of fruits 90 Aa 96 Aa 89 Aa color, higher values were observed for genotypes UEL111, UEL110, BRS MariAverages followed by same uppercase letter in line and lowercase letter in column do not and Hortivale.differ by Tukey test (p<0.5). Some studies have shown someTable 2. Seed germination and first germination count of five C. baccatum var. pendulum, variability in germination and vigor“dedo-de-moça” type genotypes, extracted from fruits in three maturity stages (green, orange of seeds in accessions belonging toand red). Londrina, UEL, 2016. same species, such as for passion fruit (Freitas, 2009), papaya (Cardoso et al.,Genotypes Green Maturation stages Red 2009) and Capsicum spp. (Pessoa et al., Orange 2015). Pessoa et al. (2015), evaluating F2 population of C. annuum, verified Germination (%) variability and high heritability for variables related to seed physiologicalUEL111 53 Bbc 91 Aa 96 Aa potential, considering that these characteristics can be used in the firstUEL110 44 Bc 86 Aa 97 Aa generations of selection aiming to obtain uniformity of emergency and seedlingBRS Mari 68 Ba 84 ABa 94 Aa vigor.Horticeres 61 Bab 67 Bb 93 Aa For accelerated aging test, the genotypes Hortivale, Horticeres andHortivale 66 Bab 93 Aa 98 Aa UEL 111 obtained the highest values when evaluated at red maturation stage, First count (%) without 10-day rest, whereas for fruits at orange stage, the highest values wereUEL111 50 Bab 90 Aa 96 AaUEL110 40 Bb 82 Aa 95 AaBRS Mari 62 Bab 75 ABab 93 AaHorticeres 49 Bab 55 Bb 96 AaHortivale 65 Ba 85 ABa 95 AaAverages followed by same uppercase letter in line and lowercase letter in column do notdiffer by Tukey test (p<0.05).488 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Seed physiological potential of “dedo-de-moça” pepper in relation to maturation stages and rest periods of the fruitsverified for genotypes UEL 111 and stage compared to green fruits (Table 3). harvested at 67 DAA, 7 days of storageHortivale (Table 3). Fruits submitted to Contrarily, no difference for orange and (rest period). This study corroboratesa 10-day rest period, except for green red maturation stages for fruits under the results in this research, in which thematuration stage, did not present any rest period was noticed. authors observed that 10-day rest ofdifference between genotypes at red and fruits resulted in more vigorous seeds,orange stage. Among the green fruits the Comparing post-harvest extraction considering this result more evidenthighest values were observed for BRS and 10-day rest period of the fruits, in green fruits which initially showedMari and Hortivale. the authors observed higher values lower physiological potential (Table 3). for accelerated aging in post-harvest For post-harvest extraction, the rest period of green fruit stage, for For electrical conductivity lowerhighest values for accelerated aging all genotypes; orange stage fruits values for orange and red stages forwere observed at red maturation stage showed the same results, except for the post-harvest extraction were observedfor UEL 111, Horticeres and Hortivale, genotype UEL 111. Red fruits presented (Table 3). For fruits under a 10-daywhereas for UEL 111 and UEL 110 no a difference between post-harvest rest, no differences among maturationdifference at orange and red maturation extraction and 10-day rest period only stages for genotypes BRS Mari andstages was verified. Comparing for genotypes UEL 110 and BRS Mari Hortivale were observed, whereasgenotypes in relation to maturity stages which obtained higher values when the in relation to other genotypes betterof fruits under a 10-day rest period, fruits were in rest period. Queiroz et al. results were obtained for orange and redUEL 110 and Horticeres obtained (2011), evaluating accelerated aging of stages. Comparing presence or absencehigher number of normal seedlings after Habanero Yellow pepper, verified that of rest period of fruits for 10 days,accelerated aging for orange maturation maximum vigor was noticed for seeds differences for the three fruit maturity stages were noticed, considering thatFigure 1. Biplot raph of Principal Component Analysis of pepper genotypes C. baccatum var. higher values were observed for post-pendulum. Green fruits without rest (1A); green fruits with rest (1B); intermediate-colored harvest extraction. For green fruits,fruits without rest (2A); orange fruits with rest (2B); red fruits without rest (3A); red fruits the authors observed differences forwith rest (3B). Londrina, UEL, 2016. genotypes UEL 110, BRS Mari and Hortivale, whereas for orange fruits, the authors observed differences for UEL 111, BRS Mari and Hortivale. For red fruits, the difference mentioned above was observed only for genotypes UEL 110 and Hortivale, showing existence of genotypic variability among the genotypes regarding the rest period in the three maturation stages. In relation to genotypes, BRS Mari obtained the lowest values for the three post-harvest maturation stages, whereas in 10-dayTable 3. Accelerated aging test and electrical conductivity from seeds of five C. baccatum var. pendulum “dedo-de-moça” type genotypes,post-harvest extracted and after 10-day rest period of fruits in three maturity stages (green, orange and red). Londrina, UEL, 2016.Genotypes Post-harvest extraction 10-day rest period Green Orange Red Green Orange RedUEL 111 4 Bc 77 Aa 75 Aab 61 Bb* 74 Aba 82AaUEL 110 31 Ba 55 Abc 56 Ac 71Bab* 88 Aa* 90 Aa*BRS Mary 24 Bba 36 Bd 64 Abc 85Aa* 88 Aa* 90 Aa*Horticeres 15 Cb 48 Bcd 84 Aa 66Bb* 84Aa* 85 AaHortivale 24 Cab 70 Bab 87Aa 86Aa* 87 Aa* 89Aa Electrical conductivity (µS cm-1 g-1 seeds)UEL 111 1.66 Ac 0.99 Bc* 1.00 Bab 1.10 Ab 0.75 Bc 0.95 ABbUEL 110 4.53 Aa* 1.01 Bc 1.15 Bab* 1.13 Ab 1.09 Aa 0.88 BbBRS Mary 2.07Ac* 0.64 Bd* 0.88 Bb 0.42 Ac 0.39 Ad 0.73 AbcHorticeres 2.30 Ac 1.82 Ab 1.30 Ba 2.34 Aa 1.77 Bb 1.59 BaHortivale 3.87 Ab* 2.64 Ba* 1.08 Cab* 0.58 Ac 0.57 Acd 0.46 Ac*Differences between two seed extraction times (post-harvest and 10-day rest period). Averages followed by same uppercase letter in lineand lower case letter in column do not differ by Tukey test (p<0.05).Hortic. bras., Brasília, v.36, n.4, October-December 2018 489

LSA Gonçalves et al.rest period, the lowest values were orange) rest period will be beneficial for NOGUEIRA, DA, 2014. ExpDes: An Rverified for genotypes BRS Mari and germination and vigor characteristics, package for anova and experimental designs.Hortivale. showing similar behavior, with different Applied Mathematics 5: 2952-2958. intensities for each studied genotype, Electrical conductivity test though. Thus, a practical application FREITAS, MVS. 2009. Qualidade fisiológica dasis related to the amount of leached is the possibility of seed producers sementes e parâmetros genéticos de progêniesions, being directly related to cell concentrate the harvest obtaining higher de maracujazeiro amarelo (Passiflora edulis f.membrane integrity (Vidigal et al. total quantities of fruits and that, through flavicarpa). Rio de Janeiro: UENF. 52p. (MSc2008). Thus, the higher the value of the selection and rest period of green and dissertation).electrical conductivity of the soaking orange fruits, could obtain lots of seedssolution, the more unstructured are with high physiological potential. Lastly, JUSTINO, EV; BOITEUX, LS; FONSECA,the membranes. Thus, the results of the authors highlight that the knowledge MEN; SILVA FILHO, JG; NASCIMENTO,electrical conductivity test corroborate about behavioral maturation of the WM. 2015. Determinação da maturidadeaccelerated aging test, since the highest genotype results in greater efficiency fisiológica de sementes de pimenta dedo devalues (more unstructured membranes) for high-quality seed production since moça Capsicum baccatum var. pendulum.were observed for green fruits. The such different responses are observed. Horticultura Brasileira 33: 324-33.authors also noticed that 10-day rest “Dedo-de-moça” genotypes showedperiod helps restructure cell membranes lower physiological potential when LÊ, S; JOSSE, J; HUSSON, F. 2008. Facto Miner:due to the lowest values observed in their fruits were harvested at green stage an r package for multivariate analysis. Journalsome situations after this rest period without 10-day rest period. of Statistical Software 25: 1-18.(Vieira et al., 2002). Similar resultswere found by Pereira et al. (2014) REFERENCES MAPA. Ministério da Agricultura, Pecuária ewho verified reduction of electrical Abastecimento. Accessed at August 15, 2016.conductivity values as the fruits were ABUD, HF; ARAUJO, EF; ARAUJO, RF; Available http://www.agricultura.gov.br/ripening and also during their storage ARAUJO, AV; PINTO, CMF. 2013. Qualidadeperiod, showing higher vigor of “dedo- fisiológica de sementes das pimentas malagueta MOREIRA, SO; RODRIGUES, R; OLIVEIRA,de-moça” pepper seeds. e biquinho durante a ontogênese. Pesquisa HS; MEDEIROS, AM; SUDRÉ, CP; Agropecuária Brasileira 48: 1546-1554. GONÇALVES, LS. 2013. Phenotypic and Using principal components analysis genotypic variation among Capsicum annuum(ACP), the authors observed that two of A S S O C I AT I O N O F O F F I C I A L S E E D recombinant inbred lines resistant to bacterialthe first components explained 88.16% ANALYSTS. 1983. Seed vigor testing spot. Genetics and Molecular Researchof variation, considering that CP1 handbook. East Lansing: AOSA. 88p. 12:1232-1242.and CP2 described 76.1 and 12.1%, (Contribution, 32).respectively (Figure 1). According to PEREIRA, FECB; TORRES, SB; SILVA, MIL;Cruz & Regazzi (2001), when the two BAALBAKI, RS; ELIAS, S; MARCOS-FILHO, GRANGEIRO, LC; BENEDITO, CP. 2014.first variables explain over 70% of total J; McDONALD, MB. 2009. Seed vigor testing Qualidade fisiológica de sementes de pimentavariation, their use is satisfactory in handbook. New York: AOSA. 346p. em função da idade e do tempo de repousothe multivariate study using dispersion pós-colheita dos frutos. Revista Ciênciagraphic of scores in relation to the BRASIL. Ministério da Agricultura, Pecuária e Agronômica 45:737-744.variables. Abastecimento. 2009. Regras para análise de sementes. SDA. Brasilia: Mapa. 399p. PESSOA, AMS; BARROSO, PA; RÊGO, In the two-dimensional graphic ER; MEDEIROS, GA; BRUNO, RLA;dispersion of ACP, the authors could CARDOSO, DL; SILVA, RF; PEREIRA, MG; RÊGO, MM. 2015. Genetic divergence ofnotice two big different groups: the first VIANA, AP; ARAÚJO, EF. 2009. Genetic physiological-quality traits of seeds in agroup defined by the genotypes with diversity and genetic parameters related population of peppers. Genetics and Moleculargreen fruits whose seeds were extracted to physiological seed quality in papaya Research 14: 12479-12488.after harvest, whereas the second group germplasm. Revista Ceres 56: 572-579.was composed of the other treatments QUEIROZ, LAF; PINHO, EVR; OLIVEIRA, JA;(Figure 1A). In this sense, 10-day rest CARDOSO, R; RUAS, CF; GIACOMIN, RM; FERREIRA, VF; CARVALHO, BO; BUENO,period of the green fruit in order to RUAS, PM; RUAS, EA; BARBIERI, RL; ACR. 2011. Época de colheita e secagem nahave their seeds extracted favors seed RODRIGUES, R; GONÇALVES, LSA. 2018. qualidade de sementes de pimenta habanerophysiological potential, obtaining values Genetic variability in brazilian Capsicum yellow. Revista Brasileira de Sementes 33:close to the ones obtained with fruits baccatum germplasm collection assessed by 472-481.harvested at orange and red stages. morphological fruit traits and AFLP markers. Plos One 13: e0196468. RICCI, N; PACHECO, AC; CONDE, AS; Overall, fruit coloration reflected CUSTÓDIO, CC. 2013. Qualidade deseed maturity since it provides CARVALHO, SIC; RIBEIRO, CSC; HENZ, GP; sementes de pimenta jalapenho em função damaximum germination when red color REIFSCHNEIDER, FJB. 2009. BRS Mari: maturação e tempo de permanência nos frutos.was observed. On the other hand, even nova cultivar de pimenta dedo-de-moça para Pesquisa Agropecuária Tropical 43: 123-129.if the fruits are harvested at maturation processamento. Horticultura Brasileira 27:stage before the red stage (green and 571-573. TEIXEIRA, BA; NASCIMENTO, WM; FREITAS, RA. 2006. Maturação de sementes490 CRUZ, CD; REGAZZI, AJ. 2001. Modelos de pimentão ‘Tico’. Horticultura Brasileira biométricos aplicados ao melhoramento 24. Suplemento 1. genético. Viçosa: UFV. 390p. USDA - United States Department of Agriculture. DEWITT, D; BOSLAND, PW. 2009. The Accessed January 14, 2011. Grin species complete chile pepper book. A gardener’s records of Capsicum. Beltsville, Maryland: guide to choosing, growing, preserving and National Germplasm Resources Laboratory. cooking. Portland: Timber Press. 336p. Available at http://www.arsgrin.gov/cgi-bin/ npgs/html/exsplist.pl/ F E R R E I R A , E B ; C AVA L C A N T I , P P ; VIDIGAL, DS; DIAS, DCFS; DIAS, LAS; FINGER, FL. 2011. Changes in seed quality during fruit maturation of sweet pepper. Scientia Agricola 68: 535-539. VIDIGAL, DS; DIAS, DCFS; PINHO, EVR; DIAS, LAS. 2009. Alterações fisiológicas e enzimáticas durante a maturação de sementes de pimenta (Capsicum annuum L.). Revista Brasileira de Sementes 31: 129-136. VIDIGAL, DS; LIMA, JS; BHERING, MC; DIAS, DCFS. 2008. Teste de condutividade Hortic. bras., Brasília, v.36, n.4, October-December 2018

Seed physiological potential of “dedo-de-moça” pepper in relation to maturation stages and rest periods of the fruits elétrica para sementes de pimenta. Revista de soja. Pesquisa Agropecuária Brasileira PRIORI, D. 2014. Caracterização molecular Brasileira de Sementes 30: 168-174. 37: 1333-1338. de pimentas crioulas (Capsicum baccatum) com marcadores microssatélites. HorticulturaVIEIRA, RD; PENARIOL, AL; PERECIN, D; VILLELA, JCB; BARBIERI, RL; CASTRO, Brasileira 32: 131-137. PANOBIANCO, M. 2002. Condutividade CM; NEITZKE, RS; VASCONCELOS, elétrica e teor de água inicial das sementes CS; CARBONARI, T; MISTURA, CC;Hortic. bras., Brasília, v.36, n.4, October-December 2018 491

ResearchPELÁ, A; RIBEIRO, MA; BENTO, RU; CIRINO, LHB; REIS JÚNIOR, RA. 2018. Enhanced-efficiency phosphorus fertilizer: promising technology for carrot crop. Horticultura Brasileira 36: 492-497. DOI - http://dx.doi.org/10.1590/S0102-053620180411Enhanced-efficiency phosphorus fertilizer: promising technology for carrotcropAdilson Pelá1; Matheus A Ribeiro1; Rafael U Bento1; Luiz HB Cirino1; Roberto A Reis Júnior21Universidade Estadual de Goiás (UEG), Ipameri-GO, Brazil; [email protected]; 2WSCT, Londrina-PR, Brazil; [email protected] ABSTRACT RESUMO Several studies were carried out to evaluate polymer-coated Fertilizante fosfatado de eficiência aumentada: umamineral fertilizers; however, few studies, on the agronomic efficiency tecnologia promissora na cultura da cenouraof these fertilizers in the field in carrot crop, are available. Thus, weaimed to evaluate the use of enhanced-efficiency phosphorus fertilizer Existem diversos estudos para avaliação das característicascoated with polymers in carrot (Daucus carota). The experiment químicas dos fertilizantes minerais recobertos por polímeros, porém,was carried out in field, in Ipameri-GO. The experimental design são escassas as pesquisas que avaliam a eficiência agronômica doswas randomized blocks, arranged in an incomplete factorial design mesmos a campo na cultura da cenoura. Dessa forma, objetivou-se(5x2)+1, considering five phosphorus doses (150, 300, 450, 600 and avaliar o uso de fertilizante fosfatado de eficiência aumentada750 ha-1 kg P2O5), two P sources [conventional MAP (monoammonium (Policote) na cultura da cenoura (Daucus carota). O trabalho foiphosphate) and polymer-coated MAP (Policote)] and one additional realizado em condições de campo no município de Ipameri-GO.treatment (control, without P). The evaluated traits were plant height, O delineamento experimental foi de blocos ao acaso, arranjadosroot length, root diameter, total productivity, marketable root classes, em esquema fatorial (5x2)+1, sendo cinco doses de fósforoagronomic efficiency of phosphate fertilization and P content in the (150, 300, 450, 600 e 750 ha-1 kg de P2O5), duas fontes de Proots. Data were submitted to analysis of variance and regression. {MAP (monoamonio fosfato) convencional e MAP revestido porPhosphate fertilization did not influence the P content in carrot polímero} além de um tratamento adicional (testemunha, semroots, but increased plant height, root length and diameter and yield P). Foram avaliados a altura de plantas, comprimento e diâmetroof carrot roots. Polymer-coated phosphate increased plant height, de raiz, além da produtividade total e classes comerciais daslength, diameter and productivity of carrot roots, when compared raízes, eficiência agronômica da adubação fosfatada e teor deto conventional fertilizer. Carrot productivity was, on average, P nas raízes. Os dados foram submetidos à análise de variância15.5% higher with polymer-coated P source (39.42 t ha-1) than with e regressão. A adubação fosfatada não influenciou o teor dethe conventional P source (34.11 t ha-1). Marketable roots were P nas raízes da cenoura, mas aumentou a altura de plantas, oalso improved with the use of polymer-coated phosphate fertilizer. comprimento, o diâmetro e a produtividade de raízes de cenoura.Phosphate fertilizer coated with polymer increased the agronomic O adubo fosfatado revestido com polímero aumentou a altura deefficiency of phosphate fertilization in the carrot crop. plantas, o comprimento e a produtividade de raízes de cenoura, em relação ao adubo sem revestimento. A produtividade de cenoura foi, em média, 15,5% maior com a fonte de P revestida (39,42 t ha-1), em relação à fonte convencional (34,11 t ha-1). Também verificou-se melhoria nos padrões comerciais das raízes com a utilização do adubo fosfatado revestido. O revestimento do adubo fosfatado com o polímero da marca Policote aumentou a eficiência agronômica da adubação fosfatada na cultura da cenoura.Keywords: Daucus carota, polymer-coated phosphorus. Palavras-chave: Daucus carota, Policote, fósforo.Received on February 17, 2017; accepted on October 13, 2018Carrot (Daucus carota) is the marketed in the distribution center Brazil showed that the decreasing order main root vegetable in terms of and the fifth most important crop, of macronutrients extracted by carroteconomic value and it is among the economically speaking; the market crops is potassium, nitrogen, calcium,ten most cultivated vegetable crops in totaled 153.83 million dollars (CNA, phosphorus, sulfur and magnesium (LuzBrazil, with a consumption of 5.8 kg/ 2017). et al., 2009). Even phosphorus beingperson/year (Zanfirov et al., 2012). The the 4th element extracted by the carrotestimated production of this vegetable Carrot is a demanding vegetable crop, is one of the elements which is thein the country is about 752,000 t, in in relation to nutrition, especially due most used (high doses), in fertilization2016, being the fourth most important to its short vegetative cycle and high program for carrots. P is well known asvegetable considering the quantity production of dry mass (Filgueira, being one of the most important elements 2013). Some studies carried out in492 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Enhanced-efficiency phosphorus fertilizer: promising technology for carrot cropfor plant metabolism, being essential available for agriculture, studies in of treatments in the sowing furrow.for establishment and development of order to prove agronomic efficiency, In order to avoid competition amongthe plants (Silva et al., 2015), since mainly on more demanding crops, plants, thinning was done 30 days afterit favors the root system, increasing like vegetables, such as carrots, are planting, spaced 3 cm between plants.the absorption of water and nutrients, necessary. Top dressing was performed applying 60resulting in an increase of this vegetable kg ha-1 of N in all treatments, using urea asproductivity (Avalhaes et al., 2009). This study aimed to evaluate the source, 45 days after planting. efficiency of phosphorus source coating P is widely used for fertilization with Policote brand polymer (enhanced- Pest and disease were controlledsince it is one of the most limiting efficiency fertilizer) in development, preventively spraying insecticidesnutrients for agricultural crops, mainly quality and productivity of carrot crop. from the following chemical products:in tropical soil rich in iron and aluminum benzoylurea, neonicotinoid andoxides (Araújo, 2011). “Free” Fe, the MATERIAL AND METHODS pyrethroid, and fungicides of the chemicalamount of aluminum replacing iron and, groups: benzimidazole, isophthalonitrile,in lower quantities, “amorphous” Fe The experiment was installed at acetamide, phenylamide and strobilurins.and kaolinite are the main responsible the experimental farm of Universidade The range of application rate,elements for phosphorus fixation (Santos Estadual de Goiás, Ipameri Campus recommended by the manufacturer, andet al., 2008), determining the low (17043҆06”S, 48008’39”W), in a Red- also the visual diagnosis were the criteriaefficiency of phosphate fertilizers (Wang Yellow Oxisols, medium texture (Santos for application.et al., 2010). According to Novais et al. et al., 2013). Soil chemical analysis of(2007), the deficiency of P is one of the this area was done before the experiment Plants were harvested 110 days aftermain reasons for the low agricultural installation, in the 0-20 cm layer. The planting; plant height and root length wereproduction in most Brazilian soils. results obtained were: pH= 6.1; P evaluated using a measuring tape, root (Mehlich)= 4.0 mg dm-3; K= 140.0 mg diameter with the aid of a digital caliper In acid soils such as Cerrado soil, P dm-3; H+Al= 14.0 mmolc dm-3; Al3+= and root productivity. After harvest, twocontent is limiting, and P fertilizations 0.0 mmolc dm-3; Ca= 17.0 mmolc dm-3; roots per plot were sampled in order toshow low efficiency due to its large Mg= 9.0 mmolc dm-3; organic matter determine phosphorus content. Roots wereadsorption on soil mineral phase, 18.0 g dm-3; CEC= 43.6 mmolc dm-3; properly washed and dried in forced airpredominantly of low reversibility, clay, silt and sand of 350, 100 and 550 circulation until reaching constant massmainly in Fe andAl oxides (Schoninger et g kg-1, respectively, and base saturation, (70°C); then, they were ground using aal., 2013). Thus, phosphate fertilization 67.9%. P availability (Mehlich), in soil, Willey type mill. Afterwards, the rootsis a high-cost investment, characterized was classified as “very low” according were digested with 1 M HCl in waterby great amounts of P used (Gazola to Ribeiro et al. (1999). Conventional bath at 80°C (Miyazawa et al., 1992)et al., 2013). The situation becomes soil preparation was carried out using and P content was determined by readingworse due to the fact that phosphate is two harrowing, and leveling. in induced plasma atomic emissiona non-renewable natural resources, it is spectrophotometry (ICP- AES).also scarce and without substitutes, and The experimental design consistedshould, therefore, be efficiently used of randomized blocks, arranged in an Roots were classified through(Lana, 2009). incomplete factorial design (5x2)+1, average root length, according to the considering five doses of phosphorus classes proposed by Hortbrasil (2009), Among the alternatives to increase (MAP= monoammonium phosphate) in which carrots shorter than 10 cm longthe best use of phosphate fertilizers, the (150, 300, 450, 600 and 750 kg ha-1 are considered unmarketable; class 10use of enhanced-efficiency fertilizers P2O5), two P sources (conventional MAP included roots measuring 10≤14 cm; class(EEFs) stands out. These fertilizers and polymer-coated MAP) and one 14, roots measuring 14≤18 cm; class 18reduce nutrient loss to the environment additional treatment (control without roots measuring 18≤22 cm; class 22,and increase nutrient availability to P), with four replicates. measuring 22≤26 cm; and class 26 rootsthe plants. EEFs are divided in two longer than 26 cm.groups: slow and controlled-release The experimental plot consisted ofand stabilized. Recently, additives six double rows, spaced 0.10 m between Using the average productivity data,with greater affinity for iron and the double rows and 0.35 m between the the authors calculated the Agronomicaluminum than phosphorus, such as centrals, measuring 3 meters length. The Efficiency Index of Phosphorus (IEAP)the Policote brand, have been used authors considered useful area the four observed in the evaluated sources, usingfor coating phosphate fertilizers to central rows, discarding 0.50 m of each the equation described by Fageria et al.produce stabilized EEFs, aiming to end, resulting in a useful area of 1.80 m². (2012):reduce P fixation rate and availability Hybrid cultivar Juliana (700,000 plantsof the nutrient in soil. Policote is a ha-1) was manually sown on September IEAP= (productivity with phosphorus,soluble anionic polymer with 93.7% 1, 2015, after being fertilized with 60 kg in kg ha-1 – productivity withoutbiodegradability (Chagas et al., 2015). N + 400 kg ha-1 K2O, using urea and KCl phosphorus, in kg ha-1) / (applied dose ofHowever, since it is a new technology as sources, respectively, and application P2O5, in kg ha-1)Hortic. bras., Brasília, v.36, n.4, October-December 2018 Data were submitted to F test (variance and regression analysis) for effects of P 493

A Pelá et al.rates, at 5% probability. P content in roots was not for both sources (Figure 1a). Using MAP significantly influenced by phosphate as a source, plant height increased fromRESULTS AND DISCUSSION fertilization, showing average values 34.5 cm, without phosphate fertilization, of 4.58 and 4.89 g kg-1 for MAP and up to maximum value of 55.5 cm, with All treatments were superior polymer-coated MAP, respectively dose of 566.5 kg ha-1 P2O5. However,when compared to the control, for (Table 1). These P contents are higher when using polymer-coated MAP as aall evaluated variables, except for P than the ones observed by Ribeiro Filho source, plant height increased from 38.0content of roots (Table 1). Interaction et al. (2011) evaluating carrot roots at cm, without phosphate fertilization, upbetween sources and doses did not 120 days after planting (3.27 g kg-1). to maximum value of 60.1 cm, withshow any significant differences, for the dose of 515.6 kg ha-1 P2O5. Theall the evaluated variables, either. F Plant height increased with doses maximum plant height observed usingtest was significant for plant height, of P and it was significantly different the polymer-coated MAP as a sourcelength and diameter of the roots and among phosphorus sources (Table 1). was 8.28% higher than the maximumcrop productivity were influenced both The average plant height observed plant height observed with MAP, usingby sources and by doses, except for the with polymer-coated MAP (56.60 8.98% less phosphorus (kg ha-1 P2O5).effect of source on root diameter. cm) was 9.86% higher than the plant height verified with MAP (51.52 cm). Phosphate fertilization increased Significant response was also noticed for significantly root length (CR), doses of P with quadratic adjustments considering that this trait wasTable 1. F-test results for phosphorus content of the roots (TP), plant height (AP), root length (CR), root diameter (DR) and carrot produc-tivity (Prod) as well as averages and coefficients of variation observed in analysis of variance. Ipameri, UEG, 2016.Treatments TP (g/kg) AP (cm) CR (cm) DR (cm) Prod (t/ha)Control (000 kg ha-1 P2O5) 4.32 35.02 12.18 218 17.04MAP (150 kg ha-1 P2O5) 4.27 42.68 15.35 257 20.80MAP (300 kg ha-1 P2O5) 4.92 51.86 17.37 326 30.68MAP (450 kg ha-1 P2O5) 4.81 54.34 17.79 340 37.16 4.61 55.59 19.02 365 42.60MAP (600 kg ha-1 P2O5) 4.28 53.12 17.51 356 39.30 4.09 54.21 17.31 317 32.37MAP (750 kg ha-1 P2O5) 5.17 56.51 18.21 322 35.49MAP+Policote (150 kg ha-1 P2O5) 4.88 57.11 18.96 358 39.86MAP+Policote (300 kg ha-1 P2O5) 5.19 57.87 19.44 377 45.15MAP+Policote (450 kg ha-1 P2O5) 5.13 57.30 18.84 362 44.20MAP+Policote (600 kg ha-1 P2O5)MAP+Policote (750 kg ha-1 P2O5)Average dosesMAP 4.58 51.52b 17.41b 329 34.11bMAP+Policote 4.89 56.60a 18.55a 347 39.42aAverage source000 kg ha-1 P2O5 4.32 35.02 12.18 218 17.04150 kg ha-1 P2O5 4.18 48.45 16.33 287 26.59300 kg ha-1 P2O5 5.05 54.18 17.79 324 33.09450 kg ha-1 P2O5 4.84 55.72 18.38 349 38.51600 kg ha-1 P2O5 4.90 56.73 19.23 371 43.87750 kg ha-1 P2O5 4.70 55.21 18.17 359 41.75 4.70 52.33 17.45 327 34.97General average Calculated F (anova)Additional treatment 0.96ns 106.48** 139.07** 61.90** 33.41**Source 1.47ns 20.85** 14.81** 3.85ns 6.65*Dose 1.35ns 6.90** 10.25** 10.44** 9.23**Source*Dose 0.51ns 2.25ns 0.74ns 1.42ns 0.63nsCV (%) 17.2 6.72 5.38 8.92 18.61ns= non-significant; *= p<0.05; **= p<0.01. Average followed by same letters are statistically equal among each other (F test).494 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Enhanced-efficiency phosphorus fertilizer: promising technology for carrot cropsignificantly different among P sources polymer-coated MAP. Thus, phosphate for both sources (Figure 1b). Using(Table 1). The average of CR observed, fertilization and coated fertilizer (using conventional MAP, CR increased fromusing the polymer-coated MAP (18.55 Policote) improved the classification of 12.2 cm, in the absence of phosphatecm), was 6.5% higher than CR observed the carrot, since P participates in several fertilization, up to the maximum valueusing MAP (17.41 cm). In the absence metabolic processes such as respiration, of 19.7 cm, with the dose of 535.2 kgof phosphate fertilization, the average photosynthesis, cell division, storage ha-1 P2O5. The longest roots observedof CR was 12.18 cm, resulting in class and energy transfer (Taiz & Zeiger, using the polymer coated MAP was10 carrots, according to Hortbrasil 2013) favoring the development of root 6.5% longer than the one observed(2009). Using MAP as source, carrot system (Araújo et al., 2004). using conventional MAP, using 2.15%classification, based on the average of less phosphorus. The authors alsoCR, was 14, whereas it was 18 using the CR also showed significant quadratic noticed that standard CR for hybrid adjustments in relation to doses of P, carrot cultivar Juliana (18-22 cm) was obtained with lower doses of P whenTable 2. Agronomic efficiency indexes observed between sources and doses of phosphorus using polymer-coated MAP as a source.in production of carrot roots (MAP= monoammonium phosphate). Ipameri, UEG, 2016. CRs observed in this study were higher than CRs observed by Ribeiro Filho etDoses of P MAP MAP+Policote Average al. (2011).150 25.10 102.25 63.68300 45.48 61.53 53.50 Root diameter (DR) was significantly450 44.73 50.73 47.73 influenced by doses of P; the same600 42.61 46.85 44.73 was not verified among sources of750 29.68 36.22 32.95 phosphorus. Figure 2a shows an increaseAverage 37.52 59.52 - of DR with phosphate fertilization. DR increased from 2.20 cm, in the absence of phosphate fertilization, up to 3.65,Figure 1. Plant height (a) and carrot root length (b) in harvest in response to sources and doses of phosphorus. Ipameri, UEG, 2016.Figure 2. Root diameter (a) and productivity (b) of carrot in response to doses of P. Ipameri, UEG, 2016. Ipameri, UEG, 2016. 495Hortic. bras., Brasília, v.36, n.4, October-December 2018

A Pelá et al.with dose of 628.7 kg ha-1 P2O5. length and root productivity, in relation Confederação da Agricultura e Pecuária do Phosphate fertilization significantly to conventional fertilization. Brasil. 72p.increased carrot productivity, which Carrot productivity was, in FAGERIA, NC; SANTOS,AB; STONE, LF. 2012.was also significantly influenced by average, 15.5% higher using polymer- Eficiência do uso de fósforo por genótiposP sources (Figure 2b). Araújo et al. coated source Policote, compared to de arroz irrigado. Embrapa Arroz e Feijão.(2004) also verified an increase of carrot conventional source. In order to Available at <http://ainfo.cnptia.embrapa.productivity with phosphate fertilizer, reach maximum productivity, 791.7 br/digital/bitstream/item/59467/1/107.pdf>and by the residual effect of doses up kg ha-1 P2O5 of conventional MAP and Accessed February 12, 2015.to 762.5 kg ha-1 P2O5 and organic waste 669.8 kg ha-1 P2O5 of polymer-coatedcompost by Mesquita Filho et al. (2002). MAP were necessary. The authors also FILGUEIRA, FAR. 2013. Novo manual deThe maximum productivities observed verified an improvement in marketable olericultura: agrotecnologia moderna nain this study with phosphate fertilizer root standards, in relation to an increase produção e comercialização de hortaliças. 3.were higher than the national average of root length, using polymer-coated ed. rev. amp. Viçosa: UFV, 421p.reported by Santos et al. (2015), 31.0 phosphate fertilization.t ha-1, in 2014. Average productivity, HORTBRASIL. 2009. Normas de classificaçãousing polymer-coated phosphate Under soil and weather conditions impressas pelo Programa Brasileiro parafertilization (39.41 t ha-1), was 15.5% in this study, phosphorus source a Modernização da Horticultura: cenoura.higher than the productivity observed coating with Policote brand polymer Available at <http://www.hortibrasil.org.with conventional phosphate fertilizer increased the agronomic efficiency br/2016-06-02-10-49-06.html>. Accessed(34.11 t ha-1). Using MAP as source, the of phosphate fertilization for carrot October 18, 2015.maximum carrot productivity (41.34 t crop. Considering the positive results,ha-1) was observed with a dose of 791.7 new experiments, under other soil and GAZOLA, RN; BUZETTI, S; DINALLI, RP;kg ha-1 P2O5, whereas with polymer- weather conditions, and using other TEIXEIRA FILHO, MCM; CELESTRINO,coated MAP, the maximum carrot carrot cultivars are important to build TS. 2013. Efeito residual da aplicação deproductivity (44.49 t ha-1) was observed data bank which allows to build a fosfato monoamônico revestido por diferenteswith a dose of 669.8 kg ha-1 P2O5. This table to recommend polymer-coated polímeros na cultura do milho. Revista Ceresmeans that when using polymer-coated phosphate fertilization. 60: 876-884.MAP, the authors observed an increaseof 7.6% in maximum productivity, with ACKNOWLEDGMENTS LANA, RP. 2009. Uso racional de recursosphosphate fertilization 15.4% lower naturais não-renováveis: aspectos biológicos,than the one used with conventional To Universidade Estadual de Goiás econômicos e ambientais. Revista Brasileirafertilization. Productivity value of 41.34 for giving the productivity scholarship de Zootecnia 38: 330-340.t ha-1 was reached with 791.7 kg ha-1 (PROBIP 2016) to the first author.P2O5, using polymer-coated MAP as LUZ, JMQ; ZORZAL FILHO, A; RODRIGUES,source. In other words, when polymer- REFERENCES WL; RODRIGUES, CR; QUEIROZ, AA.coated MAP was used, 54.1% of the 2009. Adubação de cobertura com nitrogênio,dose used via MAP was enough for the ARAÚJO, FF. 2011. Disponibilização de fósforo, potássio e cálcio na produção comercial desame productivity. This behavior may correção do solo, teores foliares e rendimento cenoura. Horticultura Brasileira 27: 543-548.be attributed to the higher P availability de milho após a incorporação de fosfatos eover time, in relation to the lowest lodo de curtume natural e compostado. Acta MACHADO, VJ; SOUZA, CHE. 2012.fixation rate, mainly in Red-Yellow Scientiarum. Agronomy 33: 355-360. Disponibilidade de fósforo em solos comOxisols (Machado & Souza, 2012). diferentes texturas após aplicação de doses ARAUJO, C; ZÁRATE, NAH; VIEIRA, MC. crescentes de fosfato monoamônico de With increasing doses of P, a 2004. Produção e perda de massa pós-colheita liberação lenta. Bioscience Journal 28: 1-7.reduction in agronomic efficiency de cenoura ‘Brasília’, considerando doses deof phosphorus (IEAP) was noticed, fósforo e de cama de frango semi decomposta. MESQUITA FILHO, MV; SOUZA, AF; MOITA,which can be explained by the law of Acta Scientiarum. Agronomy 26: 131-138. AW; RAMAGEM, RD. 2002. Produçãodecreasing increments (Table 2). In all comercializável e teores de Cu e Zn emdoses of P, the authors observed higher AVALHAES, CC; PRADO, RM; GONDI, cenoura em decorrência da ação residualIEAP when using polymer-coated MAP. ARO; ALVES, AU; CORREIA, MAR. 2009. de fósforo e composto de lixo em solo sobIn average, polymer coating increased Rendimento e crescimento da beterraba em cerrado. Horticultura Brasileira 20: 153-157.IEAP in 58.6%. função da adubação com fósforo. Scientia Agrária 10: 75-80. MIYAZAWA, M; PAVAN, MA; BLOCH, MF. Phosphate fertilization did not 1992. Análise química de tecido vegetal.influence P content in carrot roots, CHAGAS, WFT; EMRICH, EB; GUELFI, Londrina: IAPAR. 17p. (Circular, 74).increased plant height, length, diameter DR; CAPUTO, ALC; FAQUIN, V. 2015.and root productivity, though. Productive characteristics, nutrition and NOVAIS, RF; SMYTH, TJ; NUNES, FN. 2007. agronomic efficiency of polymer-coated MAP Fósforo. In: NOVAIS, RF; ALVAREZ, Polymer-coated phosphate in lettuce crop. Revista Ciência Agronômica VVH; BARROS, NF; FONTES, RLF;fertilization increased plant height, 46: 266-276. CANTARUTTI, RB; NEVES, JCL (eds). Fertilidade do solo. Viçosa: SBCS. p. 471-550.496 CNA. 2017. Mapeamento e quantificação da cadeia produtiva de hortaliças. Brasília: RIBEIRO, AC; GUIMARÃES, PTG; ALVAREZ, VVH. 1999. Recomendações para o uso de corretivos e fertilizantes em Minas Gerais: 5ª aproximação. Viçosa: Comissão de Fertilidade do solo do Estado de Minas Gerais. 360p. RIBEIRO FILHO, NM; FLORÊNCIO, IM; BRITO, AC; DANTAS, JP; CAVALCANTI, MT. 2011. Avaliação nutricional de raízes de faveleira e cenoura em períodos equidistantes de coleta. Revista Brasileira de Produtos Agroindustriais 13: 169-175. SANTOS, CE; KIST, BB; CARVALHO, C; REETZ, ER; MÜLLER ,I; BELING, RR; POLL H. 2015. Anuário brasileiro de hortaliças 2015. Santa Cruz do Sul: Editora Gazeta. 68p. Hortic. bras., Brasília, v.36, n.4, October-December 2018

Enhanced-efficiency phosphorus fertilizer: promising technology for carrot cropSANTOS, DR; GATIBONI, LC; KAMINSKI, J. Brasília: Embrapa. 353p. TAIZ, L; ZEIGER, E. 2013. Fisiologia vegetal 5a 2008. Fatores que afetam a disponibilidade SILVA, JTA; SIMAO, FR; ALVES, JJM. 2015. do fósforo e o manejo da adubação fosfatada ed. Porto Alegre: Artmed. 918p. em solos sob sistema plantio direto. Ciência Vegetative development and production ZANFIROV, CA; CORREA, CV; CARPANETTI, Rural 38: 576-586. of Jatropha in response to phosphorus fertilization. Revista Ceres 62: 319-322. MG; CORREA, FF; CARDOSO, AII. 2012.SANTOS, HG; JACOMINE, PKT; ANJOS, SCHONINGER, EL; GATIBONI, LC; ERNANI, Produção de cenoura em função das doses de LHC; OLIVEIRA, VA; LUMBRERAS, JF; PR. 2013. Fertilização com fosfato natural potássio em cobertura. Horticultura Brasileira COELHO, MR; ALMEIDA, JA; CUNHA, e cinética de absorção de fósforo de soja e 30: 747-750. TJF; OLIVEIRA, JB. 2013. Sistema brasileiro plantas de cobertura do cerrado. Semina: WANG, X; SHEN, J; LIAO, H. 2010. Acquisition de classificação de solos. 3. ed. rev. e ampl. Ciências Agrárias 34: 95-106. or utilization which is more critical for enhancing phosphorus efficiency in modern crops? Plant Science 179: 302-306.Hortic. bras., Brasília, v.36, n.4, October-December 2018 497

ResearchZEIST, AR; ZANIN, DS; CAMARGO, CK; RESENDE, JTV; ONO, EO; RODRIGUES, JD. 2018. Fruit yield and gas exchange in bell peppers after foliar application of boron, calcium, and Stimulate. Horticultura Brasileira 36: 498-503. DOI: http://dx.doi.org/10.1590/S0102-053620180412Fruit yield and gas exchange in bell peppers after foliar application ofboron, calcium, and StimulateAndré R Zeist1; Daniel S Zanin2; Cristhiano K Camargo3; Juliano TV de Resende3; Elizabeth O Ono4;João D Rodrigues41Universidade do Oeste Paulista (UNOESTE), Presidente Prudente-SP, Brazil; [email protected]; 2Universidade do Estadode Santa Catarina (UDESC), Lages-SC, Brazil; [email protected]; 3Universidade Estadual do Centro-Oeste (UNICENTRO),Guarapuava-PR, Brazil; [email protected]; [email protected]; 4Universidade Estadual Paulista (UNESP), Botucatu-SP,Brazil; [email protected]; [email protected] ABSTRACT RESUMO The objective of this study was to evaluate the effect of the Produção e trocas gasosas do pimentão em função daisolated and combined foliar application of boron, calcium, and the aplicação foliar de boro, cálcio e Stimulateplant growth regulator Stimulate on fruit yield and gas exchangein bell peppers. The evaluated treatments were boron, calcium, Objetivou-se com este trabalho avaliar o efeito da aplicação foliarStimulate, boron + calcium, boron + Stimulate, calcium + Stimulate, isolada e combinada dos nutrientes boro e cálcio e do regulador deboron + calcium + Stimulate, and control (water). The study was crescimento vegetal comercial Stimulate na produção de frutos eperformed in complete randomized block design with three replicates. nas trocas gasosas do pimentão. Os tratamentos foram boro; cálcio;The applications were performed biweekly on the plant leaves from Stimulate; boro + cálcio; boro + Stimulate; cálcio + Stimulate; borothe beginning of flowering (December 21, 2013) until March 1, 2014. + cálcio + Stimulate; e testemunha (água), aplicados via foliar. OThe analyzed gas exchange characteristics were photosynthetic yield, experimento foi conduzido em delineamento de blocos casualiza-internal CO2 concentration, and transpiration rate. The evaluated dos com três repetições. As aplicações foliares iniciaram a partir doagronomic characteristics were number and yield of marketable and início do florescimento das plantas (21 de dezembro de 2013), comnon-marketable fruits, and the average mass, volume, and firmness of aplicações quinzenais até 01 de março de 2014. Foram avaliadas ascommercial fruits. The foliar application of boron from the beginning características de trocas gasosas: rendimento fotossintético, con-of flowering increased the photosynthetic yield and the yield of centração interna de CO2 e taxa de transpiração; e as agronômicas:marketable fruits cultivated in the field. The foliar application of número e produtividade de frutos não comerciais e comerciais; e acalcium and Stimulate did not improve gas exchange and fruit yield. massa média, volume e firmeza de frutos comerciais. A aplicaçãoThe most common effects of boron were an increase in the number of foliar de boro a partir do início do florescimento aumentou a fotos-marketable fruits. Moreover, foliar spraying with calcium from the síntese e a produção de frutos comercializáveis de pimentão cultivadobeginning of flowering increased the firmness of commercial fruits a campo. Não houve efeitos benéficos da aplicação foliar de cálcio e de Stimulate sobre as trocas gasosas e a produção de frutos de . pimentão. Os efeitos mais consistentes do boro foram no aumento do número de frutos comerciais. A pulverização foliar com cálcio a partir do início do florescimento aumentou a firmeza dos frutos comerciais de pimentão.Keywords: Capsicum annuum, leaf fertilizer, photosynthesis. Palavras-chave: Capsicum annuum, fertilizante foliar, fotossíntese.Received on September 17, 2017; accepted on October 18, 2018The application of foliar fertilizers fruit tissues (Hahn et al., 2017). Calcium Plant regulators are substances that and/or plant regulators may increase deficiency leads to the development of can produce an effect similar to that ofthe production of fruits and vegetables. apical rot or black rot in fruits (Arruda plant hormones (Albrecht et al., 2012;Calcium and boron are the nutrients Júnior et al., 2011; Hahn et al., 2017). Palangana et al., 2012). In agriculture,most frequently applied on the leaves Boron acts as a transducer in light- plant regulators are used for a varietyof vegetables (Cardozo et al., 2001). initiated processes, sugar translocation, of purposes, including increasing plant and cell wall formation (González- development and yield, stimulating Calcium participates on the Fontes et al., 2008; Zhou et al., 2016) rooting of cuttings, promoting dormancyformation of plant cell wall (Malinovsky and is essential for the formation of in fruits, stimulating sprouting, slowinget al., 2014) and is a nutrient transported the pollen tube and fertilization and or accelerating fruit ripening, andby the xylem from the roots. At the end development of fruits (Ganie et al., controlling plant development toof cell division and the beginning of cell 2013). facilitate cultural treatment and harvestgrowth, small amounts of calcium reach Hortic. bras., Brasília, v.36, n.4, October-December 2018498

Fruit yield and gas exchange in bell peppers after foliar application of boron, calcium, and Stimulate(Fagan et al., 2016a). Therefore, plant 1100 m), Paraná, Brazil. The local 0.51 kg of phosphorus (P), and 0.33 kgregulators can promote, inhibit, or climate is classified as Cfb (humid of potassium (K) per ha; 2) second phasemodify physiological processes in plants subtropical) by Köppen classification, (16 to 30 days after transplanting), 1.22(Fagan et al., 2016a). with hot summers, high occurrence kg of N, 1.20 kg of Ca, 0.77 kg of P, and of frost in winters, 17°C annual mean 1.60 kg of K per ha; 3) third phase (31 The cultivation of bell peppers temperature, and 1,946 mm annual to 45 days after transplanting), 1.20 kgis usually difficult, and fruit yield is average rainfall (Wrege et al., 2011). of N, 1.60 kg of Ca, 2.04 kg of P, andnot always satisfactory. This aspect The local soil is classified as typical 1.32 kg of K per ha; 4) fourth phase (46becomes even more critical in the field Dystroferric Bruno Latosol, clayey to 60 days after transplanting), 1.43 kgcultivation of bell peppers, in which texture. of N, 0.90 kg of Ca, 0.92 kg of P, andedaphoclimatic conditions during the 3.45 kg of K per ha; 5) fifth phase (61crop cycle are not always adequate We used a completely randomized days after transplanting to the end of theand may limit the productive potential. block design, three replicates, and nine crop cycle), 2.32 kg of N, 1.30 kg of Ca,Therefore, the foliar application of plant plants on each plot. The treatments 0.27 kg of P, and 2.16 kg of K per ha.regulators and mineral nutrients is a involved the isolated or combined foliar We used the fertilizers calcium nitrate,feasible strategy to obtain higher yields, application of fertilizers Boron Super at potassium nitrate, and monopotassiumhigher quality of the final product, and a concentration of 0.01% boron by spray phosphate (MPK).commercial competitiveness (Palangana volume (H2O), calcium chloride (CaCl2)et al., 2012; Pérez-Jiménez et al., 2015). at a concentration of 0.04% calcium by During the crop cycle, only spray volume (H2O), and plant regulator the branches and leaves below the Studies have demonstrated the Stimulate [a mixture of kinetin (90 mg first bifurcation were pruned. Weedpositive effects of foliar sprays with L-1), 4-(indol-3-yl)butyric acid (50 mg control was performed manually.calcium (Borges et al., 2005), boron L-1), and gibberellic acid (as GA3, 50 mg Phytosanitary control was performed(Mashayekhi et al., 2015), and plant L-1)] at a concentration of 150 mL p.c. preventively with sprays containinggrowth regulators (Palangana et al., 100 L of spray volume (H2O). thiamethoxam (Actara), copper2012; Pérez-Jiménez et al., 2015) on the oxychloride + mancozeb (Cuprozeb),vegetative and productive development Seedlings were obtained by planting and difenoconazole (Score) accordingof fruits and vegetables. Palangana et al. the All Big cultivar (ISLA Sementes®) to manufacturers’ recommendations(2012) observed that leaf spraying with in 200-cell expanded polystyrene for the crop.the plant growth regulator Stimulate at trays containing a pine bark-baseda dose of 150 mL p.c. 100 L-1 of spray commercial biostabilized substrate. Foliar applications were performedvolume increased the production of bell Seedlings with four to five leaves were using a costal sprayer [with a constantpeppers. However, few studies to date transplanted in the field 49 days after pressure valve (Jacto), 2 kgf cm-2evaluated the foliar application of boron sowing. pressure, and a cone-shaped nozzle X2and calcium in bell pepper production (2/110)] at 1.05 m s-1 speed and 240 Lor the concomitant use of these nutrients The soil was plowed to prepare the ha-1 volume. Plastic curtains were usedwith plant growth regulators. experimental area in the field, and a bed to avoid contaminating adjacent plots. shaper was used for preparing beds, 1.0 Bell peppers are susceptible to m width. The soil was corrected with Gas exchange was analyzed usingcalcium deficiency (Silva et al., 2017) 1.79 tons of calcitic limestone (PRNT a portable photosynthesis systemand boron deficiency (Mello et al., 100%) per hectare according to the (IRGA, Infrared Gas Analyzer, Li-2002). The spraying of these nutrients, results of soil analysis to reach a base Cor, LI6400XT) with 1000 μmoltogether with plant regulators, on leaves saturation of 80%. After liming, the soil photons m-2 s-1, 400 μmol mol-1 of CO2,and flowers can increase the rate of gas was tilled, and beds covered with a 3 cm and ΔCO2 + ΔH20 lower than 1%, byexchange, promote plant development, layer of organic compost + corn straw. measuring the photosynthetic yieldand increase fruit yield. or net assimilation (A, µmol CO2 m-2 Seedlings were transplanted at s-1), internal CO2 concentration (Ci, The objective of this study was 1.2×0.4 m spacing and density of 2.08 µmol mol-1), and transpiration rate (E,to evaluate the effect of isolated and plants m-2. Plants were staked vertically mmol H2O m-2 s-1). The three centralcombined foliar application of boron, using bamboo stakes. Drip irrigation plants of each plot were evaluated incalcium, and the plant regulator was performed according to the water the third fully expanded leaf from theStimulate on bell pepper production. requirement of the crop. apex. Measurements were made from 10:00 a.m. to 12:00 p.m. during fullMATERIAL AND METHODS For the development and daily blooming (January 20 to 22, 2014) and application of fertigation, the the beginning of fruiting (February 17 This study was carried out at recommendations of Trani & Carrijo to 19, 2014). All plots were evaluatedUniversidade Estadual do Centro- (2011) were adopted according to the on three dates in each phase, and oneOeste (UNICENTRO) located development stage of the crop in clayey block was evaluated per date in sunnyin the municipality of Guarapuava soils, using the following nutrient conditions.(25°23’01”S; 51°29’37”W; altitude combination 1) first phase (up to 15 days after transplanting), 0.23 kg of Fruits that changed color from green nitrogen (N), 0.30 kg of calcium (Ca), 499Hortic. bras., Brasília, v.36, n.4, October-December 2018

AR Zeist et al.to bluish-green were harvested from of commercial fruits (mL) (determined with that of the control treatment usingfive central plants in each plot on the individually in fruits classified by the Dunnett test and the statisticalfollowing dates: February 17, February commercial standards based on the software ASSISTAT version 7.7 at 5%27; March 10; and April 1, 2014. Fruits displacement of water contained in significance level (Silva & Azevedo,with a length >60 mm and diameter a 2-L beaker), and fruit firmness (N) 2016). The contrasts of interest for>40 mm were considered marketable [in fruits classified by commercial agronomic characteristics (isolated andand, those <60 mm in length and <40 standards using a digital penetrometer combined foliar application of boron,mm diameter were classified as non- (Instrutherm DD-200) with a 8-mm tip] calcium, and Stimulate) between themarketable, including those with severe by compressing two areas in the central groups were estimated using the Scheffédefects, including wilting, deterioration, region of whole fruits [results expressed test and the SISVAR software versionmalformation, disease, or mechanical or in Newton (N)]. 5.6 (Ferreira, 2008).pest insect damage, according to Araújoet al. (2009). The obtained data were tested for RESULTS AND DISCUSSION normality of residuals, homogeneity of The agronomic characteristics we residual variances, and block additivity. All treatments with isolated andevaluated were number of marketable After that, analysis of variance was combined application of boron, calcium,and non-marketable fruits (fruits m-2), conducted using the F test. When and Stimulate increased fruit yieldproduction of marketable and non- significant, the effect of isolated and compared with the control treatment,marketable fruits (g m-2), average mass combined foliar sprays with boron,of commercial fruits (g fruit1), volume calcium, and Stimulate was comparedTable 1. Number and productivity of marketable (M) and non-marketable (NM) fruits and average mass of marketable fruits (AMC) in bellpepper plants, sprayed isolated and combined with boron, calcium and commercial plant regulator Stimulate. Guarapuava, UNICENTRO,2013/2014.Treatments Fruits m-2 Production (g m-2) AMC (g fruit-1) M1 NM2 M NM 130.7Boron 25.2* 6.9 1095.5* 101.5 152.3 115.9Calcium 19.8 4.6 942.5 72.8* 123.7 110.4*Stimulate 24.5 8.1* 941.5 124.6 131.7 119.5Boron + calcium 29.1* 8.3* 1201.4* 108.2 136.0 6.93Boron + Stimulate 27.2* 11.0* 1003.1* 142.1 -21.6+Cálcio + Stimulate 22.9 8.1* 1001.9* 146.1 14.8 36.4+Boron + calcium + Stimulate 26.2* 10.0* 1039.7* 120.2 7.0Control 20.6 4.6 932.5 98.5 20.3+ -1.0CV (%) 7.4 14.7 5.04 16.1 11.2 28.6+Estimating the contrasts of interest 41.9+ 20.6+Boron isolated vs. calcium isolated 5.4+ 2.3+ 153.0+ 28.7+ 32.8+ -7.8Boron isolated vs. Stimulate isolated 0.6 -1.2 154.0+ -23.1+ 5.5Calcium isolated vs. Stimulate isolated -4.8+ -3.5+ 1.0 -51.8+ -15.8Boron isolated vs. boron + calcium -4.0 -1.5 -105.9+ -6.7 -3.6Boron isolated vs. boron + Stimulate -2.1 -4.2+ 92.4+ -40.6+Boron isolated vs. calcium + Stimulate 2.3 -1.2 93.6+ -44.6+Boron isolated vs. boron + calcium + Stimulate -1.0 -3.1 55.8 -18.7Calcium isolated vs. boron + calcium -9.4+ -3.7+ -258.9+ -35.4+Calcium isolated vs. boron + Stimulate -7.5+ -6.4+ -60.6 -69.3+Calcium isolated vs. calcium + Stimulate -3.1 -3.5+ -59.4 -73.3+Calcium isolated vs. boron + calcium + Stimulate -6.4+ -5.4+ -97.2+ -47.4+Stimulate isolated vs. boron + calcium -4.6+ -0.2 -259.9+ 16.4Stimulate isolated vs. boron + Stimulate -2.7 -2.9 -61.6 -17.5Stimulate isolated vs. calcium + Stimulate 1.7 0.0 -60.4 -21.5+Stimulate isolated vs. boron + calcium + Stimulate -1.7 -1.9 -98.2+ 4.4*Different from control by Dunnett’s level (P<0.05); +significant contrast by Scheffé test, 1% probability.500 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Fruit yield and gas exchange in bell peppers after foliar application of boron, calcium, and Stimulateexcept for calcium and Stimulate alone Stimulate alone (Table 1). These results significantly different from the controls(Table 1). Furthermore, boron alone, suggest that foliar sprays containing for average mass of commercial fruits,boron + calcium, boron + Stimulate, boron were more effective in fixing except for boron + Stimulate, whichand boron + calcium + Stimulate fruits than the other treatments. decreased fruit mass (Table 1). Thisincreased the number of marketable treatment, together with Stimulatefruits compared with the control (Table The positive effect of boron on fruit alone and boron + calcium + Stimulate,1). yield may be due to improvements in reduced the volume of marketable fruits the physiological processes of plants. relative to the control (Table 2). The analysis of the contrasts of Boron is involved in the synthesis,interest indicated that boron either lignification, and composition of the Calcium alone did not change thealone or in combination produced a cell wall, sugar transport, and respiration characteristics of commercial fruitshigher number of commercial fruits than (Fagan et al., 2016b). Moreover, these when compared to the control butcalcium alone. Boron alone produced authors have shown that boron is decreased the yield of non-commerciala higher fruit yield than calcium and essential for reproductive growth and fruits relative to the control. The analysisStimulate in isolation; boron + calcium development, nitrogen fixation, and cell of the contrasts of interest revealed thatwas better than boron, calcium, and membrane structuring. calcium produced a higher average massStimulate alone; and boron + calcium + of marketable fruits when comparedStimulate was better than calcium and Treatments with isolated and to boron and Stimulate alone or in combined foliar sprays were not combination (Table 1).Table 2. Volume and firmness of marketable fruits in bell pepper plants with spraying isolated A possible explanation for theand combined of boron, calcium and commercial plant regulator Stimulate. Guarapuava, absence of the effect of calcium onUNICENTRO, 2013/2014. the production of commercial fruits (number and yield of fruits) wasTreatments Volume Firmness that, during the crop cycle, the plants received fertigation containing calcium (mL fruit-1) (N) nitrate. However, calcium spraying decreased the yield of non-commercialBoron 282.2 33.4 fruits (Table 1) and increased fruit firmness (Table 2) compared to theCalcium 309.9 41.1* control treatment. With respect to the latter characteristic, calcium in isolationStimulate 247.7* 30.9 differed from boron and Stimulate either alone or in combination (Table 2).Boron + calcium 269.0 33.9 The greater firmness of fruits fromBoron + Stimulate 226.7* 29.2 plants treated with calcium compared to the control treatment can beCálcio + Stimulate 281.4 31.8 attributed to the structural function of calcium in forming the cell wallBoron + calcium + Stimulate 224.1* 28.1 of fruits. The binding of calcium to fruit pectins inhibits the solubilizationControl 292.9 33.9 of polyuronides and provides a more rigid structure to the middle lamellaCV (%) 6.4 12.62 (greater firmness) (Glenn et al., 1988). Senescence of tissues is affected toEstimating the contrasts of interest some extent by the degradation of pectic polymers in the cell wall, and fruits withBoron isolated vs. calcium isolated -27.7 -7.7+ high calcium levels show increased firmness and consequently longer shelf-Boron isolated vs. Stimulate isolated 34.5+ 2.5 life (Pereira et al., 2002). The increase in fruit firmness by calcium was alsoCalcium isolated vs. Stimulate isolated 62.2+ 10.2+ observed in other fruit species, including blueberry (Ochmian, 2012), apple (RoseBoron isolated vs. boron + calcium 13.2 -0.5 & Drake, 2008), kiwi (Koutinas et al., 2010), and cherry (Brown et al., 1996).Boron isolated vs. boron + Stimulate 55.5+ 4.2 The spraying of Stimulate increasedBoron isolated vs. calcium + Stimulate 0.8 1.6 the number, yield, and average mass of commercial fruits relative to theBoron isolated vs. boron + calcium + Stimulate 58.1+ 5.3 control only when this product wasCalcium isolated vs. boron + calcium 40.9+ 7.2+ 501Calcium isolated vs. boron + Stimulate 83.2+ 11.9+Calcium isolated vs. calcium + Stimulate 28.5 9.3+Calcium isolated vs. boron + calcium + Stimulate 85.8 13.0+Stimulate isolated vs. boron + calcium -21.3 -3.0Stimulate isolated vs. boron + Stimulate 21.0 1.7Stimulate isolated vs. calcium + Stimulate -33.7+ -0.9Stimulate isolated vs. boron + calcium + 23.6 2.8Stimulate*Different from control by Dunnett’s level (P<0.05); +significant contrast by Scheffé test,1% probability.Hortic. bras., Brasília, v.36, n.4, October-December 2018

AR Zeist et al.Table 3. Photosynthetic yield (A), internal CO2 concentration (Ci), and transpiration rate (E) in bell pepper plants with spraying isolated andcombined of boron, calcium and commercial plant regulator Stimulate. Guarapuava, UNICENTRO, 2013/2014.Treatments A (µmol CO2 m-2 s-1) Ci (µmol mol-1) E (mmol H2O m-2 s-1) Fl1 Fs2 Fl Fs Fl Fs 8.0* 7.1*Boron 22.3* 21.9* 117.6* 112.6* 6.3 5.0 6.9 6.9*Calcium 20.4 19.8 156.7* 167.1 7.9* 5.8 6.1 5.7Stimulate 20.2 20.2 160.2 162.6 6.6 5.5 6.9 5.6Boron + calcium 22.2* 21.9* 121.6* 107.5* 5.9 5.8 9.8 12.0Boron + Stimulate 19.9 19.9 163.5 171.1Cálcio + Stimulate 20.1 19.6 193.6 165.4Boron + calcium + Stimulate 20.9 20.3 165.2 165.3Control 17.75 19.4 197.9 166.4CV (%) 6.6 6.7 10.6 11.4*Different from control by Dunnett’s level (P<0.05); 1full flowering (Fl); 2fruiting start (Fs).combined with boron and/or calcium internal CO2 concentration (Zeist et al., on gas exchange and fruit yield. The(Table 1), suggesting that Stimulate did 2017a,b). The explanation for this result most common effects of boron were annot improve the main characteristics in is that, the higher the net assimilation of increase in the number of marketablefield-cultivated bell peppers. In addition, CO2 and water absorption and diffusion, fruits. Biweekly foliar sprays withthe positive effects of Stimulate + boron the higher is the use of intracellular calcium (0.01%) from the beginningwere primarily due to the improvements CO2 by Rubisco in the Calvin cycle. of flowering increased the firmness ofcaused by boron. Dalastra et al. (2014) evaluated gas commercial bell peppers. exchange in Sancho melon, 56 days Increased fruit yields using after transplanting, and observed that REFERENCESStimulate is reported in the literature the photosynthetic yield was increasedfor bell peppers (Palangana et al., as the intracellular CO2 concentration AL-AMERY, MM; HAMZA, JH; FULLER, MP.2012), cabbage (Zeist et al., 2017b), was decreased. 2011. Effect of boron foliar application onand soybean (Albrecht et al., 2012). reproductive growth of sunflower (HelianthusHowever, in the present study, Stimulate The treatments that improved annuus L.). International Journal of Agronomyimproved only the volume of marketable the agronomic characteristics and 2011: 1-6.fruits relative to the control. Plant photosynthetic yield of bell peppersregulators do not always increase fruit compared to the control contained ALBRECHT, LP; BRACCINI, A; SCAPIM,yield, as reported by Ataíde et al. (2006) boron. Evidence of the increased fruit CA; ÁVILA, MR; ALBRECHT, AJP. 2012.using sprays containing Stimulate and yield by boron has also been reported Biorregulador na composição química eGA3 in passion fruit. for other agricultural crops using boron na produtividade de grãos de soja. Ciência (Al-Amery et al., 2011) and boron + zinc Agronômica 43: 774-782. Boron alone and boron + calcium (Wasaya et al., 2017).significantly improved gas exchange ARAÚJO, JS; ANDRADE, AP; RAMALHO,relative to the control both in full bloom Mello et al. (2002) emphasize the CI; AZEVEDO, CAV. 2009. Característicasand at the beginning of fruiting (Table importance of boron in the development e frutos de pimentão cultivado em ambiente3). In this respect, Thurzó et al. (2010) and yield of bell peppers. These authors protegido sob doses de nitrogênio viaobserved that boron increased the levels observed that boron deficiency might fertirrigação. Engenharia Agrícola e Ambientalof photosynthetic pigments in Prunus decrease root volume, foliar area, 13: 152-157.avium, and Liu et al. (2015) found that photosynthetic yield, and productioncalcium increased the photosynthetic of branches and flowers. Moreover, ARRUDA JUNIOR, SJ; BEZERRA NETO,activity of tomato plants under low boron deficiency leads to the deficiency E; BARRETO, LP; RESENDE, LV. 2011.temperatures at night. of other essential nutrients by affecting Podridão apical e produtividade do tomateiro their rate of absorption and use. em função dos teores de cálcio e amônio. Boron alone and boron + calcium Caatinga 24: 20-26.increased the photosynthetic yield and The results indicate that thetranspiration rate when compared to biweekly application of boron (0.01%) ATAÍDE, EM; RUGGIERO, C; OLIVEIRA, JC;the control but resulted in the lowest on the leaves from the beginning of RODRIGUES, JD; BARBOSA, JC. 2006.intracellular CO2 concentrations (Table flowering increases the photosynthetic Efeito de giberelina (GA3) e do bioestimulante3). The photosynthetic yield is usually yield and yield of marketable bell ‘Stimulate’ na indução floral e produtividadedependent on the transpiration rate peppers cultivated in the field. There do maracujazeiro-amarelo em condições(Ferraz et al., 2012), and these parameters were no beneficial effects of the foliar de safra normal. Revista Brasileira detend to be inversely correlated with the application of calcium and Stimulate Fruticultura 28: 343-346.502 BROWN, GS; KITCHENER, AE; GLASSON, WB; BARNES, S. 1996. The effects of copper and calcium foliar sprays on cherry and apple fruit quality. Scientia Horticulturae 67: 219-227. CARDOZO, VP; PIZETTA, NV; TEIXEIRA, NT. 2001. Adubação foliar com cálcio e boro na Hortic. bras., Brasília, v.36, n.4, October-December 2018

Fruit yield and gas exchange in bell peppers after foliar application of boron, calcium, and Stimulate cultura do tomate (Lycopersicum esculentum THERIOS, I; VOULGARAKIS, N. 2010. CECÍLIO FILHO, AB; MENDOZA- Mill) Cv. Débora max. Ecossistema 26: 39-39. Effects of preharvest calcium foliar sprays on CORTEZ, JW. 2017. Síntomas de deficiencia several fruit quality attributes and nutritional de macronutrientes en pimiento (CapsicumDALASTRA, GM; ECHER, MM; GUIMARÃES, status of the kiwifruit cultivar Tsechelidis. annuum L.). Agrociencia Uruguay 21: 31-43. VF; HACHMANN, TL; INAGAKI, AM. HortScience 45: 984-987. 2014. Trocas gasosas e produtividade de três SILVA, FAS; AZEVEDO, CAV. 2016. The assistat cultivares de meloeiro conduzidas com um e LIU, YU; ZHANG, G; QI, M; LI, T. 2015. Effects software version 7.7 and its use in the analysis dois frutos por planta. Bragantia 73: 365-371. of calcium on photosynthesis, antioxidant of experimental data. African Journal of system, and chloroplast ultrastructure in Agricultural Research 11: 3733-3740.FAGAN, EB; ONO, EO; RODRIGUES, JD; tomato leaves under low night temperature CHALFUN JÚNIOR, A; DOURADO NETO, stress. Journal of Plant Growth Regulation SILVA, MW; JADOSKI, CJ; ONO, EO; GOTO, D. 2016a. Fisiologia vegetal: reguladores 34: 263-273. R. 2009. Cálcio, boro e reguladores vegetais vegetais. Piracicaba: Andrei. 300p. na fixação de frutos em tomateiro. Pesquisa MALINOVSKY, FG; FANGEL, JU; WILLATS, Aplicada & Agrotecnologia 2: 103-106.FAGAN, EB; ONO, EO; RODRIGUES, JD; WGT. 2014. The role of the cell wall in plant SOARES, LH; DOURADO NETO, D. 2016b. immunity. Frontiers in Plant Science 5: 1-12. THURZÓ, S; SZABÓ, Z; NYÉKI, J; NAGY, PT; Fisiologia vegetal: metabolismo e nutrição SILVA, AP; GONÇALVES, B. 2010. Effect of mineral. Piracicaba: Andrei. 305p. MASHAYEKHI, K; DEHKORDI, AG; boron and calcium sprays on photosynthetic KAMKAR, B; AZBARMI, R. 2015. pigments, total phenols and flavonoid contentFERRAZ, RLS; MELO, AS; SUASSUNA, Foliar spray of sucrose and boron on some of sweet cherry (Prunus avium L.). Acta JF;  RITO, MEB; FERNANDES, PD; characters of leaf and fruit of tomato Var. Horticulturae 868: 457-461. NUNES JUNIOR, ES. 2012. Trocas gasosas super A. International Journal of Analytical, e eficiência fotossintética em ecotipos de Pharmaceutical and Biomedical Sciences TRANI, PE; TIVELLI, SW; CARRIJO, OA. 2011. feijoeiro cultivados no semiárido. Pesquisa 4: 51-61. Fertirrigação em hortaliças. 2.ª ed. Campinas: Agropecuária Tropical 42: 181-188. Instituto Agronômico, Série Tecnologia APTA, MELLO, SC; DECHEN, AR; MINAMI, K. 2002. Boletim Técnico IAC, 196. 51p.FERREIRA, DF. 2008. SISVAR: um programa Influência do boro no desenvolvimento e na para análises e ensino de estatística. Symposium composição mineral do pimentão. Horticultura WASAYA, L; SHABIR, MS; HUSSAIN, 6: 36-41. Brasileira 20: 99-102. M; ANSAR, M; AZIZ, A; HASSAN, W; AHMAD, I. 2017. Foliar application of zincGANIE, MA; AKHTER, F; BHAT, MA; MALIK, OCHMIAN, I. 2012. The impact of foliar and boron improved the productivity and AR; JUNAID, JM; SHAH, MA; BHAT, AH; application of calcium fertilizers on the quality net returns of maize grown under rainfed BHAT, TA. 2013. Boron – a critical nutrient of highbush blueberry fruits belonging to the conditions of Pothwar plateau. Journal of Soil element for plant growth and productivity with ‘Duke’ cultivar. Notulae Botanicae Horti Science and Plant Nutrition 17: 33-45. reference to temperate fruits. Current Science Agrobotanici 40: 163-169. 104: 76-85. WREGE, MS; STEINMETZ, S; REISSER PALANGANA, FC; SILVA, ES; GOTO, R; JUNIOR, C; ALMEIDA, IR. 2011. AtlasGLENN, GM; REDDY, ASN; POOVAIAH, BW. ONO, EO. 2012. Ação conjunta de citocinina, climático da Região Sul do Brasil: Estados 1988. Effect of calcium on cell wall structure, giberelina e auxina em pimentão enxertado do Paraná, Santa Catarina e Rio Grande do protein phosphorylation and protein profile e não enxertado sob cultivo protegido. Sul. 1. Pelotas: Embrapa Clima Temperado, in senescence apples. Plant Cell Physiology Horticultura Brasileira 30: 751-755. Colombo: Embrapa Florestas. 336p. 29: 565-573. PEREIRA, AJ; BLANK, AF; ALVARENGA, ZEIST, AR; RESENDE, JTV; SILVA, IFL;GONZÁLEZ-FONTES, A; REXACH, MAR; SOUZA, RJ. 2002. Aplicação de fontes OLIVEIRA, JRF; FARIA, CMDR; J ; N AVA R R O - G O C H I C O A , M T; e doses de cálcio na produção e qualidade de GIACOBBO, CL. 2017a. Agronomic HERRERA-RODRÍGUEZ, MB; BEATO, frutos de melão. Horticultura Brasileira 20: characteristics of tomato plant cultivar Santa VM; MALDONADO, JM; CAMACHO- 428-431. Cruz Kada grafted on species of the genus CRISTÓBAL, JJ. 2008. Is boron involved Solanum. Horticultura Brasileira 35: 419-424. solely in structural roles in vascular plants? PÉREZ-JIMÉNEZA, M; PAZOS-NAVARROB, Plant Signaling & Behavior 3: 24-26. M; LÓPEZ-MARÍNA, J; GÁLVEZA, A; ZEIST, AR; PIVA, R; RESENDE, JTV; SILVA, VARÓC, P; AMORA, FM. 2015. Foliar IFL; ATHANAZIO, JC; RODRIGUES, JD.HAHN, L; SUZUKI,A; FELTRIM,AL;WAMSER, application of plant growth regulators changes 2017b. Physiological and agronomic traits AF; MUELLER, S; VALMORBIDA, J. 2017. the nutrient composition of sweet pepper of cabbage plants hybrid Fuyutoyo® sprayed Aplicação de formulações de cálcio e boro na (Capsicum annuum L.). Scientia Horticulturae with plant growth regulators. Horticultura cultura do tomateiro tutorado. Agropecuária 194: 188-193. Brasileira 35: 2010-2015. Catarinense 30: 61-66. RAESE, JT; DRAKE, SR. 2008. Effect of calcium ZHOU, T; HUA, Y; HUANG, Y; DING, G, SHI, L;KAZEMI, M. 2014. Effect of foliar application spray materials, rate, time of spray application, XU, F. 2016. Physiological and transcriptional of humic acid and calcium chloride on and rootstocks on fruit quality of ‘Red’ and analyses reveal differential phytohormone tomato growth. Bulletin of Environment, ‘Golden delicious’ apples. Journal of Plant responses to boron deficiency in Brassica Pharmacology and Life Sciences 3: 41-46. Nutrition 23: 1435-1447. napus genotypes. Frontiers in Plant Science 7: 1-16.KOUTINAS, N; SOTIROPOULOS, T; PETRIDIS, SILVA, AZ; WAMSER, AF; NOWAKI, RH; A; ALMALIOTIS, D; DELIGEORGIS, E;Hortic. bras., Brasília, v.36, n.4, October-December 2018 503

Scientific communicationMACIEL, GM; PEIXOTO, JVM; ROCHA, JPR; ALMEIDA, RS; OLIVEIRA, CS; MENDONÇA, TFN. 2018. Multivariate techniques in the determination of genetic diversity in pest-resistant mini tomato genotypes. Horticultura Brasileira 36: 504-509. DOI - http://dx.doi.org/10.1590/S0102-053620180413Multivariate techniques in the determination of genetic diversity inpest-resistant mini tomato genotypesGabriel M Maciel; Joicy Vitória M Peixoto; Jaíne Priscila R Rocha; Rafaela S Almeida; Camila SOliveira; Thiago Fellipe N Mendonça11Universidade Federal de Uberlandia (UFU), Monte Carmelo-MG, Brazil; [email protected]; [email protected];[email protected]; [email protected]; [email protected]; [email protected] ABSTRACT RESUMO The objective of this study was to compare methods of Técnicas multivariadas na determinação da diversidademultivariate analysis on the evaluation of genetic diversity of mini genética em genótipos de minitomate resistentes a pragastomato and to identify promising genotypes with resistance to pests.The experiment was conducted at the Vegetable Experiment Station A pesquisa foi realizada com o objetivo de comparar diferentesof the Universidade Federal de Uberlândia, Monte Carmelo campus, métodos de análise multivariada na avaliação da diversidade genéticafrom April 2013 to November 2016. The experimental design was em minitomate e identificar genótipos promissores com resistênciaa randomized complete block design with 16 treatments and four a pragas. O experimento foi conduzido na Estação Experimental dereplications totaling 64 plots, and each plot represented by five plants. Hortaliças da Universidade Federal de Uberlândia, campus MonteSixteen genotypes were characterized, 12 from the F2RC1 generation, Carmelo, no período de abril de 2013 a novembro de 2016. Oobtained through the interspecific crossing between the wild access delineamento experimental foi em blocos casualizados com 16LA-716 (Solanum pennellii) and pre-commercial lines of mini tomato tratamentos e quatro repetições totalizando 64 parcelas, sendo cada(UFU-73 and UFU-2) (Solanum lycopersicum) and the UFU-2 lines. parcela representada por cinco plantas. Foram caracterizados 16The content of acyl sugar, the amount of glandular trichomes (types I, genótipos, sendo 12 provenientes da geração F2RC1, obtidos porIV, VI and VII), twospotted spider mite and whitefly resistance were meio do cruzamento interespecífico entre o acesso selvagem LA-716evaluated. We concluded that there exist genetic variability between (Solanum pennellii) versus linhagens pré-comerciais de minitomatethe genotypes. The number of groups formed by the canonical variated (UFU-73 e UFU-2) (Solanum lycopersicum) e as linhagens UFU-2.analysis was higher (four groups) than that obtained by the Tocher Avaliou-se o teor de acilaçúcar, a quantidade de tricomas glandularesmethod (three groups) and UPGMA (three groups), demonstrating a (tipos I, IV, VI e VII), a resistência ao ácaro e à mosca branca. Pode-greater discrimination power. The Tocher and UPGMA methods were -se concluir que existe variabilidade genética entre os genótipos. Oconsistent in the analysis of the genetic divergence in pest resistant número de grupos formados pelo método de variáveis canônicasgermplasm of tomato, with the acyl sugar content being the most foi superior (quatro grupos) ao obtido pelo método de Tocher (trêsimportant variable. Genotype UFU-73-F2RC1 # 11 is resistant to pest grupos) e UPGMA (três grupos), demonstrando maior poder deattack, while the other studied lines have intermediate resistance. discriminação. Os métodos de Tocher e UPGMA foram coerentes quanto à análise da divergência genética em germoplasma de to- mateiro resistente a pragas, sendo o teor de acilaçúcar a variável de maior importância. O genótipo UFU-73-F2RC1 # 11 é resistente ao ataque de pragas, enquanto as outras linhagens estudadas apresentam resistência intermediária.Keywords: Solanum pennellii, Solanum lycopersicum, acyl sugar, Palavras-chave: Solanum pennellii, Solanum lycopersicum,genetic variability. acilaçúcar, variabilidade genética. Received on November 3, 2017; accepted on March 14, 2018Th e t o m a t o c r o p ( S o l a n u m of mini tomato has also increased due activity due to a great variety of pests lycopersicum) stood out in recent to its productivity and particularities that occur during its cultivation. Amongyears as an important agrarian activity related to the fruit such as reduced size, the main arthropod pests, the whiteflyin Brazil and in the world. In 2016, the rounded and elongated shapes, various (Bemisia tabaci) and the twospottedarea destined for tomato production in colors and high soluble solids content spider mite (Tetranychus urticae)Brazil surpassed 57,000 hectares, with among others (Preczenhak et al., 2014; causes damage to the crop productivityan estimated increase of 8% in 2017, Maciel et al., 2015, 2016). (Neiva et al., 2013; Maciel et al.,surpassing 62,000 hectares (IBGE, 2017). An alternative to control these2017). In this context, the cultivation Despite this relevance, the tomato arthropods is using genotypes with a cultivation is considered a high risk504 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Multivariate techniques in the determination of genetic diversity in pest-resistant mini tomato genotypebroad spectrum of pest resistance (Maluf altitude) and at LAGEN (Genetic the five plants of the plot. The discset al., 2010). It is possible to increase the Resources Laboratory) of Universidade were collected from leaflets presentgenetic variability in tomatoes aiming at Federal de Uberlândia (UFU), Campus in the upper third of the plants andresistance to pests in breeding programs Monte Carmelo, from April 2013 to packed in test tubes. The extractionand to increase the number of accesses November 2016. and quantification of the allelochemicalavailable in germplasm bank (Neiva et acyl sugar followed the methodologyal., 2013; Maciel & Silva, 2014; Maciel Sixteen genotypes were described by Resende et al. (2002) andet al., 2017). Gruber (2017) reported characterized: twelve F2RC1 genotypes adapted by Maciel & Silva (2014).that one of the priorities in tomato from the interspecific cross betweenbreeding programs should be to obtain wild access LA-716 (S. pennellii) versus Glandular trichomes (types I, IV, VIpest-resistant plants. However, we have pre-commercial lines of mini tomato and VII) were quantified according tonot found reports of the applicability (UFU-73 and UFU-2) (S. lycopersicum) the methodology of Glas et al. (2012), inof multivariate analysis in germplasm followed by backcrossing and self- the periods of 30, 45, 60, 75 and 90 daysbanks of tomato with different levels of fertilization. These lines from free after sowing. Five young and expandedresistance to pests. market were chosen because of their leaflets were collected from the upper desirable agronomic characteristics as third of each plant and the number of The variability among genotypes high soluble solids content. epidermal glandular trichomes per cm2can be estimated by measures of was evaluated on the abaxial and adaxialgenetic dissimilarity, standing out Inbred lines UFU-2 have surfaces. Trichomes were quantifiedthe Mahalanobis distance (D2ii’). This indeterminate growth habit (homozygous with a stereomicroscope (40x), with atechnique considers residual variances dominant, SP/SP), fruits with 110 Brix micrometric scale of 1 cm2 area.and covariance between quantitative soluble solids contents, red, averagecharacters (Cruz et al., 2012). To weight of 15 g and susceptible to pests. The twospotted spider mitecharacterize this divergence, the The mini-tomato lines UFU-73 have resistance was quantified according toTocher’s optimization method and determinate growth habit (homozygous Weston & Snyder’s (1990) repellencythe hierarchical method Unweighted recessive, sp/sp), fruits with 100 Brix test, measuring the distances covered byPair-Group Method Using Arithmetic soluble solids content, yellow, average arthropods on the leaflet surfaces of theAverages (UPGMA) are routinely used weight of 18 g and susceptible to genotypes at 5, 10, 15 and 20 minutes.in tomato (Mattedi et al., 2014; Araújo pests. The access LA-716 is rich in the The test was done with the placementet al., 2016). However, there is no allelochemical acyl sugar, capable of of five twospotted spider mites on aconsensus regarding the use of these providing broad spectrum of resistance thumbtack attached to the center oftechniques in mini-tomato germplasm to pests in tomato and the commercial each leaflet.whose genetic variability refers to the cultivar Santa Clara (susceptible todifferent levels of resistance to pests. pests). The presence of whitefly was verifiedThe studies comparing methods of according to the methodology describedmultivariate analysis in mini-tomato Genotypes were sown on May by Maluf et al. (2010). After 90 days ofresistant to pests are scarce. 2016, using 200-cell polystyrene trays sowing, the number of eggs and nymphs filled with commercial coconut-based per cm2 of leaf area were quantified with Considering the importance of substrate. After 35 days of sowing, the the aid of a stereomicroscope (40x).tomato crops in national and international seedlings were transplanted in 5 L pots Five leaflets of the upper third of thecontext, the evaluation of genetic filled with the same substrate used to plant were evaluated by each genotype.diversity of mini tomato populations produce them. For counting the number of adults, afor pest resistance will provide the mirror was used to visualize the insectsknowledge of the best combinations to The experiment was conducted in before the escape to the abaxial part ofobtain segregating or hybrid generations, randomized complete block design, each leaflet.allowing the obtention of superior with four repetitions totaling 64 plots,genotypes. Then, the objective of this each plot represented by 5 plants, The data were submitted tostudy was to compare methods of totaling 320 plants in the experiment. multivariate analysis with themultivariate analysis on the evaluation The plants were conducted in an arc- objective of determining the geneticof genetic diversity of mini tomato and type greenhouse, with dimensions dissimilarity between the genotypes.to identify promising pest resistant 7x21 m and 4 meters ceiling height, The dissimilarity matrix was obtainedgenotypes. covered with 150-micron transparent by Mahalanobis distance (D2ii). From polyethylene film and white anti-aphid Mahalanobis distance matrix, theMATERIAL AND METHODS screen side curtains. The same plants genetic divergence was represented by a were used to quantify the levels of acyl dendrogram obtained by the hierarchical The experiment was conducted at sugar, foliar trichrome, twospotted method Unweighted Pair-Group Methodthe Experimental Station of Vegetables spider mite and whitefly repellency. Using Arithmetic Averages (UPGMA),(18º42’43”S, 47º29’55”W, 873 m validated by the cophenetic correlation After 75 days of sowing, a sample coefficient (CCC) with Mantel’s test composed of 6 leaf discs (equivalent (1967). Tocher’s optimization method to 4.2 cm2) was collected in each of was also used to cluster the genotypes.Hortic. bras., Brasília, v.36, n.4, October-December 2018 505

GM Maciel et al. The relative contribution of the coefficient (CCC) was 0.77 with 29.64% groups.quantitative traits was calculated of distortion, which shows an adequateaccording to Singh (1981). For the relation between the matrix distance and The clustering of the 16 mini tomatoanalysis by canonical variables, the the dendrogram produced. genotypes by Tocher’s optimizationgenetic divergence was demonstrated method allowed the formation ofby the dispersion of the scores in graphs, When a cut considering 35% of three groups: I: Inbred lines UFU-22-with the axes represented by the first dissimilarity was made, we observed F2RC1#4, UFU-22-F2RC1#5, UFU-22-canonical variables. All analyzes were the formation of three clusters (Figure F2RC1#3, UFU-73-F2RC1#12, UFU-performed using the software Genes v. 1). The first group consisted of 81.25% 22-F2RC1#7, UFU-22-F2RC1#9, UFU-2015.5.0 (Cruz, 2013). of the genotypes under study (UFU-22- 22-F2RC1#10, UFU-22-F2RC1#1, F2RC1#1; UFU-22-F2RC1#2; UFU-22- UFU-73-2-3-10-1, UFU-22-F2RC1#8,RESULTS AND DISCUSSION F2RC1#3; UFU-22-F2RC1#4; UFU-22- UFU-22-F2RC1#6, UFU-F4-2-2-2 F2RC1#5; UFU-22-F2RC1#6; UFU-22- and UFU-22-F2RC1#2; II: Santa Clara The genetic dissimilarity measures F2RC1#7; UFU-22-F2RC1#8; UFU- genotype, III: UFU-73-F2RC1#11 and(Table 1), estimated from the generalized 22-F2RC1#9; UFU-22-F2RC1#10; S. pennellii (Table 2).distance of Mahalanobis (D2), ranged UFU-73-F2RC1#12; UFU-73-2-3-from 44.02 to 53257.93. This implies 10-1 and UFU-F4-2-2-2). The Santa The Tocher’s method was similarthe presence of genetic divergence Clara genotype, characterized as being to the UPGMA method. The group I inamong the studied genotypes (Azevedo susceptible to pest attack, formed both methods had the highest numberet al., 2015). We observed that 87.5% an isolated group. The third cluster of genotypes (87.5%). The genotypeof the studied genotypes presented consisted of the UFU-73-F2RC1#11 UFU-73-F2RC1#11 was allocated ingreater divergence when compared to genotype and the wild-access S. the same group as the wild-type S.S. pennellii genotype. However, the pennellii genotype characterized by pennellii, representing the genotypeSanta Clara genotype presented a shorter being tolerant to insect attack. Using with the highest tolerance to pestdistance in relation to the wild access. this same method, Lucatti et al. (2013), attack. The second group was formed evaluating the genetic diversity of 35 by the Santa Clara hybrid, susceptible For UPGMA dendrogram, the accessions of tomato on resistance to to pest attack. In contrast, the groupvalue of the cophenetic correlation B. tabaci, detected divergence between III was represented by genotypes with them, observing the formation of two intermediate level of resistance.Table 1. Estimates of the nearest and further distance of 16 mini tomato genotypes, based Using Tocher and UPGMAclusteringon the Mahalanobis distance (D2). Monte Carmelo, UFU, 2013-2016. methods, Luz et al. (2016) in a genetic diversity study of 53 tomato hybrids forGenotypes1 Smaller D2 Closer Higher D2 Less close industrial processing, and Faria et al. (2012) evaluating genetic divergence1 72.80 8 24022.13 16 in peppers, reported predominance of genotypes in one group and formation2 13.94 6 31588.91 16 of groups with only one genotype. The results observed in the present study3 115.06 5 21355.78 16 corroborate with those obtained by these authors.4 44.02 5 20684.83 16 The importance of the use of analysis5 44.02 4 19998.79 16 of characters stands out for studying the total available variation of the genotypes6 68.84 8 28198.82 16 based on the evaluated characteristics. Based on the criteria proposed by7 142.27 9 16639.61 16 Singh (1981), in terms of the relative contribution of each character to the8 68.84 6 26207.23 16 genetic divergence (Table 3), we verified that the most important characteristics9 142.27 7 15045.47 16 for discrimination of the genotypes were: acyl sugar content (37.05%),10 194.62 7 16505.18 16 number of nymphs per plant (12.48%) and number of eggs per plant (12.32%),11 3318.14 9 26882.11 13 and the characters of lower contribution were the distance covered by the12 123.80 5 17826.78 16 twospotted spider mite during five minutes (0.05%) and the counting of13 2862.08 15 53257.93 16 trichomes with thirty days (0.07%).14 141.82 8 26482.89 16 In the analysis of the importance15 238.45 6 31774.25 1616 53257.93 11 5611.72 1311= UFU-22-F2RC1#1; 2= UFU-22-F2RC1#2; 3= UFU-22-F2RC1#3; 4= UFU-22-F2RC1#4;5= UFU-22-F2RC1#5; 6= UFU-22-F2RC1#6; 7= UFU-22-F2RC1#7; 8= UFU-22-F2RC1#8;9= UFU-22-F2RC1#9; 10= UFU-22-F2RC1#10; 11= UFU-73-F2RC1#11; 12= UFU-73-F2RC1#12; 13= Santa Clara; 14= UFU-73-2-3-10-1; 15= UFU-F4-2-2-2; 16= Solanumpennellii.506 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Multivariate techniques in the determination of genetic diversity in pest-resistant mini tomato genotypeof characters obtained by means of the accessions. This result is relevant, allowing the selection of accesses withCanonic Variables, the acyl sugar because it discriminates the existence greater potential for resistance to pests.content was the one that contributed the of wide variability of the degree ofmost to the genetic divergence among resistance between the accesses, The relative importance of canonical variables was measured byFigure 1. Unweighted Pair-Group Method Using Arithmetic Averages (UPGMA) dendrogram the percentage of their eigenvaluesof 16 mini tomato genotypes obtained with the Mahalanobis distance generated with thirteen in relation to the total eigenvalues.characters. 1= UFU-22-F2RC1#1; 2= UFU-22-F2RC1#2; 3= UFU-22-F2RC1#3; 4=UFU-22- The values of the canonical variablesF2RC1#4; 5= UFU-22-F2RC1#5; 6= UFU-22-F2RC1#6; 7= UFU-22-F2RC1#7; 8= UFU- analysis, obtained by the correlation22-F2RC1#8; 9= UFU-22-F2RC1#9; 10= UFU-22-F2RC1#10; 11= UFU-73-F2RC1#11; matrix of the evaluated characters,12= UFU-73-F2RC1#12; 13= Santa Clara; 14= UFU-73-2-3-10-1; 15= UFU-F4-2-2-2; 16= revealed that the first two canonicalSolanum pennellii. Monte Carmelo, UFU, 2013-2016. variables were sufficient to explain 98.74% of the variation observed. TheTable 2. Mini tomato genotypes clustered by Tocher’s optimization method estimated with first variable absorbed 96.06% of theMahalanobis distance. Monte Carmelo, UFU, 2013-2016. variation obtained by the characteristics of greater contribution: the acyl sugarGroup Genotypes content. The second canonical variable represented 2.68% of the variationI UFU-22-F2RC1#4, UFU-22-F2RC1#5, UFU-22-F2RC1#3, obtained based on the variables of UFU-73-F2RC1#12, UFU-22-F2RC1#7, UFU-22-F2RC1#9, greatest contribution: twospotted spider mite covering during fifteen minutes. UFU-22-F2RC1#10, UFU-22-F2RC1#1, UFU-73-2-3-10-1, UFU-22-F2RC1#8, UFU-22-F2RC1#6, UFU-F4-2-2-2 e UFU- Silva et al. (2016), evaluating 22-F2RC1#2 the F2 generation, from interspecific crossing between S. lycopersicumII Santa Clara (TOM-684) and S. galapagense (LA- 1401), observed that genotypes selectedIII UFU-73-F2RC1#11 and Solanum pennellii for high density of type IV glandular trichomes presented resistance to theTable 3. Relative contribution (%) of characteristics for genetic divergence in mini tomato caterpillar Helicoverpa armigera.genotypes, estimated by the method proposed by Singh (1981). Monte Carmelo, UFU, These trichomes are associated with2013-2016. the production of acyl sugar. Silva et al. (2017) and Maciel et al. (2018a)Variable S.j (%) also observed that tomato genotypes with higher acyl sugar content presentedAcyl sugar (nmol/cm2 of leaf area) 37.05 resistance to Liriomyza trifolii and Spider mite, respectively.Number of nymphs 12.48 For the satisfactory interpretationNumber of eggs 12.32 of the variability found among the genotypes it is necessary that the firstNumber of trichomes (90 DAS)1 8.90 two canonical variables presented a minimum estimate of 80% of the totalNumber of adult insects 8.79 variation contained in the mentioned character (Cruz et al., 2012). In thisNumber of trichomes (60 DAS)1 7.89 study the first two canonical variables explained more than 80% of theDP twospotted spider mite (15 minutes)2 6.71 total variance of characters analyzed (98.74%). In this way the variabilityDP twospotted spider mite (10 minutes) 2 3.92 manifested among the genotypes can be explained by means of the dispersionNumber of trichomes (75 DAS)1 1.08 graph (Figure 2). By the scatter plot method, four groups were formed. TheNumber of trichomes (45 DAS)1 0.49 Santa Clara and S. pennelli genotypes formed isolated and distant groups. TheDP twospotted spider mite (10 minutes)2 0.27 genotype UFU-73-F2RC1#11 formed an isolated group, being between S.Number of trichomes (30 DAS)1 0.07 pennelli and the group formed by the other genotypes. In this way the scatterDP twospotted spider mite (15 minutes)2 0.03 plot method differed from the other1DAS= days after sowing; 2DP= distance covered by the twospotted spider mite. 507Hortic. bras., Brasília, v.36, n.4, October-December 2018

GM Maciel et al.Figure 2. Dispersion graph of 16 mini tomato genotypes in relation to the scores of the 2015. Divergência genética e importânciafirst two canonical variables, VC1 (96.06%) and VC2 (2.68%). 1= UFU-22-F2RC1#1; 2= de caracteres em genótipos de batata-doceUFU-22-F2RC1#2; 3= UFU-22-F2RC1#3; 4=UFU-22-F2RC1#4; 5= UFU-22-F2RC1#5; 6= visando a produção de silagem. RevistaUFU-22-F2RC1#6; 7= UFU-22-F2RC1#7; 8= UFU-22-F2RC1#8; 9= UFU-22-F2RC1#9; Brasileira de Ciências Agrárias. 10: 479-484.10= UFU-22-F2RC1#10; 11= UFU-73-F2RC1#11; 12= UFU-73-F2RC1#12; 13= SantaClara; 14= UFU-73-2-3-10-1; 15= UFU-F4-2-2-2; 16= Solanum pennellii. Monte Carmelo, CRUZ, CD. 2013. GENES: a software packageUFU, 2013-2016. for analysis in experimental statistics and quantitative genetics. Acta Scientiarum 35:analyzed methods, due to the formation allows the identification of more groups 271-276.of a larger number of groups. containing similar accesses. In addition, there was consistency between Tocher CRUZ, CD; REGAZZI, AJ; CARNEIRO, PCS. The formation of coincident groups, and UPGMA methods for the analysis 2012. Modelos biométricos aplicados aothrough the use of complementary of genetic divergence in pest-resistant melhoramento genético. Viçosa: UFV. 514p.methods of multivariate analysis, is tomato germplasm, with the mostalso described in pepper (Negreiros & important variable being the acyl sugar FARIA, PN; CECON, PR; SILVA, AR; FINGER,Miqueloni, 2013), passion fruit (Paiva content. Genotype UFU-73-F2RC1 # FL; SILVA, FF; CRUZ, CD; SÁVIO, FL.et al., 2014), tomato (Luz et al., 2016; 11 is resistant to pest attack, while the 2012. Métodos de agrupamento em estudo deAmaral Júnior et al., 2017; Maciel et other lines studied have intermediate divergência genética de pimentas. Horticulturaal., 2018b), which shows consistency resistance. Brasileira 30: 428-432.of similarity results in the groupscomposition. The results obtained in the REFERENCES GLAS, JJ; SCHIMMEL, BCJ; ALBA, JM;present study corroborate those found by ESCOBAR-BRAVO, R; SCHUURINK, RC;these authors. AMARAL JÚNIOR, AT; GRAÇA, AJP; VIVAS, KANT, MR. 2012. Plant glandular trichomes M; VIANA, AP; RODRIGUES, R. 2017. as targets for breeding or engineering of The application of the UPGMA Prospecting of tomato hybrids for table and resistance to herbivores. International Journalhierarchical method, Tocher ’s industry via mixed modeling and multivariate of Molecular Sciences 13: 17077-17103.optimization and canonical variables analysis. Horticultura Brasileira 35:20-25.allowed to conclude the existence of GRUBER, K. 2017. The living library: Wildgenetic variability among the genotypes. ARAÚJO, JC; TELHADO, SFP; SAKAI, RH; and heirloom plants are giving major cropThe number of groups formed by the LEDO, CAS; MELO, PCT. 2016. Univariate varieties, and the global food system, a geneticcanonical variables method was higher and multivariate procedures for agronomic makeover. Nature 544: 8-10.(four groups) than that obtained by evaluation of organically grown tomatothe Tocher method (three groups) and cultivars. Horticultura Brasileira 34: 374-380. IBGE - Instituto Brasileiro de Geografia eUPGMA (three groups), demonstrating Estatística. 2017. Levantamento sistemáticoa greater discriminating power. This AZEVEDO, AM; ANDRADE JUNIOR, da produção Agrícola: pesquisa mensal VC; FIGUEIREDO, JA; PEDROSA, EC; de previsão e acompanhamento das safras VIANNA, DJS; LEMOS, VT; NEIVA, IP. agrícolas no ano civil. Rio de Janeiro: IBGE. 30 4: 1-84. LUCATTI, AF; HEUSDEN, AW; VOS, RC; VISSER, RG; VOSMAN, B. 2013. Differences in insect resistance between tomato species endemic to the Galapagos Islands. BMC Evolutionary Biology 13:1-12. LUZ, JMQ; BITTAR, CA; OLIVEIRA, RC; NASCIMENTO, AR; NOGUEIRA, APO. 2016. Desempenho e divergência genética de genótipos de tomate para processamento industrial. Horticultura Brasileira 34: 483-490 MACIEL, GM; ALMEIDA, RS; PRISCILA, J; ANDALO, V; MARQUEZ, GR; SANTOS, NC; FINZI, RR. 2017. Mini tomato genotypes resistant to the silverleaf whitefly and to two- spotted spider mites. Genetics and Molecular Research 16: 1-9. MACIEL, GM; FERNANDES, MAR; MELO, OD; OLIVEIRA, CS. 2016. Potencial agronômico de híbridos de minitomate com hábito de crescimento determinado e indeterminado. Horticultura Brasileira 34: 144-148. MACIEL, GM; FINZI, RR; CARVALHO, FJ; MARQUEZ, GR; CLEMENTE, AA. 2018b. Agronomic performance and genetic dissimilarity among cherry tomato genotypes. Horticultura Brasileira 36:158-163. MACIEL, GM; MARQUEZ, GR; SILVA, EC; ANDALÓ, V; BELOTTI, IF. 2018a. Tomato genotypes with determinate growth and high acylsugar content presenting resistance to spider mite. Crop Breeding and Applied Biotechnology 18: 1-8. MACIEL, GM; SILVA, EC. 2014. Proposta metodológica para quantificação de acilaçúcares em folíolos de tomateiro. Horticultura Brasileira 32: 174-177. MACIEL, GM; SILVA, EC; FERNANDES,508 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Multivariate techniques in the determination of genetic diversity in pest-resistant mini tomato genotype MAR. 2015. Ocorrência de nanismo em planta NEIVA, IP; ANDRADE JÚNIOR, VC; MALUF, NEIVA, IP; SANTOS, DC; MALUF, WR. de tomateiro do tipo grape. Revista Caatinga WR; OLIVEIRA, CM; MACIEL, GM. 2013. 2016. Resistência à Helicoverpa armigera 28: 259-264. Role of allelochemicals and trichome density em genótipos de tomateiro obtidos do in the resistance of tomato to whitefly. Ciência cruzamento de Solanum lycopersicum comMALUF, WR; MACIEL, GM; GOMES, LAA; e Agrotecnologia 37: 61-67. Solanum galapagense. Pesquisa Agropecuária CARDOSO, MG; GONÇALVES, LD; SILVA, Brasileira 51: 801-808. EC; KNAPP, M. 2010. Broad-spectrum PAIVA, CL; VIANA, AP; SANTOS, EA; SILVA, arthropod resistance in hybrids between high RNO; OLIVEIRA, EJ. 2014. Diversidade SILVA, AA; ANDRADE, MC; MALUF, WR; and low-acylsugar tomato lines. Crop Science. genética de espécies do gênero Passiflora MORAES, JC; REZENDE, JF. 2017. 50: 439-450. com o uso da estratégia Ward-MLM. Revista Resistance of tomato plant genotypes with Brasileira de Fruticultura 36: 381-390. high foliar allelochemical contents to theMANTEL, N. 1967. The detection of disease leafminer Liriomyza trifolii. Arquivos do clustering and a generalized regression PRECZENHAK,AP; RESENDE, JTV; CHAGAS, Instituto Biológico 84:1-6. approach. Cancer Research 27: 209-220. RR; SILVA, PR; SCHWARZ, K; MORALES, RGF. 2014. Caracterização agronômica SINGH, D. 1981. The relative importance ofMATTEDI, AP; GUIMARÃES, MA; NICK, C; de genótipos de minitomate. Horticultura characters affecting genetic divergence. The SILVA, DJH; PUIATTI, M; CARNEIRO, Brasileira 32: 348-356. Indian Journal of Genetic and Plant Breeding PCS. 2014. Genetic divergence of tomato 41: 237-245. subsamples. Revista Ceres 61: 70-76. RESENDE, JTV; CARDOSO, MG; MALUF, WR; SANTOS, CD; GONÇALVES, LD; WESTON, PA; SNYDER, JC. 1990. ThumbtackNEGREIROS, JRS; MIQUELONI, DP. 2013. RESENDE, LV; NAVES, FO. 2002. Método biossay: a quick method of measuring Divergência genética de populações de colorimétrico para quantificação de acilaçúcar plant resistance to twospotted spider mites Piper hispidinervum com base em caracteres em genótipos de tomateiro. Ciência e (Acari: Tetranychidae). Journal of Economic morfoagronômicos. Pesquisa Agropecuária Agrotecnologia 26: 1204-1208. Entomology 83: 501-504. Tropical 43: 209-217. SILVA, AA; ANDRADE, MC; CARVALHO, RC;Hortic. bras., Brasília, v.36, n.4, October-December 2018 509

Scientific communicationRIBEIRO, WS; CARNEIRO, CS; FRANÇA, CFM; PINTO, CMF; LIMA, PCC; FINGER, FL. 2018. 1-MCP efficiency in quality of ornamental peppers. Horticultura Brasileira 36: 510-514. DOI - http://dx.doi.org/10.1590/S0102-0536201804141-MCP efficiency in quality of ornamental peppersWellington S Ribeiro1; Clebson dos S Carneiro2; Christiane de Fátima M França3; Cleide Maria F Pinto4;Paula Cristina C Lima2; Fernando L Finger21Universidade Estadual da Paraíba (UFPB), Lagoa Seca-PB, Brazil; [email protected] ; 2Universidade Federal de Viçosa(UFV), Viçosa-MG, Brazil; [email protected]; [email protected]; [email protected]; 3Universidade Federal do Oesteda Bahia (UFOB), Barra-BA, Brazil; [email protected]; 4Empresa de Pesquisa Agropecuária de Minas Gerais (EPAMIG),Viçosa-MG, Brazil; [email protected] ABSTRACT RESUMO 1-MCP has been effectively used as an antagonist of ethylene Eficiência do 1-MCPna qualidade de pimenteiras ornamentaisdeleterious actions in flowers and ornamental plants. The objectivewas to evaluate the efficiency of 1-MCP (0.0, 0.5, 1.0 and 1.5 g m-3) in O 1-MCP tem sido efetivamente utilizado como antagonista dasmaintaining post-production quality of exogenous ethylene sensitive ações deletérias do etileno em flores e plantas ornamentais. O obje-ornamental pepper. Two commercial varieties were evaluated: tivo foi avaliar a eficiência do 1-MCP (0,0; 0,5; 1,0 e 1,5 g m-3) naPimenta Colorida and Pimentão Ornamental, both Capsicum manutenção da qualidade pós-produção de pimenteiras ornamentaisannuum. The pre-treatment with 1-MCP, regardless of the applied sensíveis ao etileno exógeno. Foram avaliadas duas variedades co-concentration, was effective in blocking the ethylene action reducing merciais: Pimentão Ornamental e Pimenta Colorida, ambas Capsicumthe leaves abscission, flowers and fruits of both genotypes by 100%. annuum. O pré-tratamento com 1-MCP, independente da concentra-Plants pretreated with 1-MCP had postproduction life increased by ção aplicada, foi eficaz em bloquear a ação do etileno reduzindo emeight and nine days for Pimenta Colorida and Pimentão Ornamental, 100% a abscisão de folhas, flores e frutos de ambos os genótipos.respectively. The 1-MCP application at the concentration of 1.0 g m-3 As plantas pré-tratadas com 1-MCP tiveram a vida de pós-produçãois efficient in maintaining ornamental quality and prolonging the shelf aumentada em oito e nove dias para Pimenta Colorida e Pimentãolife of Pimenta Colorida and Pimentão Ornamental. Ornamental, respectivamente. A aplicação de 1-MCP na concentração de 1,0 g m-3 é eficiente em manter a qualidade ornamental e prolongar a vida de prateleira da Pimenta Colorida e Pimentão Ornamental.Keywords: Capsicum annuum, ornamental plants, sensitivity, Palavras chave: Capsicum annuum, plantas ornamentais,transport. sensibilidade, transporte. Received on March 14, 2017; accepted on September 14, 2018Species of the genus Capsicum have been effectively used to prevent the after a single exposure, without any different ethylene sensitivity levels. deleterious ethylene effects on plants detectable odor (Finger & Barbosa,In potted peppers, ethylene triggers a (Sisler & Serek, 1999). 2006). However, depending on theseries of deleterious responses, among shelf-life of these plants, the sensitivitythem, the abscission of fruits and leaves as The effects of these compounds as of the plant tissue can be resumeda reaction to tissue sensitivity. However, ethylene antagonists are attributed to by the synthesis of new binding sitesother negative effects are visible, such their molecular structure which allows allowing the ethylene action resumptionas the acceleration of chlorophyll very strong binding to the low valence (Blankenship & Dole, 2003).degradation and the senescence process electron donor compounds present at the(Beaudry & Kays, 1998; Krajayklang receptor. They compete with ethylene So, one of the most sought goals inet al., 2000; Brackmann et al., 2004; for their binding sites and remain bound the post-production stage of ornamentalSegatto et al., 2013). to these receptors for a long time, plants, including pepper plants, is the thus avoiding the ethylene-dependent nullification or delay of the deleterious The need for chemical protection responses (Sisler & Serek, 1997, 1999). effects caused by ethylene withagainst the ethylene action has been minimal application of antagonists. Therecommended for many ornamental 1-MCP is one of the most useful Epidendrum ibaguense orchid treatedpotted plants, in which low ethylene compounds among cyclopropenes for with 1-MCP had shelf life doubled whenconcentrations cause rapid losses in this purpose. It is non-toxic, stable at compared to control flowers (Finger etornamental quality (Serek et al., 1994). room temperature, active at relatively al., 2008). Similar results were obtainedIn this sense, cyclopropenes have low concentrations, providing protection in cultivars of Phalaenopsis, where the for a long period of up to 12 days510 Hortic. bras., Brasília, v.36, n.4, October-December 2018

1-MCP efficiency in quality of ornamental peppers1-MCP application inhibited the floral The commercial cultivars Pimenta s-1 m-2 of fluorescent light, simulatingbuds and flowers abscission, effectively Colorida and Pimentão Ornamental the interior of shops, supermarkets andblocking the ethylene action (Sun et al., (Capsicum annuum) were used in this residences. This phase was determined2009). experiment. Plants were taken to the by the days between removing the plants laboratory at the commercialization from the chamber until the day they were Fumigation with cyclolefins point, characterized by 50% of the commercially inadequate, that is, when1-DCP and 1-OCP have been shown population with at least 30% fully they had 50% leaf abscission and/orto be efficient in reducing the flower ripened fruits, visually determined fruit and/or 50% leaf senescence. Leafabscission rate in potted mini-roses even (fruits with the maximum growth size senescence recognition was obtained bywhen ethylene is not the primary agent and typical size of each species, with grouping the genotypes according to ain inducing plant senescence (Buanong the specific color demanded by the common pattern of senescence.et al., 2005). market and not wilted). The treatments were carried out in a 60 L hermetic Data analysis The 1-MCP effectiveness in delaying chamber, where the plants remained inthe senescence symptoms on majority the dark and without irrigation during The experiment was set up in aof ornamental plants is dependent on the treatment, simulating the transport completely randomized design withapplication temperature, concentration condition. In this environment, the 9 treatments and 3 replicates. Theand stage of plants development (Finger commercial product EthylBloc® (0.14% experimental unit consisted of one& Barbosa, 2006). i.a., Rohm and Hass Química Ltda., plant per pot. To analyze the data, a São Paulo, Brazil) was dissolved in descriptive analysis with standard error The objective of the present research water at 50°C, releasing 1-MCP gas. calculation was performed. The PRISMwas to evaluate the 1-MCP action on The treatments were composed of: 1) program was used to obtain the graphs.the longevity of two ornamental pepper External control, in which the plantscultivars, sensible to ethylene. were kept in bench condition with RESULTS AND DISCUSSION average temperature of 20ºC and 8-10MATERIAL AND METHODS (μmol s-1 m-1 of fluorescent light; 2) The treatment with 1-MCP was Internal control, in which the plants effective in blocking the ethylene Localization, obtainment and were kept inside the chambers without action reducing the leaves and fruitsmaintenance of seedlings the ethylene application or 1-MCP; abscission of Pimentão Ornamental. 3) Ethylene at 10 μL-1; 4) 0.5 g m-3 of There was no abscission of leaves and Pepper seedlings were produced in 1-MCP; 5) 1.0 g m-3 of 1-MCP; 6) 1.5 fruits in the plants treated with 1-MCPprotected environment in polystyrene g m-3 of 1-MCP; 7) 0.5 g m-3 of 1-MCP of the ethylene action in all evaluatedtrays filled with commercial Bioplant® + 10 μL-1 of ethylene; 8) 1.0 g m-3 of concentrations; however, those treatedsubstrate. After reaching two to 1-MCP + 10 μL-1 of ethylene; 9) 1.5 g with 1-MCP in the concentrations ofthree pairs of leaves, seedlings were m-3 of 1-MCP + 10 μl-1 of ethylene. 0.5 and 1.5 g m-3 maintained the 100%transplanted into 900 mL vessels (11 response of flower abscission andcm high, 9.5 cm basal diameter, 13.5 cm Before and after the treatment’s flower buds similar to plants treatedupper diameter). Bioplant® commercial application and also during the post- with ethylene alone. In pre-treatedsubstrate was used to fill the vessels. production phase the plants were 1-MCP peppers at 1.0 g m-3, 0% flower evaluated on: abscission and floral buds were observed At planting, the substrate was even after 48 hours of exposure tofertilized with 2.5 g of NPK 0-10-10 Accumulated abscission of leaves, ethylene (Figure 1).formulation. During the experiment, fruits and flowers (%)fertilization was done every 20 days This suggests that ethylenewith 10 g of NPK formulation 10-0-10. The accumulated abscission of application was not sufficient for the leaves, fruits and flowers (%) was synthesis of new binding sites nor the Plants were watered, from sowing determined by the total count of leaves, removal of 1-MCP of the same. 1-MCPto transplanting, once a day with fruits and flowers, respectively, before binds to ethylene receptors with a half-enough water to moisten the substrate and after the treatments during the life of diffusion between 7 and 12 days,until field capacity. From transplanting whole experiment. Only completely which in most cases exceeds the shelfuntil establishment of the seedlings, expanded leaves were counted. We life of ornamental peppers (Serek et al.,the substrate was watered with 150 counted the closed flower buds, in 1995). Compared with ethylene, whichmL of water/pot daily. From the initial anthesis, completely opened and the has a diffusion time of 2 to 10 minutes,establishment period of the seedlings fertilized ones. Fruits were separated it can be concluded that the binding ofuntil the last day of the experiment, the by maturation stage in green, ripe-green 1-MCP to the ethylene receptor cansubstrates were watered with 150 mL and ripe. be regarded as irreversible; however,of water/pot daily. During watering, once the 1-MCP receptor complex isthe water was deposited directly on the Post-production phase metabolized, the process is reversed, andsubstrate, with occasional wetting of After application of the treatments, new receptors are synthesized (Sisler &the leaves. the plants were transferred to the interior of a room at 20-25°C and 7-10 μmol 511 1-MCP applicationHortic. bras., Brasília, v.36, n.4, October-December 2018

WS Ribeiro et al.Serek, 1999). with 1-MCP at all concentrations did When exposed to exogenous Although fruit abscission was not change their coloration whereas, ethylene, the percentage of accumulated the fruits of plants treated with ethylene abscission of leaves was 63.70%, thatreduced in plants treated with 1-MCP, for only 48 hours accelerated the of flowers 100% and that of fruits wasthe same proportion of immature transformation of green and green 10.41%. Of the total fallen fruits, 100%fruits abscision was found in plants mature fruits to the red color. were of green maturation stage. Aftertreated with ethylene, with values the removal from the chamber, somehigher than 50%. On the other hand, For ‘Pimenta Ornamental’ plants, leaves that persisted on the plant werethe external control plants presented 1-MCP treatment was also effective yellowed (Figure 2).a higher proportion of abscision of in blocking the ethylene action bymature fruits; behavior due to ordinary reducing leaf, fruit and flower abscission It became evident that the fruits insenescence processes. (including flower buds) by 100% at all green mature stage that persisted on the evaluated concentrations. plant, had the color intensified with the The fruits of the plants pretreated application of 10 μL L-1 of ethylene. Fruit abscission was not observed inFigure 1. Accumulated abscission (%) of leaves, fruits and flowers of 'Pimentão Ornamental' internal and external control plants.(Capsicum annuum) in vase before (day 0) and after 0.5, 1.0 and 1.5 g m-3 and withoutapplication of 10 μL L-1 of ethylene for 48 hours. Vertical bars indicate standard deviation The ornamental pepper lasted onlyof the average (n= 3). Viçosa, UFV, 2015. one day after the application of ethylene for 48 hours, while plants treated with 1-MCP lasted eight days in the bench condition. Plants treated with only 1-MCP had the post-production phase increased compared to the plants of the external control, suggesting that the low radiation (8-10 μmol s-1 m-2 fluorescent light) of the room in which the plants were subjected to after treatment, induced ethylene synthesis, and that 1-MCP was effective in inhibiting the effect of this hormone produced by light stress. Cavatte (2013), evaluating the light and temperature action on the longevity of ornamental peppers BGH 1039 and Roxa (Capsicum annuum), found that 1-MCP drastically inhibited leaf fall in both varieties when exposed to high temperature. However, the response of 1-MCP to inhibit the ethylene effects, in the same work, depended on the variety and the luminosity conditions in which the plants were submitted. The treatment with 1-MCP + ethylene was effective in reducing leaf abscission of Calypso cultivar, classified according to the same research as highly sensitive to exogenous ethylene. The cultivar Calypso also did not present fruit abscission when submitted to the same treatment (Segatto et al., 2013). In orchids of the genus Cymbidium, the 1-MCP application extended the longevity of the stems regardless of the ethylene presence in the atmosphere after treatment with 1-MCP (Heyes & Johnston, 1998). In other flower studies, 1-MCP treatment has the greatest effect on512 Hortic. bras., Brasília, v.36, n.4, October-December 2018

1-MCP efficiency in quality of ornamental peppersinhibiting the ethylene deleterious ambigua with 1-MCP. In researches hand, fumigation with 0.5 g m-3 ofaction when applied prior to exposure performed with Dianthus caryophyllus, 1-MCP increased longevity by 33% overto the hormone and the beneficial effect 1-MCP application at 0.5 nL L-1 the control (Santos et al., 2005).decreases if 1-MCP is applied together concentration during 24 hours wasor after ethylene (Blankenship & Dole, effective in blocking the deleterious For the studied ornamental pepper2003). Matthiola incana stems treated effects of ethylene (Serek & Sisler, varieties, pre-treatment with 1-MCP atwith 1 mL L-1 of ethylene for 48 hours, 1997, 2001). Accelerated yellowing and 1.0 g m-3 concentration, was effectivepromoted 100% petal abscission, and early foliar leaves abscission, ethylene in inhibiting the ethylene action andinduced leaf epithelia. These effects effect observed in brassicaceae, is reducing leaf, flower and fruit abscission.were completely inhibited by pre- reversed with the use of 1-MCP. Withtreatment with 500 nL L-1 of 1-MCP application of 100 mg L-1 of Ethrel, ACKNOWLEDGMENTSfor 6 hours. Consolida ambigua longevity was reduced by about 69%, compared to To Conselho Nacional de Celikel & Reid (2002) found control inflorescences. On the other Desenvolvimento Científico esimilar results on pre-treated Consolida Tecnológico (CNPq), Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG) and Comissão de Aperfeiçoamento de Pessoal do Nível Superior (CAPES). REFERENCESFigure 2. Accumulated abscission (%) of leaves, flowers and fruits of Capsicum annuum BEAUDRY, RM; KAYS, SJ. 1998. Effect ofbefore (day 0) and after the application of 0.5, 1.0 and 1.5 g m-3 with and without application ethylene source on abscission of pepper plantof 10 μL L-1 of ethylene for 48 hours. Vertical bars indicate standard deviation of the average organs. HortScience 23: 724-744.(n= 3). Viçosa, UFV, 2015. BLANKENSHIP, SM; DOLE, JM. 2003. 1-Methylcyclopropene: a rewiew. Postharvest Biology and Technology 28: 1-25. BRACKMANN, A; SESTARI, I; STEFFENS, CA; GIEHL, RFH. 2004. Qualidade da maçã cv. Gala tratada com 1-metilciclopropeno. Ciência Rural 34: 1415-1420. BUANONG, M; MIBUS, H; SISLER, EC; SEREK, M. 2005. Efficacy of new inhibitors of ethylene perception in improvement of display quality of miniature potted roses (Rosa hybrida L.) Plant Growth Regulation 47: 29-38. CAVATTE, RPQ; LIMA, JS; SILVA, TP; CAVETTE, PC; FINGER, FL; BARBOSA, JG. 2013. Influence of temperature and 1-Methylcyclopropene on post-production display life of ornamental pepper (Capsicum annuum L.). Acta Horticulturae 1002: 359- 364. CELIKEL, FG; REID, MS. 2002. Postharvest handling of stock (Matthiola incana). HortScience 37: 144-147. FINGER, FL; BARBOSA, JG. 2006. Postharvest physiology of cut flowers. In: NOUREDDINE, B; NORIO, S (ed). Advances in postharvest technologies for horticultural crops. Kerala: Research Signpost, 373-393. FINGER, FL; MORAES, PJ; MAPELI, AM; BARBOSA, JG; CECON, PR. 2008. Longevity of Epidendrum ibaguense flowers as affected by pre-loading treatments and vase solution. Journal of Horticultural Science & Biotechnology 83: 144-147. HEYES, JA; JOHNSTON, JW. 1998. 1-Methylcyclopropene extends Cymbidium orchid vaselife and prevents damaged pollinia from accelerating senescence. New Zealand Journal of Crop and Horticultural ScienceHortic. bras., Brasília, v.36, n.4, October-December 2018 513

WS Ribeiro et al. 26: 319-324. ornamental peppers (Capsicum annuum L.). inhibitor of ethylene action, improves the life Acta Horticulturae 1000: 217-222.KRAJAYKLANG, M; KLIEBER, A; DRY, PR. of fruit, cut flowers and potted plants. Acta 2000. Colour at harvest and postharvest SEREK, M; SISLER, EC; REID MS. 1994. behaviour influence paprika and chille spice Novel gaseous ethylene binding inhibitor Horticulturae 394: 337-345. quality. Postharvest Biology and Technology prevents ethylene effect in potted flowering SISLER, EC; SEREK, M. 1999. Compounds 20: 269-278. plants. Journal American Society Horticulture Science 119: 1230-1233. controlling the ethylene receptor. BotanicalSANTOS, VR; FINGER, FL; BARBOSA, JG; Bulletin of Academia Sinica 40. 1999. BARROS, RS. 2005. Influência do etileno SEREK, M; SISLER, EC. 2001. Efficacy of SISLER, EC; SEREK, M. 1997. Inhibitors of e do 1-MCP na senescência e longevidade inhibitors of ethylene binding in improvement ethylene responses in plants at the receptors das inflorescências de esporinha. Bragantia of the postharvest characteristics of potted level: recent developments. Physiologia 64: 33-38. flowering plants. Postharvest Biology and Plantarum 100: 577-582. Technology 23: 161-166. SUN, Y; CHRISTENSEN, B; LIU, F; WANG, H;SEGATTO, FB; FINGER, FL; BARBOSA, JG; MÜLLER, R. 2009. Effects of ethylene and RÊGO, ER; PINTO, CMF. 2013. Effects of SEREK, M; SISLER, EC; REID, MS. 1995. 1-MCP (1-methylcyclopropene) on bud and Ethylene on the post-production of potted 1-methylcyclopropene, a novel gaseous flower drop in mini Phalaenopsis cultivars. Plant Growth Regulation 59: 83-91.514 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Scientific communicationCORDEIRO, AAS; RODRIGUES, MB; GONÇALVES JÚNIOR, M; ESPÍNDOLA, JAA; ARAÚJO, ES; GUERRA, JGM. 2018. Organic cabbage growth using green manure in pre-cultivation and organic top dressing fertilization. Horticultura Brasileira 36: 515-520. DOI - http://dx.doi.org/10.1590/S0102- 053620180415Organic cabbage growth using green manure in pre-cultivation and organictop dressing fertilizationAna Amélia S Cordeiro1; Marinete B Rodrigues2; Murilo Gonçalves Júnior2; José Antônio A Espíndola3; Ednaldo daS Araújo3; José Guilherme M Guerra31Instituto Federal do Norte de Minas Gerais (IFNMG), Arinos-MG, Brazil; [email protected]; 2Universidade Federal Ruraldo Rio de Janeiro (UFRRJ), Seropédica-RJ, Brazil;. [email protected]; [email protected]; 3EmbrapaAgrobiologia, Seropédica-RJ, Brazil; [email protected]; [email protected]; [email protected] ABSTRACT RESUMO The experiment was conducted in (Integrated Agroecological Cultivo orgânico de repolho com adubação verde em pré-Production System in Seropedica-RJ) Sistema Integrado de Produção cultivo e adubação orgânica em coberturaAgroecológica (SIPA), Seropédica-RJ, to evaluate the effect oftwo maize populations in relation to baby corn productivity and O experimento foi conduzido na área do Sistema Integrado deshoot mass, to determine the contribution of pre-cultivated maize, Produção Agroecológica (SIPA), Seropédica-RJ, objetivando avaliargreen velvet and organic topdressing fertilization in the agronomic o efeito de duas populações de milho quanto à produtividade deperformance of cabbage (Brassica oleracea var. capitata). The minimilho e de massa de parte aérea, determinar a contribuição dosexperimental design consisted of randomized blocks with three pré-cultivos de milho, da mucuna verde e da adubação orgânica detreatments (maize population of 100,000 and 200,000 plants ha-1 cobertura, no desempenho agronômico do repolho. O delineamentoand green velvet at 100,000 plants ha-1) and eight replicates. After adotado foi constituído de blocos casualizados, com três tratamentosthat, cabbage was transplanted in the straw of these species, adopting (milho nas densidades de 100.000 e 200.000 plantas ha-1 e mucunaa randomized block design allocated in split plots, totalizing six verde na densidade de 100.000 plantas ha-1) e oito repetições. Natreatments, being three pre-cultivation practices and two organic sucessão, realizou-se o transplantio do repolho na palhada destastopdressing fertilization doses (with or without 50 g fermented organic espécies, adotando-se o delineamento de blocos casualizados distri-compost per planting hole). Considering “baby corn” productivity, buídos em parcelas subdivididas, totalizando seis tratamentos, sendono differences were observed compared to maize populations, with três pré-cultivos e duas doses de adubação orgânica de coberturaan average productivity of 822.5 kg ha-1. Green velvet pre-cultivation (ausência e presença de 50 g de composto orgânico fermentado porobtained the highest shoot dry mass (8.4 t ha-1). Cabbage crop was cova). Considerando a produtividade de “minimilho”, não foramimproved by green velvet pre-cultivation, reaching 60.7 t ha-1 and observadas diferenças em decorrência das populações de milho, comorganic topdressing fertilization, reaching 60.4 t ha-1; however, in produtividade média de 822,5 kg ha-1. A maior produtividade de massathe presence of green velvet straw, topdressing fertilization did not seca de parte aérea dos pré-cultivos foi obtida com mucuna verdepromote additional yield benefit of this crop. Thus, we noticed that (8,4 t ha-1). A cultura do repolho foi beneficiada pelo pré-cultivo comgreen manure using green velvet increased cabbage productivity, a mucuna verde, alcançando 60,7 t ha-1 e pela adubação orgânica desubmitted to organic management, when compared to maize pre- cobertura, alcançando 60,4 t ha-1, todavia, na presença da palhadacultivation, making it able to replace organic topdressing fertilization. de mucuna verde, a adubação de cobertura não promoveu benefício adicional no rendimento desta hortaliça. Desta forma, evidenciou-se que a adubação verde utilizando a leguminosa mucuna verde propor- ciona aumento de produtividade de repolho, submetido ao manejo orgânico, quando comparado ao pré-cultivo de milho e é capaz de substituir a adubação orgânica de cobertura.Keywords: Brassica oleracea var. capitata, agroecology, minimum Palavras-chave: Brassica oleracea var. capitata, agroecologia,tillage, baby corn, corn stigmas, velvet green. cultivo mínimo, minimilho, estigmas de milho, mucuna verde.Received on October 20, 2017; accepted on June 16, 2018Astrong appeal for sustainable biological soil characteristics, resulting integrated, for specialized systems. That agriculture has forced the search for in higher productivities (Sediyama et al., is the reason why local availability ofnew production systems, which include 2014). The evolution of the production organic matter for fertilization had beenthe replacement of synthetic fertilizers process led to the substitution of reduced.by organic ones. This practice promotes agricultural management practices, inbenefits to chemical, physical and which plant and animal farms were Alternatively to manures, the use of fermented “Bokashi” compost,Hortic. bras., Brasília, v.36, n.4, October-December 2018 515

AAS Cordeiro et al.a fermented mixture of wheat bran 2009; Corrêa et al. 2014). This botanical Those ears, measuring diameters fromand castor oil cake, inoculated with family is a widely consumed food and 0.8 to 1.8 cm (desired diameter) andeffective microorganisms (EM), has has great socioeconomic importance with no deformations, were classifiedbeen widely used (Mata et al., 2016). (Filgueira, 2008) and also presents high as marketable; the ones which were outThe predominant fermentation process nutrient extraction capacity (Silva et al., of the desired diameter were classifiedis lactic, however, acetic, alcoholic, 2012). In conventional management, as unmarketable (Pereira Filho & Cruz,propionic and butyric fermentation also cabbage (Brassica oleracea var. 2001) and mini corn with deformationsoccur (Siqueira & Siqueira, 2013). capitata) is generally fertilized using were classified as unmarketable due to high doses of soluble fertilizers (Aquino deformation. After determining fresh In tropical conditions, few scientific et al., 2005); however, in organic mass, subsamples of baby corn andstudies are related to the benefits of cultivation the green manure associated stigmas were taken to be dried in forcedthese fermented composts for plant with organic fertilization provides good air circulation at 65°C for 72 hours.mineral nutrition, though. Oliveira productivity levels for this vegetables Then, dry mass was quantified, ground(2015) observed that the application (Pereira, 2007). and taken to Laboratório de Químicaof this compost resulted in an increase Agrícola of Embrapa Agrobiologia toin number of leaves and fresh mass The aim of this study was to evaluate determine N, P, K, Ca and Mg contents.production of lettuce shoots (cv. Vera). the effect of green manure, in pre- cultivation with green velvet and corn in Cutting of corn and green velvet Another alternative to soil two population densities, associated with plants, in order to make straw mulch,fertilization is the green manure. Silva fermented organic compost “bokashi”, was carried out during the green velvetet al. (2011b), studying succession of on agronomic performance of cabbage flowering, at 144 days after sowing andorganic maize and kale cultivations submitted to organic cultivation. kept on the soil. We quantified phytomassunder no-tillage system, verified that samples and took subsamples, then drykale showed higher productivity, when MATERIAL AND METHODS mass was quantified and macronutrientsintercropped with vegetables Crotalaria contents were analyzed, as it was donespectabilis and Mucuna deeringiana. The experiment was installed for baby corn.Silva et al. (2011a) estimated that, in at Sistema Integrado de Pesquisaaverage, 67% of N in green velvet em Produção Agroecológica (SIPA) Non-leguminous species were usedtissues is derived from the biological “Fazendinha Agroecológica km 47”, as reference for natural abundancenitrogen fixation (BNF). Seropédica, Rio de Janeiro State of 15N in soil. False-milkweed (22º45’S, 43º41’W, 33 m altitude). (Emilia sonchifolia), wandering-jew Using grass mulch has many (Commelina erecta) and maize (Zeaadvantages such as high capacity of mass The soil is classified as Argisol. Soil mays) were collected in the experimentproduction and nutrient cycling, mainly chemical analysis in the 0-20 cm layer, area and analyzed, showing theK. Decomposition of the mulching with showed pH (water)= 6.1; Al+++= 0.0 following δ15N values: 10.60; 9.32 andgrass straw is lower than the mulching cmolcdm-3; Ca++= 1.9 cmolcdm-3; Mg++= 8.06, respectively. The contributionwith vegetables (Silva, 2002). The 0.93 cmolcdm-3; available P= 64 mg dm-3; of BNF was estimated using 15N ordecomposition rate of straw, in general, K+= 50.0 mg dm-3; organic matter = δ15N abundance technique (Shearer &is inversely proportional to the C/N 1.41 g kg-1. Kohl, 1988), with the aid of a massratio (Doneda, 2010), favoring the spectrometer (Finnigan MAT, modelmaintenance of mulching for a longer Cover crops were sown on February Delta Plus). The percentage contributionperiod of time. 22, 2011. Maize, cultivar Eldorado, of N derived from BNF was calculated was grown in a 1.0-m spacing between using the formula: % BNF = 100 (δ15N Considering the maize shoot furrows and 10 plants per linear meter of control plant - δ15N of fixing plant)production, this species presents (100,000 plants ha-1), 0.5 m between / (δ15N of control plant – B), being Bpotential to be used as mulching. One furrows and 10 plants per linear meter = -1.54, value corresponding to thealternative is producing straw and mini (200,000 plants ha-1). The green velvet isotopic discrimination of δ15N bycorn (baby corn) in situ. Baby corn (Mucuna pruriens cv. Utilis) was Mucuna pruriens, according to thatis the female inflorescence harvested planted in 0.5-m spacing between described by Okito et al. (2004), adoptedprior to fertilization (Barbosa, 2009), furrows and 5 plants per linear meter to estimate all the other species.being processed as industrialized food, (100,000 plants ha-1). The useful areabeing source of additional cash income. consisted of 4 m2 of central green velvet Five days after the mulching speciesStigma (corn hair) is recommended plots, for corn (100,000 plants ha-1) 2 cutting, cabbage seedlings, cultivarby popular medicine to treat edema, central rows measuring 2 meters long Seicho, 32-day old, were transplantedcystitis, gout and kidney stones (Li were delimited and for maize (200,000 into no-tillage system. The holes& Yu, 2009). However, no results in plants ha-1) 4 central rows measuring 2 were arranged in double rows, spacedrelation to stigma production in maize meters long were delimited. 0.4x0.3x0.7 m, totalizing 64 plantsfields in Brazil were found. per subplot and were fertilized using Baby corn ears were harvested planting fertilizer at a rate of 6.536 t ha-1 Many studies on management between 56 and 75 days after sowing. of tanned bovine manure presenting theof Brassicacea in organic farmingproduction have been carried out (Santos, Hortic. bras., Brasília, v.36, n.4, October-December 2018516

Organic cabbage growth using green manure in pre-cultivation and organic top dressing fertilizationfollowing chemical analysis: 15.0; 3.5; despite of the fact that yield was not plants ha-1 was higher and different12.0; 14.4 and 6.2 g kg-1, respectively of high, the high monetary value added from the population density of 200,000N, P, K, Ca and Mg. to this by-product of baby corn harvest corn plants ha-1 when analyzing mass should be highlighted. Experimental productivities of maize shoots. In the The experiment design was in results on stigma production were not lowest population density, productivityrandomized blocks, with four replicates, found in literature, so that no discussion was similar to the value found, in similararranged in split plot scheme, consisting in relation to productivity reached using weather conditions, by Corrêa et al.of six treatments; plots consisted of three the adopted organic management was (2014) with the same cultivar. The lowestpre-cultivations (mulching species) possible. productivity reached in the highestand subplots with and without organic population density allowed to verifytopdressing made from fermented Productivity of shoot dry mass of a possible occurrence of intraspecificcompost (0 t ha-1 and 2.28 t ha-1, and green velvet was superior and was competition (Table 2), which did notthe last dose equivalent to 100.0 kg ha-1 different from shoot dry mass of maize influence in baby corn productivity,N). This compost was prepared using a (Table 2). Productivity of shoot dry mass since the ears were early-harvested. Formixture of wheat bran (60%) and castor equivalent to 6.0 t ha-1 is considered Andrade et al. (1999), this crop showcake (40%), 200 L of water, 2 L of an appropriate amount of straw for low plasticity of growth when comparedeffective microorganisms solution and mulching, in no-tillage system (Darolt, to other species of Poaceae family, due1.5 kg of crystal sugar; the compost was 1998), in tropical conditions. On the to its limited capacity of leaf expansionkept in plastic buckets and hermetically other hand, in the Atlantic forest biome, and prolificity. This botanical familysealed and left to stand for 1 month this shoot productivity cannot be found. produces a mass with high qualityfor fermentation. Chemical analysis and volume (Andreola et al., 2000)showed: 44.3; 4.2; 11.5; 3.3 and 3.5 g Shoot dry mass of green velvet and usually presents a decompositionkg-1, respectively N, P, K, Ca and Mg. in this study was higher than the one rate inversely proportional to its C/N found by Silva et al. (2011a) in similar ratio (Doneda, 2010), favoring the Cabbage harvest was performed weather conditions. However, in spite establishment of mulching.on October 20, 2011, at 89 days after of producing greater amount of shoottransplanting. The following agronomic phytomass, equivalent to 8.4 t ha-1, this Some studies suggest thattraits were evaluated: whole plant fresh leguminous plant has a low C/N ratio, the efficiency of grass cultivationmass, head fresh mass, head weight. decomposing faster. Oliveira et al. intercropped with leguminous plantsThen, subsamples of each subplot (2008), analyzing different mulching produces straw with C/N ratiowere taken. These subsamples have decomposition, observed that C/N ratios intermediate to that of the species inundergone the same steps cover crop were lower in leguminous C. juncea, isolated crops, resulting in the lowestmass has (as it was mentioned above), velvet bean (Mucuna pruriens) and decomposition rate in relation to thein order to determine dry mass and the gliricidia (Gliricidia sepium) comparing phytomass when using leguminouschemical analysis of plant material. with sugar cane grass (bagasse) and plants exclusively, favoring the Cameroon grass. Percentage value maintenance of mulching longer and The obtained results were submitted of dry mass remaining in grass was synchronizing the supply stages andto statistical analysis using F test, with superior to leguminous plants, which increased demand for N by cropsthe aid of SAEG Program and Scott- showed low contents of remaining N, (Corrêa et al., 2014).Knott test at 5% significance level. showing faster release of this nutrient. The amount of N, K, Ca andRESULTS AND DISCUSSION The authors observed that the Mg accumulated in shoot area of population density of 100,000 maize No significant differences were Table 1. Fresh and dry mass (kg ha-1) of marketable and non-marketable husked baby cornobserved for baby corn productivity in per diameter and by deformations, dry straw mass and corn stigma dry mass, in two cornpopulation densities from 100,000 to population densities. Seropédica, UFRRJ, 2011.200,000 plants ha-1(Table 1). Averagevalues for marketable baby corn Treatment MDC NCBCD MDNDef EECproductivity were 822.5 kg ha-1. Similarvalues for mass of marketable fresh baby M100 Fresh mass Dry masscorn were found by Corrêa et al. (2014) M200in the same experimental area and by 809.25 A 504.78 A 55.93 A 67.5 AJesus (2009) in the North FluminenseRegion. 836.12 A 436.70 A 67.86 A 65.8 A In relation to baby corn stigmas, the CV (%) 9 28 36 12authors did not observe any significantdifference between the two plant Averages followed by same letter in the column do not differ from each other by Scott-Knottpopulation densities (Table 1). The test, 5% probability level; MDC= marketable husked baby corn; NCBCD= Non-marketableaverage productivity reached 66 kg ha-1; baby corn by diameter; MDNDef= Non-marketable husked baby corn, by deformations; EEC= Stigmas of harvested ears; M100 and M200= Respectively, maize grown in the density population of 100,000 and 200,000 plants ha-1.Hortic. bras., Brasília, v.36, n.4, October-December 2018 517

AAS Cordeiro et al.green velvet was higher compared to organic compost), in relation to any in pre-cultivation with green velvettreatments with maize, which shows analyzed variables. However, positive and in the presence of mulching, wasthe high capacity of this leguminous and independent effects were detected similar to the observed by Moreira et al.plant for nutrient cycling (Table 2). analyzing pre-cultivation with green (2011). Analyzing cabbage productionClose values, except for Ca, were found velvet and topdressing using fermented in relation to synthetic-N fertilizer,by Lima et al. (2010) in velvet bean, organic compost on cabbage productive Moreira et al. (2011) obtained thereporting average values of 196.6; performance (Table 3). maximum estimated value of 1.13 kg of14.4; 100.7; 41.9 and 13.9 kg ha-1, for head fresh mass, applying 278 kg N ha-1.N, P, K, Ca and Mg, respectively. The In this context, pre-cultivationamount of N, P and Mg accumulated in with green velvet provided an increase Values of cabbage productivity,maize shoots, in population density of in production and, consequently, in using green velvet straw and maize200,000 plants ha-1 was lower than that productivity of cabbage “heads” in t ha-1, straw, reached levels similar to theof the accumulated quantity on density when compared to pre-cultivations with ones found by Vargas et al. (2011),of 100,000 plants ha-1, due to the lower different maize population densities. under conventional cultivation withproductivity observed in the highest This increase reached about 15 and 22%, C. juncea and C. ensiformis straw, andpopulation density (Table 2). In maize corresponding to gains in productivity of using nitrogen fertilization with75 kg ofpopulation of 200,000 plants ha-1, Corrêa heads, from 9 to 13 t ha-1, respectively, in N ha-1, yield was between 47.0 to 58.0et al. (2014) verified values similar to relation to pre-cultivations equivalent to t ha-1. Oliveira et al. (2003) reachedthe ones found in this study, except for maize densities from 100,000 to 200,000 productivity of 34.7 t ha-1, under organicthe quantity accumulated in the shoots plants ha-1. This fact is possibly due to cultivation with C. juncea straw, inof N and Ca. the benefits resulting from the greater population density of 27,778 plants ha-1. cycling of nutrients provided by the Under the same weather conditions, In organic cabbage cultivation, the green velvet straw, comparing to maize, Santos (2009) found productivityauthors did not verify interactive effects mainly the cycling of nitrogen (Table 3). ranging from 62 to 74 t ha-1, growingrelated to the studied variation sources cabbage with C. juncea straw, under(pre-cultivation and dose of fermented Average cabbage head weight in mono and intercropping system with the adopted organic management, both either sunflower or sorghum, under the same edaphoclimatic conditions.Table 2. Mass productivity of mulching and amount of macronutrients accumulated in planttissues. Seropédica, UFRRJ, 2011. Higher accumulations of N, P and Mg in cabbage shoots were providedTreatment Dry mass N P K Ca Mg by pre-cultivation with green velvet, (t ha-1) (kg ha-1) differing statistically from the other treatments (Figure 1). These valuesM100 4.9 B 61.3 B 16.4 A 65.1 B 9.65 B 11.0 B are close to the ones found by Pereira (2007), evaluating nutrient accumulationM200 3.3 C 43.5 C 12.1 B 52.1 B 6.42 B 7.7 C in cabbage mass, under no-tillage on C. juncea straw; Pereira (2007) found 99.6;MV100 8.4 A 184.6 A 11.9 B 91.0 A 145.40 A 20.0 A 11.6; 131.8; 16.7; 6.0 kg ha-1 of N, P, K, Ca and Mg, respectively.CV (%) 16 20 26 20 20 28 In relation to BNF through the useAverages followed by same letters in the column do not differ from each other by Scott-Knott of green velvet, the amount of N fromtest, 5% probability; M100 and M200= Maize grown in the population density of 100,000 the atmosphere, estimated by naturaland 200,000 plants ha-1, respectively; MV100= Green velvet cultivated in the population abundance of 15N technique, was 62% similar to the value found by Silva etdensity of 200,000 plants ha-1. al. (2011a), which is the accumulated amount of 114.32 kg ha-1 of N in theTable 3. Fresh mass of the whole plant, cabbage “head” average weight and N content of shoots. Considering the equivalence,cabbage, cultivated in no-tillage system, on mulching mass with and without organic fertil- disregarding soil N recovery efficiencyization. Seropédica, UFRRJ, 2011. by the cabbage from decomposition process of green velvet straw, this valueKind of Whole plant Head mass Head productivity N content corresponds to an application of 254 kgstraw mass (t ha-1) ha-1 of a concentrated synthetic fertilizer (kg per plant) (t ha-1) (urea). Considering the N fertilization recommended by Filgueira (2008), theM100 78.93 B 1.03 B 51.46 B 22.9 B amount of N derived from accumulated BNF only in green velvet shoots, is aM200 72.44 B 0.94 B 47.14 B 21.8 B value close to what is recommended for this crop. In this context, consideringMV100 87.29 A 1.21 A 60.77 A 28.2 AOrganic compost0N 72.05 B 0.92B 46.22 B 22.5 B100N 87.4 A 1.20 A 60.44 A 26.0 AAverages followed by same letters in the column do not differ from each other by Scott-Knotttest, 5% probability; M100 and M200= Maize grown in the population density of 100,000and 200,000 plants ha-1, respectively; MV100= Green velvet cultivated in the populationdensity of 200,000 plants ha-1; 0N= 0.0 kg ha-1 N; 100N= 100.0 kg ha-1 N.518 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Organic cabbage growth using green manure in pre-cultivation and organic top dressing fertilizationorganic management, pre-cultivation atmospheric N2 fixing bacteria. of N supply for the crop. Thus, organicwith green velvet shows potential to Using the results, the authors topdressing can be replaced by pre-provide significant amount of N to cultivation with this leguminous plant,reach productivity levels similar to concluded that cabbage which had showing advantage of soil protectionthe ones obtained under conventional been organically cultivated, under no- and, also monetary-cost benefits. Thus,management. tillage system using green velvet, in this system can be an alternative for the absence of topdressing application, organic production systems, in which Evaluating N contents in cabbage with fermented organic compost, did not the use of synthetic N fertilizers is notheads (Table 3), the authors observed show any mass productivity decrease allowed, as well as in conventionalthat in green velvet straw cultivation when compared with organic fertilized production systems.N content was higher, differing treatment (Table 3). These resultssignificantly from the other treatments. show the contribution of BNF through In this context, Pereira (2007)This is due to the fact that this species the use of green velvet, after straw suggests replace supplementary organicperforms biological fixation with decomposition, as an effective source fertilization by pre-cultivation with C. juncea, since the productivity ofFigure 1. Accumulated amount of nutrients in shoots of cabbage, cultivated on the mulching cabbage grown on the straw of thisstraw; 1Bars with the same letters do not differ among themselves by Scott-Knott test, 5% leguminous plant, without topdressingprobability; M100 and M200= Maize grown in the population density of 100,000 and application, did not differ from the200,000 plants ha-1, respectively; MV100= Green velvet cultivated in the population density productivity of cabbage with poultryof 200,000 plants ha-1. Seropédica, UFRRJ, 2011. litter, 200 kg ha-1 N.Figure 2. Amount of nutrients accumulated in shoot of cabbage using topdressing with In relation to the amount of nutrientsorganic compost; 1Bars with the same letters do not differ among themselves by Scott-Knott accumulated in cabbage shoots, thetest, 5% probability; 0N= 0.0 kg ha-1 N; 100N= 100.0 kg ha-1 N. Seropédica, UFRRJ, 2011. authors observed that the topdressing with fermented organic compost resultedHortic. bras., Brasília, v.36, n.4, October-December 2018 in an increase of N, P, K and Ca (Figure 2) when compared to the absence of this organic fertilization. Similarly, Oliveira et al. (2003) reported that supplementary topdressing with poultry litter, in cabbage cultivation, provided an increase in nutrient accumulation in the shoot area. The authors concluded that population density of 100,000 maize plants ha-1 provided the same productivity of baby corn fresh mass and maize stigma dry mass, as density of 200,000 maize plants ha-1. However, in the lower population density, shoot productivity is higher than the productivity found in the higher density, making it the best alternative, considering productivity indexes, seed economy and ease of crop management. Pre-cultivations with maize and green velvet resulted in high productivity of dry shoot phytomass, which shows that a strategy favoring the use of these species can provide the production of straw produced in situ aiming to cabbage minimal cultivation under organic production systems. Productivity of cabbage on green velvet straw was higher than the productivity of cabbage grown on maize straw, considering that topdressing with the compost did not result in an additional gain in relation to this 519

AAS Cordeiro et al.vegetable yield, this system showed to DONEDA, A. 2010. Plantas de cobertura de 37: 60-66.be unnecessary. Even cabbage being solo consorciadas e em cultivo solteiro:cultivated on the maize straw showed decomposição e fornecimento de nitrogênio ao PEREIRA, AJ. 2007. Caracterização agronômicasatisfactory productivity, above national milho. Santa Maria: UFSM. 79p (MSc. thesis). de espécies de Crotalaria L. em diferentesaverage, and increased in the presence of condições edafoclimáticas e contribuiçãotopdressing fertilization with the organic FILGUEIRA, FAR. 2008. Novo manual de da adubação verde com Crotalaria junceacompost “bokashi” obtained from wheat olericultura: Agrotecnologia moderna na no cultivo orgânico de brássicas em sistemafermentation and cake. produção e comercialização de hortaliças. 3ª de plantio direto. Seropédica: UFRRJ. 72p ed. Viçosa: UFV. 412p. (Ph.D. thesis). ACKNOWLEDGEMENTS JESUS, VP. 2009. Produção de minimilho (Zea PEREIRA FILHO, IA; CRUZ, JC. 2001. Manejo The authors thank to Coordination mays l.) em diferentes sistemas de manejo. cultural do minimilho. Revista Brasileiraof Improvement of Higher Education Campos dos Goytacazes: UENF. 59p (MSc. Agropecuária 3: 41-43.Personnel (CAPES), Universidade thesis).Federal Rural do Rio de Janeiro SANTOS, CAB. 2009. Consórcios de espécies(UFRRJ), Embrapa Agrobiologia, LI, FL; YU, L. 2009. Flavonoids extraction from de cobertura de solo para adubação verde,Foundation for Research Support of Rio maize silk and its function on blood sugar antecedendo ao cultivo milho e repolho sobde Janeiro (FAPERJ) and The National control. China Food Additives 94: 121-124. manejo orgânico. Seropédica: UFRRJ. 80pCouncil for Scientific and Technological (M.Sc. thesis).Development CNPq) for the financial LIMA, JD; SAKAI, RK; ALDRIGHI, M; SAKAI,support for the experimental study. M. 2010. Arranjo espacial, densidade e época SEDIYAMA, MAN; SANTOS, IC; LIMA, de semeadura no acúmulo de matéria seca e PC. 2014. Cultivo de hortaliças no sistema REFERENCES nutrientes de três adubos verdes. Pesquisa orgânico. Revista Ceres 61: 829-837, Agropecuária Tropical 40: 531-540.ANDRADE, FH; VEGA, C; UHART, S; CIRILO, SHEARER, G; KOHL, DH. 1988. Natural A; CANTARERO, M; VALENTINUZ, O. MATA, MG; GUERRA, JGM; PINHEIRO, 15N – abundance a method of estiming the 1999. Kernel number determination in maize. EFM; CEDDIA, MC. 2016. Análise espaço- contribution of biological fixed nitrogen to Crop Science 39: 453-459. temporal dos atributos químicos do solo N2 – fixing systems: Potential for non-legumes. de um módulo de pesquisa em produção Plant and Soil 110: 317-327.ANDREOLA, F; COSTA, LM; OLSZEVSKI, N; orgânica. In: AMARAL SOBRINHO, NMB; JUCKSCH, I. 2000. A cobertura vegetal de CHAGAS, CI; ZONTA, E. (org). Impactos SILVA, AGB; GUERRA, JGM; GONÇALVES inverno e a adubação orgânica e, ou, mineral ambientais provenientes da produção agrícola: JUNIOR, M; COSTA, JR; ESPÍNDOLA, influenciando a sucessão feijão/milho. Revista experiências argentinas e brasileiras. 1. ed. JAA; ARAÚJO, ES. 2011a. Desempenho Brasileira de Ciência do Solo 24: 867-874. Livre Expressão. p.165-197. agronômico de mucuna verde em diferentes arranjos espaciais. Pesquisa AgropecuáriaAQUINO, LA; PUIATTI, M; PEREIRA, PRG; MOREIRA, MA; VIDIGAL, SM; SEDIYAMA, Brasileira 46: 603-608. PEREIRA, FHF; CASTRO, MRS; LADEIRA, MAN; SANTOS, MR. 2011. Crescimento R. 2005. Características produtivas do repolho e produção de repolho em função de doses SILVA, EE; POLLI, H; GUERRA, JGM; em função de espaçamentos e doses de de nitrogênio. Horticultura Brasileira 29: AGUIAR-MENEZES, EL; RESENDE, ALS; nitrogênio. Horticultura Brasileira 23: 266- 117-121. OLIVEIRA, FL; RIBEIRO, RLD. 2011b. 270. Sucessão entre cultivos orgânicos de milho OKITO, A; ALVES, BRJ; URQUIAGA, S; e couve consorciados com leguminosas emBARBOSA GR. 2009.Cultivares de milho a BODDEY, RM. 2004. Isotopic fractionation plantio direto. Horticultura Brasileira 29: diferentes doses de zinco para produção de during N2 fixation by four tropical legumes. 57-62. minimilho em Vitória da Conquista-BA.Vitória Soil Biology & Biochemistry 36: 1179-190. da Conquista: UESB, 54p. (MSc. thesis). SILVA, KS; SANTOS, ECM; BENETT, CGS; OLIVEIRA, FL; GUERRA, JGM; ALMEIDA, LARANJEIRA, LT; EBERHARDT NETO,CORRÊA, AL; ABBOUD, ACS; GUERRA, DL; RIBEIRO, RLD; SILVA, ED; SILVA, E; COSTA, E. 2012. Produtividade e JGM; AGUIAR, LA; RIBEIRO, RLD. 2014. VV; ESPINDOLA, JAA. 2008. Desempenho desenvolvimento de cultivares de repolho Adubação verde com crotalária consorciada de taro em função de doses de cama de em função de doses de boro. Horticultura ao minimilho antecedendo a couve-folha sob aviário, sob sistema orgânico de produção. Brasileira 30: 520-525. manejo orgânico. Ceres 61: 956-963. Horticultura Brasileira 26: 149-153. SILVA, VV. 2002. Efeito do pré-cultivo de adubosDAROLT, MR. 1998. Princípios para implantação OLIVEIRA, EAG. 2015. Formulações tipo verdes na produção orgânica de brócolos e manutenção de sistemas. In: Plantio direto: “bokashi” como fertilizantes orgânicos no (Brassica oleraceae var. Itálica) em sistema pequena propriedade sustentável. Londrina: cultivo de hortaliças. Seropédica: UFRRJ. de plantio direto. Seropédica: UFRRJ. 80p IAPAR. p.16-45. 79p. (Ph.D. thesis). (M.Sc. thesis). OLIVEIRA, FL; GUERRA, JGM; ALMEIDA, SIQUEIRA, AP; SIQUEIRA, MFB. 2013. DL; RIBEIRO, RLD; ESPINDOLA, JAA; Bokashi: adubo orgânico fermentado. Niterói: RICCI, MSF; CEDDIA, MB. 2008. Avaliação Programa Rio Rural, 16p. (Manual Técnico, de coberturas mortas em cultura de alface sob 40). manejo orgânico. Horticultura Brasileira 26: 216-220. VARGAS, TO; DINIZ, ER; SANTOS, RHS; LIMA, CTA; URQUIAGA, S; CECON, PR. OLIVEIRA, FL; RIBAS, RGT; JUNQUEIRA, 2011. Influência da biomassa de leguminosas RM; PADOVAN, MP; GUERRA, JGM; sobre a produção de repolho em dois cultivos ALMEIDA, DL; RIBEIRO, RLD. 2003. Uso consecutivos. Horticultura Brasileira 29: do pré-cultivo de Crotalaria junceae de doses 562-568. crescentes de “cama” de aviário na produção do repolho sob manejo orgânico. Agronomia520 Hortic. bras., Brasília, v.36, n.4, October-December 2018

Scientific communicationMOURA, LE; GOLYNSKI, A. 2018. Critical points of industrial tomato from field to processing. Horticultura Brasileira 36: 521-525. DOI - http://dx.doi. org/10.1590/S0102-053620180416Critical points of industrial tomato from field to processingLuis Eduardo de Moura; Adelmo Golynski11Instituto Federal Goiano (IFGoiano), Morrinhos-GO, Brazil; [email protected]; [email protected] ABSTRACT RESUMO The authors evaluated critical points of production stages of the Pontos críticos ocorridos em frutos de tomate industrial doindustrial tomato, through physical and physico-chemical analyzes campo ao processamentoof U2006 hybrid fruits in the harvest, 2016. Fruits were evaluated inrelation to raw material, temperature, fresh mass, pH, soluble solids Foram avaliados os pontos críticos ocorridos nas etapas de(°Brix), firmness, titratable acidity and extravasation of electrolytes. produção do tomate industrial, por meio de análises físicas e físico-Samples were collected in six steps: manual, mechanized, truck, -químicas dos frutos do híbrido U2006 na safra ocorrida em 2016.arrival at industry, unloading and selection mat in two periods, Os frutos foram avaliados quanto à classificação de matéria-prima,morning and afternoon, totalizing 60 fruits for each step, and four temperatura, massa de matéria fresca, pH, sólidos solúveis (°Bríx),replications. Fruits which waited for more than 10 hours in the yard firmeza, acidez titulável e extravasamento de eletrólitos. As coletasgenerated an increase in serious defects (%), loss of fresh mass, foram realizadas em seis etapas: manual, mecanizada, caminhão,discount on the amount paid for the load. The most critical stages of chegada à indústria, descarregamento e esteira de seleção, em doisthe production process were identified when tomatoes arrived at the períodos: manhã e tarde, totalizando 60 frutos por cada etapa emindustry and their unloading, when the fruits presented fresh mass loss quatro repetições. Os frutos que esperaram acima de 10 horas nodue to the high temperature. In addition, the authors highlight that a pátio geraram aumento de defeitos graves (%), perda da massa debetter organization in the arrivals at the industry as well as an efficient matéria fresca, desconto no valor pago pela carga, com alteraçõescommunication of crop restriction is crucial, since unscheduled stops na qualidade. As etapas mais críticas do processo produtivo foramincrease waiting time, causing significant quality losses. identificadas na chegada à indústria e seu descarregamento, onde os frutos apresentaram perda de massa de matéria fresca devida à elevada temperatura. Sugere-se melhor organização nas chegadas à indústria bem como eficiente comunicação de restrição das colheitas, uma vez que paradas não programadas elevam o tempo de espera, provocando, portanto, perdas significativas na qualidade.Keywords: Solanum lycopersicum, postharvest, quality. Palavras-chave: Solanum lycopersicum, pós-colheita, qualidade.Received on October 26, 2017; accepted on August 13, 2018Tomato is the second most grown to Mendes et al. (2011), an increase in We aimed to highlight the critical vegetable consumed worldwide. breathing occurs due to the production points from harvest to the processingThis plant is a crop of great economic of ethylene and other biochemical of tomato fruits, being verified throughand social importance being also reactions responsible for changes in physical and physico-chemical analyzesimportant in human diet. Goiás (86%) color, texture and nutritional quality in the fruits.followed by São Paulo (12.7%) and after physical damage during harvestMinas Gerais (1.3%) are the main or shipping. MATERIAL AND METHODSstates where tomatoes are producedfor processing industries (Vilela et al., Therefore, tomato maturation during To build a data bank in this study,2012). harvest and pre and post harvest control industrial tomato samples were obtained are essential in order to ensure fruit in concentrated maturation stage, firm This study was carried out in the quality (Beckles, 2012), preventing the fruits in properties A (17°50’27”S,municipality of Morrinhos, Goiás State, entry of pathogenic microorganisms 49°10’60”W, altitude 888 m), Bwhere industrial tomato cultivation (Ronchi et al., 2010). Physical damage (17°43’51”S, 49°03’46”W, altitude 821stands out, productivity of 112 thousand significantly affects chemical and m), and a factory specialized in tomatotons (IBGE, 2015). physical compositions of pericarp and derivatives (17°46’13”S, 49°07’40”O, locular tissue in tomato fruits (Ferreira altitude 800 m), in the municipality of Water content ranges from 90 to et al., 2009). Thus, harvest done during Morrinhos, Goiás State, Brazil. Samples95%, which characterizes tomato as a the appropriate maturation stage will were collected in six steps and in twohighly perishable fruit, with losses of determine fruit quality (Damatto Juniorup to 21% after harvest (Rocha et al., et al., 2010). 5212009; Rinaldi et al., 2011). AccordingHortic. bras., Brasília, v.36, n.4, October-December 2018

LE Moura & A Golynskidistinct periods of the day, morning control of goods receipt. According to (A) (Calbo & Nery, 1995):and afternoon, to observe physiological Table 1, adapted from ordinance n° 278,changes caused by thermal stress. 1988, MAPA. A discount was applied In which, to convert mm to cm, the on cargo weight for payment purposes. authors divided mm by 10. The steps were: 1) Manual harvest (inthe same area, right before mechanized Analyses were done at Laboratório A= flattened area in cm2; d1= lengthharvest); 2) Mechanized harvest (sample do Instituto Federal Goiano, Campus (cm); d2 = width (cm).collected on selection mat, when Morrinhos, for fresh mass, pH, solubletomatoes were harvested); 3) Samples solids, firmness, titratable acidity and Firmness was obtained by dividingin the truck (collected in the truck still in extravasation of electrolytes. the weight of the probe (P) kilogramthe field); 4) Arrival at industry (samples force by flattened area (A) cm2, Fz= P/A.collected at the moment when the truck Data on average temperature and (Calbo & Nery, 1995).arrived at the industry); 5) Unloading relative humidity were collected on(samples collected when the tomato was harvest days of samples in the weather In which: Fz= firmness (N); P= flattenerunloaded for processing); 6) Selection station of Instituto Federal Goiano weight; A= area in cm2.mat (samples collected on the mat, in Campus Morrinhos (17°48’50”S,the industry). All used samples were 49°12’16” W, altitude 902 m) In order to convert fimness from Kgfobtained from the same truck in all steps. to N, the equation was multiplied by 9.8. Fresh mass was measured on 30 Collecting phase totalized 60 fruits fruits, randomly separated and put To determine soluble solids, weper each step. Fruits were packed in on plastic trays, being weighed in a calibrated the refractometer withplastic boxes, in four replications. After semi-analytical balance (FCB 3K0.1, distilled water having a zero-index ofcollecting, samples were taken to the Kern, Kern & Sohn Gmbh, Stuttgart, refraction. Juice was extracted from fivelaboratory in boxes, which were stored Germany). fruits, using replication method, addingat a climate-controlled room, for up to two drops of juice on the prism of the12 hours, at 20°C temperature. Titratable acidity was determined portable refractometer 0-32°Brix (RZT, using the official method described Bel Engineering, Bel Equipamentos The authors evaluated the by Instituto Adolfo Lutz, based on Analíticos LTDA) and then refractivecommercial tomato hybrid U2006 neutralization titration with NaOH index reading was carried out. Afterfor industrial processing (Nunhems (0.1 N) up to pH 8.2. Fruits were each reading, prism was properlyBrasil-Bayer Crop Science), resistant washed and dried with paper towels, washed with distilled water and driedto diseases like bacterial spot and before extraction of juice from 5 fruits with double-sided absorbent paper,begomovirose, considered the main per replicate using a fruit centrifuge until having all readings totaled (sixphytosanitary issues of tomato for (FastFruitInox, Suggar). Then, 1 mL of collecting steps), performing fourindustrial processing (Villas-Bôas et al., juice was transferred to an Erlenmeyer replicates and recording all obtained2007; Fernandes, 2008). flask containing 9 mL distilled water data, according to the methodology and 3 to 5 drops of phenolphthalein proposed by Instituto Adolfo Lutz. Fruits were collected in two indicator. Afterwards, titration was doneproperties, in the beginning of harvest, with NaOH solution in six collect steps, To determine pH, fruits were washed2016. The first property where the in four replicates. and, right after, dried using a towelsamples were collected, named paper, then juice was extracted from 5“Property A”, is located 12 km away Acidity (in molar solution, % fruits of each replicate in the centrifugefrom the industry, being 10 km asphalt v/m) was calculated according to the (FastFruitInox, Suggar). Afterwards,road and 2 km dirt road. The second following formula (Instituto Adolfo they were measured using a pH meterproperty, named “Property B”, located Lutz, 2008): (mPA-210, MS Tecnopon, MS Tecnopon11.2 km away from the industry, being Instrumentação) with standard solutions10.9 km asphalt road and 0.30 km dirt Where V= volume in mL of NaOH 4.00 and 7.00. After measurement,road. solution (0.1 N) spent via titration; electrode was cleaned with distilled f= factor of NaOH (0.1 N); P= mass water and dried with double-sided Raw material was classified at the (g) of the sample used in titration; c= absorbent paper. Thereafter, the authorsindustry, in order to evaluate defects correction factor used was 10, since performed the reading of the six-step-in fruits, which interfere with the titration was done with NaOH (0.1N). collection samples with four replicates,quality required for cargo pricing. All recorded the obtained data, according totrucks were accompanied from the Firmness analysis was determined the methodology proposed by Institutofield up to processing and they were using flattening technique, 0.264 kg, Adolfo Lutz.classified and analyzed using industry with the aid of a caliper (1.0004,methodologies in six defects, being ZAAS), measuring length and diameter Membrane electrolyte extravasationfour defects classified as serious defects (in mm) on both sides of the fruit, in was evaluated according to some(disintegrated, visible locules, moldy five fruits and six collect steps, with adaptations from the methodologyand green) and two general defects four replicates. The flattened area was described by Vasquez-Tello et al.(discolored and smashed). Obtained data estimated using the ellipse area formulawere recorded on the form of quality Hortic. bras., Brasília, v.36, n.4, October-December 2018522

Critical points of industrial tomato from field to processing(1990) and Pimentel et al. (2002). Disks obtained using the formula: the amount of money paid for the cargo,in 10 fruits, 5 mm diameter, of each besides impacting on fruit quality. Forreplicate, were collected. The disks were The obtained data were submitted to producer and for industry, these factorswashed previously in water and then ANOVA test for variance analysis and are prejudicial since fruit was weighedsubmerged in 30 mL distilled water, the averages were submitted to Tukey after the waiting time in the outside area.in amber bottles, for 24 hours, at room test, at 5% significance level.temperature. Then, free conductivity In Brazil, besides high luminosity, thewas measured (CL, µS/cm), using a RESULTS AND DISCUSSION temperatures are excellent for growingbenchtop conductivity meter (EC-125, tomato, ranging from 21-28°C duringHANNA, Hanna Instruments, Padova, The morning shift waiting times the day and 15-20°C during the nightItália). Afterwards, the same bottles were shorter, in relation to the afternoon (Filgueira, 2008). Average temperatureswere placed in an oven (Q317M, shift, due to arrival order and process found are within the tolerance range inQuimis, Quimis Aparelhos Científicos, in industry. the morning, but not in the afternoon.São Roque, São Paulo) for one hour Temperature in properties A and Bat 100°C and after cooling at room Thus, over 10 hours of standby (Table 2) showed significant differencestemperature, and total conductivity was time, incidence of serious defects were during this period. The authors noticedmeasured (CT, µS/cm). In order to avoid greater than 20% (Table 2), resulting in some changes in the morning shift, inerrors, the sensor was cleaned between a discount which reflected directly on both properties where the weather waseach reading with distilled water. The warmer due to the sunset and coolerelectrolyte extravasation rate was during unloading due to the cold water used in this process. In the afternoon, theTable 1. Classification of tomato for processing adopted in industry. Morrinhos, IFGoiano, temperature in the field is very high and2016. tends to decrease along harvest steps, until unloading and milling, due to theSerious defects (%) Discount (%) use of cold water in the last steps.≤ 20 Standard Property A did not show any significant difference in the morning20.1 a 25.0 -5 (2,267 kg) and in the afternoon (2,167 kg) for fresh mass. On the other hand,25.1 a 30.0 -10 property B showed significant difference both in the morning (2,389 kg) and in30.1 a 35.0 -20 the afternoon (2,178 kg). The critical point was in unloading step in property35.1 a 40.0 -30 A, whereas in property B, the highest loss of fresh mass was verified in≥ 40 DisapprovedSource: adapted from ordinance n°278, 1988, Ministry of agriculture, livestock and foodsupply.Table 2. Physical and chemical attributes of the industrial tomato, hybrid U 2006 (harvest 2006): Classification of the raw material, waitinghours in the outside area (Hours), relative humidity (UR), temperature (TC), fresh matter mass (MF), titratable acidity (AT), firmness (FZ),soluble solid content (°Bríx), hydrogen potential (pH), extravasation of electrolytes (EE). Morrinhos, IFGoiano, 2016.Shift Serious defects (%) General defects (%) Quality (%) Hours UR (%) TC (oC) Property A 24.70B 31.39AMorning 17.40 39.21 43.35 5.0 61.0 23.27BAfternoon 19.86 33.51 46.63 4.7 62.3 38.86A EE (%) Property B 38.39BMorning 20.48 17.52 61.99 15.6 61.0 69.11AAfternoon 22.21 26.59 51.19 14.7 62.3 28.10B 72.35A MF (kg) AT (%) FZ (N) oBrix pH Property AMorning 2.267A 0.53A 1.06A 4.19 A 4.49BAfternoon 2.167A 0.53A 0.85A 4.06 A 4.61A Property BMorning 2.389A 0.52A 1.97A 4.40 A 4.48AAfternoon 2.178B 0.55A 0.86B 4.14B 4.67AAverages followed by same letters in the column do not differ from each other, Tukey test, 5% significance.Hortic. bras., Brasília, v.36, n.4, October-December 2018 523