TJVM Vol. 49 No. 3 September 2019

THE THAI JOURNAL OF VETERINARY MEDICINE Office: Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330 Thailand Tel. 66(2) - 218 9556-7 Fax. 66(2) - 255 3910 Advisory Committee: Asst. Prof. Dr. Thawatchai Sakphuaram President of the Veterinary Council of Thailand Prof. Dr. Roongroje Thanawongnuwech Dean Dr. Somchuan Ratanamungklanon President of the Thai Veterinary Medical Association Prof. Dr. Alongkorn Amonsin under the Royal Patronage Associate Dean of Academic International and Student Affairs Dr. Boonlert Preechatangkij President of Chulalongkorn University Veterinary Prof. Dr. Kaywalee Chatdarong Alumni Association Associate Dean of Research and Innovation Editorial Board: Andrew Ponter (France) Andrej Madej (Sweden) Annop Kunavongkrit (Thailand) Eileen L. Thacker (USA) Atichat Bramasa (Thailand) Elisabeth Persson (Sweden) Chollada Buranakarl (Thailand) Han-Soo Joo (USA) Jiroj Sasipreeyajan (Thailand) Karen L. Keller (USA) Marissak Kalpravidh (Thailand) Oliver Sparagano (UK) Mongkol Techakumphu (Thailand) Stanley H. Done (UK) Narongsak Chaiyabutr (Thailand) Stig Einarsson (Sweden) Peerasak Chanprateep (Thailand) Takashi Aoki (Japan) Pranee Tuntivanich (Thailand) Teresa Y. Morishita (USA) Roongroje Thanawongnuwech (Thailand) Masashi Maita (Japan) Somchai Chanpongsang (Thailand) Eric Lombardini (USA) - Padet Tummaruk (Thailand, Editor-in-Chief) Anudep Rangsipipat (Thailand) Boonrit Thongsong (Thailand) Theerayuth Kaewamatawong (Thailand) Piyarat Chansiripornchai (Thailand) Anusak Kijtawornrat (Thailand) Chenphop Sawangmake (Thailand) Nutthee Am-in (Thailand) Morakot Nuntapaitoon (Thailand) Sirawit Pagdepanichkit (Thailand) Orapun Jaturakan (Thailand) Sirinun Pisamai (Thailand) Chutimon Thanaboonnipat (Thailand) Journal Management and Membership: Mr. Kritsana Phanchinda and Mrs. Junya Petchkongthong The Veterinary Library and Information Center Faculty of Veterinary Science, Chulalongkorn University, Bangkok, 10330 Thailand Tel. 66(2)- 218 9556-7 Email: [email protected] https://www.tci-thaijo.org/index.php/tjvm This publication will be indexed and abstracted in Science Citation Index Expanded (SciSearch®), SCOPUS, CABI, ProQuest and EBSCO Publisher: Chulalongkorn University Printing House (5305-128/600) Phayathai Road, Pathumwan, Bangkok, 10330 Thailand Tel. 66(2) - 218 3557-63, Fax. 66(2) - 218 3551

Board of Reviewing Editors TJVM would like to thank the followings for their expertise contribution to the Journal in 2017-2019 Animal Husbandry: Somchai Chanpongsang, Duangsmorn Suwattana, Nalinee Imboonta, Chackrit Nuengjamnong, Praopilas Phakdeedindan Animal Nutrition: Bas Kemp, Peter Kapple Theil, Boonrit Thongsong, Uttra Jamikorn, Chaiyapoom Bunchasak, Suriya Sawanon, Anongnart Assavacheep, Thita Taecholarn Aquatic Animal Medicine: Nantarika Chansue, Janenuj Wongtavatchai, Aranya Ponpornpisit, Channarong Rodkhum, Nopadon Pirarat, Win Surachetpong, Pattanapon Kayansamruaj, Patharapol Piamsomboon, Thanida Hetrakul Biochemistry: Sirakarnt Dhitavat, Gunnaporn Suriyaphol, Prapruddee Piyawiriyakul, Sariya Asawakarn, Phongsakorn Chuammitri, Teerapong Yata Companion Animal Medicine: Rosama Pusoonthornthum, Meena Sarikaputi, Walasinee Sakcamduang, Niyada Thitaram, Thawat Lekdumrongsak, Sukullaya Ritthikulprasert, Sirilak Disatian Surachetpong, Chaowaphan Yinharnmingmongkol, Tassanee Jaroensong, Vachira Hunprasit Livestock Animal Medicine: Kittisak Ajariyakhajorn, Somsak Pakpinyo, Witaya Suriyasathaporn, Niwat Chansiripornchai, Worapol Aengwanich, Chaidate Inchaisri, Pornchalit Assavacheep, Thanasak Boonserm, Nataya Charoenvisal, Kwankate Kanistanon Physiology: Chollada Buranakarl, Kris Angkanaporn, Suwanakiet Sawangkoon, Sutthasinee Poonyachoti, Sumpun Thammacharoen, Yukie Ueyama, Sarinee Kalandakanond-Thongsong, Anusak kijtawornrat, Kittipong Tachampa, Prapawadee Pirintr, Soontaree Petchdee, Saikaew Sutayatram Theriogenology: Roy Kirkwood, Nicoline Soede, Rangsan Parnpai, Suneerat Aiumlamai, Wichai Tantasuparuk, Sudson Sirivaidyapong, Kaywalee Chatdarong, Siriwat Suadsong, Sudsaijai Kornmatitsuk, Kulnasan Saikhun, Kampon Kaeoket, Padet Tummaruk, Suppawiwat Ponglowhapan, Nawapen Phutikanit, Theerawat Tharasanit, Theerawat Swangchan-Uthai, Anucha Sathanawongs, Morakot Nuntapaitoon, Nutthee Am-In, Kakanang Buranaamnuay, Sroisuda Chotimanukul, Nitira Anakkul, Chanyuth Tretipskul, Panida Chanapiwat, Panisara Kunkitti, Sarawanee Khunmanee, Saritvich Panyaboriban Veterinary Anatomy: Weerapong Koykul, Wuthichai Klomkleaw, Kriengyot Sajjarengpong, Paisan Tienthai, Damri Darawiroj, Sayamon Srisuwatanasagul, Pawana Chuesiri, Peerapol Sukon Veterinary Microbiology: Sanipa Suradhat, Nuvee Prapasarakul, Naraid Suanyuk, Kannika Na Lampang, Nitaya Indrawattana, Nuanjan Paraksa, Patamabhorn Amavisit, Sarawut Kumphune, Sunpetch Angkititrakul, Pattrarat Chanchaithong, Teerawut Nedumpun Veterinary Parasitology: Padet Siriyasatien, Piyanan Taweethavonsawat, Sontaya Tiewsirisup, Morakot Kaewthamasorn, Woraporn Sukhumavasi, Tanasak Changbunjong Veterinary Pathology: Achariya Sailasuta, Roongroje Thanawongnuwech, Anudep Rungsipipat, Wijit Banlunara, Rachod Tantilertcharoen, Somporn Techangamsuwan, Theerayuth Kaewamatawong, Atigan Thongtharb, Patharakrit Teewasutrakul, Sawang Kesdangsakonwut, Yaowalak Panyasing, Kasem Rattanapinyopituk Veterinary Pharmacology: Kazuyoshi Taya, Amnart Poapolathep, Piyarat Chansiripornchai, Rariya Udomkusonsri, Chenphop Sawangmake, Chavalit Boonyapakorn, Sukonthar Ngampramuan, Vudhiporn Limprasutr, Gülcan Avci Veterinary Public Health: Alongkorn Amonsin, Rungtip Chuanchuen, Suphachai Nuanualsuwan, Taradon Luangtongkum, Saruda Tiwananthagorn, Nuananong Sinwat, Saharuetai Jeamsripong, Sirawit Pagdepanichkit Veterinary Surgery: Marissak Kalpravidh, Chanin Kalpravidh, Monchanok Vijarnsorn, Sumit Durongphongtorn, Preenun Jitasombuti, Naruepon Kampa, Cholawat Pacharinsak, Kumpanart Soontornvipart, Nalinee Tantivanich, Korakot Nganvongpanit, Pasakorn Brikshavana, Chalika Wangdee, Nan Choisunirachon, Panrawee Phoomvuthisarn, Krishaporn Kradangnag, Nicole Sirisophit Mehl, Krittee Dejyong, Orapun Jaturakan, Sirinun Pisamai Veterinary Virology: Kanisak Oraveerakul, Thaweesak Songserm, Porntippa Lekcharoensuk, Pravina Kitikoon, Dunruethai Sreta, Aunyaratana Thontiravong, Nawapon Techakriengkrai

The Thai Journal of Veterinary Medicine Vol. 49 No. 3 September 2019 Contents Original Article 203 209 Prevalence of canine parvovirus and rotavirus with diarrhea in Western Taiwan 217 Chiu-Huang Ting, Chia-Ying Lin, Hung-Yi Wu, Yueh-Fang Lee, Ching-Dong Chang, Shyh-Shyan Liu 227 Validation of commercially available EIA kit for measurement of feline plasma kisspeptin Prattana Tanyapanyachon, Junpen Suwimonteerabutr, Olga Amelkina, Kaywalee Chatdarong 235 243 Development of business models for indigenous genetic improvement in small ruminant farms through 249 reproductive biotechnology 257 265 Sarawanee Khunmanee, Theerawat Swangchan-Uthai, Junpen Suwimonteerabutr, Pintira Thiangthientham, Sanya Supappornchai, Mongkol Techakumphu 273 Investigation of Extended-Spectrum Beta-Lactamase (ESBL)-producing Escherichia coli and antimicrobial resistance in dogs with periodontal disease 283 Jirapa Thepmanee, Jutamart Rodroo, Nattakarn Awaiwanont, Montira Intanon, Kannika Na Lampang, Niyada Thitaram, Kriangkrai Thongkorn Gene expression profiling of NGF, BDNF, NT-3 and TrkB receptor in the development of prehierarchical follicles of Zi Geese (Anser cygnoides) Cornelius Tlotliso Sello, Chang Liu, Yujian Sui, Hui Yang, Ziqiu Wang, Hongtao Lu, Jingtao Hu, Yongfeng Sun Screening antimicrobial properties against mastitis pathogens of turmeric extract after combination with various antiseptics Wasana Chaisri, Noppason Pangprasit, Anyaphat Srithanasuwan, Montira Intanon, Witaya Suriyasathaporn Comparison of different methods for sperm vitality assessment in frozen-thawed Holstein bull semen Kakanang Buranaamnuay A feasibility of ultrasonographic assessment for femoral trochlear depth and articular cartilage thickness in canine cadavers Phuangporn Boonchaikitanan, Nan Choisunirachon, Kumpanart Soontornvipart Effect of oxidized soybean oil on the immune response to porcine reproductive and respiratory syndrome modified live virus vaccine in nursery pigs Alongkot Boonsoongnern, Pichai Jirawattanapong, Win Surachetpong, Prapassorn Boonsoongnern, Pariwat Poolperm The use of B-scan coupling with A-scan ultrasonography to characterize ocular biometry in canine absolute glaucoma Napasorn Ngamrojanavanit, Natthaporn Tanthasathien, Nirachon Srisamai, Suchaya Taotongnuntasin, Panrawee Phoomvuthisarn, Nalinee Tuntivanich The expression of serum lactate dehydrogenase in canine oral tumors Nan Choisunirachon, Urapa Klansnoh, Panrawee Phoomvuthisarn, Sirinun Pisamai, Chutimon Thanaboonnipat, Anudep Rungsipipat Short Communication 289 Detection of rabies virus specific antibody in stray dogs in Palestine Adnan Fayyad, Nasr Jalboush, Ibrahim Alzuheir, Belal Abu Helal, Mohammad Manasrah Case Report 295 301 Severe parasitic gastroenteritis (PGE) in a goat: A veterinary case report and way forward 309 Faez Firdaus Abdullah Jesse, Asinamai Athliamai Bitrus, Eric Lim Teik Chung, Innocent Damudu Peter, Mohd Azmi Mohd Lila, Annas Salleh Rare form of gastrointestinal intussusceptions: Report of two challenging canine cases Nithida Boonwittaya, Piyathida Ardaum, Sunee Kunakornsawat, Kannika Siripattarapravat, Veerada Wachirodom Pulmonary squamous cell carcinoma in a captive clouded leopard (Neofelis nebulosa) Kittikorn Boonsri, Koravee Pothichai, Thewarach Vechmanus, Pinich Boonthong, Kidsadagon Pringproa



INSTRUCTIONS TO AUTHORS and no published material may be reproduced or published elsewhere without written consent from the The Thai Journal of Veterinary Medicine (TJVM) Journal. If excerpts from other copyrighted works are publishes articles reporting interdisciplinary included, the Author(s) must obtain written permission investigations concerning veterinary and animal from the copyright owners and credit the source(s) in sciences, at all levels of resolution, from basic to clinical, the manuscript. The Journal will not be responsible for molecular to behavioral, and opinions that are of the loss of manuscripts at any time. All statements in general interest to the broad community of published manuscripts are the responsibility of the veterinarians and biological scientists. Clinical Authors, who will assist the editors by reviewing proofs investigations, protocols and reviews will also be before publication. considered for publication if they provide significant insight into the structure or function, the SUBMISSION PROCEDURE pathophysiology of a disease, or its treatment. Authors are requested to submit their manuscripts In the Journal’s Table of Contents, published articles in English in a concise and understandable style. will be shown under one of the appropriate Section Technical jargon or “laboratory slang” should not be titles listed below used. Please note that the electronic files supplied will always be used to produce the illustrations, including SECTIONS those for the print version of the article; it is the Authors’ responsibility to ensure that the manuscript is written in Editorials A limited amount of space will be available a style that is grammatically correct and free of spelling for comments about important scientific points or or other typographical errors and that these files are of subjects of topical interest and will be by invitation suitable quality. All manuscripts must be typewritten only. using Times New Roman font at 12 point, with double- spacing throughout and with margins at least 2.5 cm Reviews The article can be submitted either by wide. Pages should be numbered in succession, the title invitation or submission. The latter will be reviewed by page being number 1 and all lines should be numbered experts in the same manner as other submitted consecutively in the left margin. Text files should be manuscripts. supplied in Microsoft Word formats. Original Articles The manuscript should be novel Each manuscript should be accompanied by a research findings and provide strong evidence for the signed cover letter in which the corresponding Author conclusions. The manuscripts suitable for publication in states: “The work described has not been submitted TJVM should be of extreme importance to scientists in elsewhere for publication, in whole or in part”. All the field as well as interesting to researchers in other submissions to TJVM must contain experiments that disciplines. conform to the ethical standards issued by the National Research Council. If the studies deal with Short Communications These are short manuscript animal experiments, the authors certify in the that describe outstanding new discoveries. The decision Materials and Methods section, that the procedures will be based on whether the paper reports particularly have been approved by the Authors’ Institution’s important findings that have a high impact in the field Ethic Committee, and care was taken to minimize the of work. number of animals used. If the ethical standard governing the reported research is different from those Case Reports These are short reports of original clinical guidelines indicated above, the authors must provide or pathological findings whose importance mean that information in the submission cover letter about which they will be of interest to veterinarians. guidelines and oversight procedures were followed. SUBMISSION POLICY Authors should only use abbreviations sparingly and should always define the abbreviation when first Submission of a paper to TJVM is understood to used in the text by placing it in parentheses after the full imply that it deals with original material not previously term. The abbreviations should then be used published and that it is not being considered for consistently thereafter and appear at least twice in the publication elsewhere. Please write your text in good text. Drug names should be the official or approved English (American or British usage is accepted, but not names; trade names or common names may be given a mixture of these). The manuscript must be approved where the drug is first mentioned. Trade names should by a native English speaker before submission. The be capitalized, and the manufacturer’s name and layout and style should adhere strictly to the country given in parenthesis thereafter. The doses of the instructions given under “Organization of the Article”. drugs should be given as unit weight/unit body weight, No revisions or updates will be incorporated after the e.g. mmol/kg or mg/kg. Symbols for physical units article has been accepted and sent to the Publisher should be restricted to the Systems International (S.I.) (unless approved by the Editorial Board). The Editorial Units. Units and abbreviations should conform to the Board reserves the right to reject any manuscript following examples: M, mM, μM, N, %, m, cm, mm, μm, deemed unsuitable for publication in TJVM. nm, pm, cm2, l, ml, kg, g, mg, μg, ng, pg, h, min, sec, msec, rpm, Hz, ppm, °C, J, KJ and lux. Upon acceptance, a letter will be sent to the corresponding Author confirming receipt of the Where possible, Authors should also include a manuscript. Accepted manuscripts become the list of three or more potential reviewers for their property of TJVM. The Journal reserves the copyright, manuscript, with contact information.

ORGANIZATION OF THE ARTICLE followed by several information presentation sections and end with a conclusion section. Section headings The manuscript should have a uniform style and be should be used to organize the presentation of submitted exactly as the author wishes it to appear in information. print. It should consist of subdivisions in the following sequence. Acknowledgements. It is the corresponding Author’s responsibility to ensure that individuals who are 1) Title page acknowledged for assistance or for providing 2) Abstract comments on the manuscript are agreeable to be 3) Text acknowledged in this way. 4) Acknowledgments 5) References References 6) Tables 7) Figures legends (a) In the text, references should be quoted as the name 8) Figures of the first author and year in chronological order. Start each subdivision on a new page. Multiple authors are indicated by “et al.,” except when there are only two authors, in which case both names Title Page The first page of the manuscript should are written. include Title of paper, Full name of author(s), Institutional affiliations and complete mailing address, Examples number of pages and number of figures and tables. E- mail address of the corresponding author should be …(Garthwaite and Garthwaite, 1995; Morris et al., presented. 2000). …by Nagy et al. (1999a,b). Clarkson et al. (2004) stated…… Abstract The manuscript should contain an abstract of around 250 words. The abstract must be written in (b) The reference list should be on a separate page at the complete sentences and succinctly state the objectives, end of the manuscript, in alphabetical order and experimental design of the paper, principal arranged as follows: authors’ names and initials, year, observations, and conclusions; it should be intelligible title of the article, abbreviated title of the journal, without reference to the rest of the paper. volume, first and last page numbers. Keywords Four to six key words should be included. Examples Text Article Nagy ZA, Esiri MM and Cato A-M 1999a. Cell cycle Original articles: The text should be presented in the markers in the hippocampus in Alzheimer’s disease. following order Acta Neuropath. 94: 6-15. Herpin P, Le Dividich J, Hulin JC, Fillaut M, De Marco i.) Introduction This should provide the scientific F and Bertin R 1996. Effect of the level of asphyxia rationale for the research that is reported. No results during delivery on viability at birth and early postnatal should be presented. vitality of newborn pigs. J Anim Sci. 74: 2067-2075. ii.) Materials and Methods Procedures used in the Chapter in a book research should be described in sufficient detail to Mize RR 1994. Conservation of……visual system. In: permit the replication of the work by others. Previously Neuroscience. From the Molecular to the Cognitive. published procedures should be referenced and briefly Progress in Brain Research. 3rd ed. FE Bloom (ed). summarized. The source of all materials, including Amsterdam: Elsevier. 123-132. animals and human tissue, must be provided. An entire book iii.) Results This section presents findings without Sodikoff CH 1995. Laboratory Profiles of Small Animal discussion of their significance. Subsections should be Diseases. A Guide to Laboratory Diagnosis. 2nd ed. St. used in order to present results in an organized fashion. Louis: Mosby. 178 pp. The findings may be assisted by high quality illustrations, as necessary, to adequately document the Electronic information work. Figures should be referred to in the text as Fig. 1, Dumble LJ 1996. “The third world and infertile Figs. 1, 3-4, etc., and tables as Table 1, Tables 1, 3-4, etc. women.” [Online]. Available: http://www.maff.gov. Probability format style should be used as “P < 0.05”. uk. Accessed July 12, 1997. iv.) Discussion This section presents the Authors’ (c) A paper which has been accepted for publication but interpretations of their findings and an assessment of has not yet appeared may be cited in the reference list their significance in relation to previous work. with the abbreviated name of the journal followed by Repetition of material presented in the Results section the words “in press”. should be avoided. (d) Unpublished data may be mentioned only in the Short Communication and Case Reports: These should text, not in the References. Initials, as well as surnames, not exceed 4 pages (approximately 2,000 words in total, including spaces). Follow the instructions for Original Articles with the exception that Results and Discussion are combined. Reviews: Reviews should have an introductory section,

must be given for authors whose unpublished experiments are quoted: (ML King, unpublished observations) Tables or figures These should be included on separate pages placed at the end of the manuscript. Their desired approximate locations should be indicated in the text. Each figure must be accompanied by an explanatory legend in a separate section entitled Figure Legends. In general, tables and figures should be constructed so that they, together with their captions and legends, will be intelligible with minimal reference to the main text. Table and figure legends should be written as in the following examples. Figure 1 Typical lesions of... Table 1 Statistical analysis showing.... All graphic files must be submitted, as JPEG in sufficiently high resolution (300 dpi for grayscale or color images and 600-1000 dpi for line art) to allow for printing. Keep text and graphics (and any other items) as separate files. Name your files using the correct extension, e.g. Text.doc, Fig1.jpg, etc. Publication fee After the paper is accepted, the authors will be required to pay a publication fee for 5,000 THB or 150 USD.



Original Article Prevalence of canine parvovirus and rotavirus with diarrhea in Western Taiwan Chiu-Huang Ting1* Chia-Ying Lin2 Hung-Yi Wu1* Yueh-Fang Lee1 Ching-Dong Chang1 Shyh-Shyan Liu1 Abstract In this study, we investigated the prevalence of Diarrhea pathogens in pet dogs referred to as Canine Parvovirus (CPV) and Canine Rotavirus (CRV) in western Taiwan using conventional polymerase chain reaction (PCR). Fecal samples were collected from 240 dogs which have the symptoms of diarrhea examined by the veterinary hospitals from March 2015 to March 2017. The PCR sensitivity of total DNAs extracted from 0.1g fecal samples ranged from 10 ng to 100 ng. The prevalence of CPV and CRV infections were 23.3% (56/240) and 9.2% (22/240) respectively. The related analysis between prevalence rates and the epidemiological data of pet dogs were correlated with the age, season, area, vaccination and breed. The results showed that both the diseases have the highest occurrence in winter and spring, and the highest proportions might occur in puppies, suburbs and mixed-breed dogs. Non- vaccination dogs were the most prone to Canine Parvovirus Enteritis. When dog puppies were infected with CPV, the mortality rate was high. Since Canine Rotavirus is a zoonosis, the more human being is exposed to it, the higher its occurrence will be. This study has provided the clinical veterinarian the advanced ability of both the diseases diagnosis and crucial information for prevention and control of Canine Parvovirus and Rotavirus diseases in Taiwan and neighborhood countries. Keywords: Canine, Parvovirus, PCR, Rotavirus, Taiwan 1Department of Veterinary Medicine, National Pingtung University of Science and Technology , Pingtung. No 1, Shuefu Road, Neipu, Pingtung, 91201 Taiwan. 2Managing Director of Da Dian Biotechnology Company Limited *Correspondence: [email protected] and [email protected] (C.Ting and H. Wu) Thai J Vet Med. 2019. 49(3): 203-208.

204 Ting C. et al. / Thai J Vet Med. 2019. 49(3): 203-208. Introduction diarrheal disease (Bishop RF et al., 1973; Bishop R , 2009; Kirkwood CD, 2017), is confirmed that it will also Canine parvovirus (CPV) is an emerging DNA cause domestic diarrhea later, and found that many virus that was first observed to cause disease in canines species of animals infected with CRV. G3P[3] and in 1978 and has since become an ubiquitous pathogen G3P[9] strains have been detected sporadically in worldwide. Canine Parvovirus-2 (CPV-2) can infect all- humans (Matthijnssens J et al., 2011; Wang YH ,2013) aged dogs. Its two strains of CPV-2 and CPV-2b were and most of the disease is acute gastroenteritis. HCoV separated in 1979 and 1984 respectively (Sokolow SH 229E and OC43 are the causes of the common cold et al., 2005). Two distinct parvoviruses are now known which are now globally endemic in humans to infect dogs—the pathogenic CPV-2 and CPV-1. ( J.S.M. Peiris, 2012). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most In 1996, a CRV case of acute gastroenteritis found important pathogenic viruses with high morbidity in an Italian child was suspected of being infected by (100%) and frequent mortality up to 10% in adult dogs rotavirus (Grazia SD et al., 2007). Because CRV is an and 91% in pups (S. Nandi et al.,2010; Miranda C, 2016; epidemic and could scatter suddenly and widespread Kim HH, 2018; Kilian E, 2018). The disease condition rapidly, dogs can be infected at all ages. The virus is has been complicated further due to emergence of a spread by the faecal-oral route but airborne or droplet number of variants named CPV-2a, CPV-2b and CPV- transmission has also been postulated. The virus is so 2c over the years and involvement of domestic and infectious that even cured vitality and strong infectious wild canines (S. Nandi et al., 2010). CPV-2c (Glu426 and cured animals can continue to excrete virus for 3 variant) was found in Italy, Vietnam and Spain (Decaro weeks. The pollution of the feeding environment and N et al., 2006). Among those viruses, the sensitivity of water sources are likely to cause a cluster infection the breeds to the parvovirus is higher, such as even the virus caused by a relatively low mortality Norwegian Nasal, Black Labrador, Doberman pinscher (Ogilvie I et al., 2012). and American Pit Bull Terrier, and the condition is more serious after infection. Most CPV infections are CPV-2 has been incriminated as primary caused by the mixture of the two strains but the pathogens. CPV-1 and canine rotaviruses (CRV) can original strains. The virus is not the same virus produce mild to inapparent illness in young pups (less originally found, but the general test could not tell the than 8 weeks old), and their clinical significance is origin from others (Martella V et al., 2005). CRV is a considered low ( Jane E. et al., 2016). To provide the zoonotic disease. The first case of CRV found in young knowledge of prevention and control, we would like to children, which is a kind of common infectious use this survey to understand the prevalence of these two diseases in Taiwan in recent years. Figure 1 . A: Sampling regions (New Taipei, Zhanghua, Yunlin, Tainan) at Western Taiwan. B: Regional map of Taiwan (From the website of Ministry of Foreign Affairs of Taiwan). Materials and Methods effect of canine vaccine and dog species.The epidemiology of both canine parvovirus 2 (CPV2) and Experiment Design: The study is planned for two years Canine coronavirus (CCoV) canine viral enteritis were (spring, summer, autumn, winter two rounds) from investigated by molecular biology polymerase chain March 2015 to March 2017, screened by animal reaction (PCR) in combination with clinical diagnosis. hospitals in western Taiwan, to investigate 240 cases Samples: This study included 240 diarrhea dogs from (one fecal sample by each dog) of suspected viral animal hospitals of western Taiwan, including New enteritis as a statistic to understand the main cause of Taipei, Zhanghua, Yunlin and Tainan (Fig 1). Dogs viral enteritis and its infection relation with season, from 10 hospitals (New Taipei 3 hospitals, Zhanghua age, suburbs and urban areas, immune-protective 2, Yunlin 2 and Tainan 3) are picked, with 24 dogs per

Ting C. et al. / Thai J Vet Med. 2019. 49(2): 203-208. 205 hospital. Fecal samples were collected directly upon were respectively 0.4 μM, 5U Taq DNA Polymerase, 20 defecation. To prevent contamination, 5–10 g of faeces U RNase inhibitor and Buffer solution. PCR reaction was collected with a spoon and stored in a sterile program protocol was as follows: CPV, step 1: pre- plastic sampling tube. The samples were kept denaturation at 94°C for 1 min; step 2: 94°C for 15 sec refrigerated and processed in the laboratory within (denaturation), 52°C for 30 sec (annealing); Step 3: 24 hr after collection. extension at 72°C for 2 min, performed for 40 cycles; step 4: Final extension at 68°C for 7 min. Rotavirus , Polymerase chain reaction assay: RNA and DNA was step 1: pre-denaturation at 94°C for 1 min; step 2: 94°C extracted from fecal using Corning Axygen AP-MN- for 15 sec (denaturation), 52°C for 30 sec (annealing) ; BF-VNA-250 AxyPrep TM Body Fluid Viral DNA & Step 3: extension at 72°C for 1 min, performed for 40 RNA Purification Miniprep Kit (BIOKIT, Miaoli cycles ; step 4: Final extension PCR temperature was County, Taiwan). CPV uses the primer pair: 5’- 72°C for 7 min. The process was repeated three times. GAAGAGTGGTTGTAAATAATA-3’, 5’-CCTATATC (Varaporn Korchunjit et al., 2014.) The primer ACCAAAGTTAGTAG-3’. In the case of rotavirus, RT- sequences were designed and used in previous PCR was performed for each of the samples, using the M-MLV Reverse Transcriptase Rnase H-Kit (Bioman, publications (Pletcher JM et al.,1979；Wang HC et al., USA.), and the specific primer was used for reverse transcription of RNA and polymerase chain reaction 2005). Table1. The electrophoresis of amplicons was using the primer pair: 5’-TTGCCACCAATTCAAAAT achieved in a 1.5% agarose gel (stained with 0.5 AC-3’ and 5’-ATTTCGGACCATTTATAACC-3’ (Table mg/mL ethidium bromide) and visualized in a MS 1). Conventional PCR was performed using 0.625 mM UVCI Image Capture visualized transilluminator dNTPs, and the specific primers (Forward, Reverse) (Major Science, USA). Table 1 Sequences of PCR primers Pathogens Oligonucleotide sequence (5’-3’) Expected size (bp) CPV-2 416 5’-GAAGAGTGGTTGTAAATAATA-3’ 234 Rotavirus 5’-CCTATATCACCAAAGTTAGTAG-3’ 5’-TTG CCA CCA ATT CAA AAT AC-3’ 5’-ATT TCG GAC CAT TTA TAA CC-3’ Viral PCR susceptibility test: DNA extracted from be detected by the primer as 10-3ng (Fig 2A). Canine canine parvovirus (CPV) infection detected by PCR rotavirus (CRV) infected with the DNA of the detection increases with a primer (Table 1), which shows that the of the target gene 234 bp. The minimum amount of minimum DNA amount of the target gene 416 bp can DNA is 10-1 ng (Fig 2B). Figure 2 PCR susceptibility test target gene. A. Canine Parvovirus B. Canine Rotavirus Results month~1yr 13.3% (8/60), 1~6yrs 6.7% (4/60), 6~11yrs 6.7% (4/60), 11~16yrs 10% (6/60). The prevalence of Total prevalence rate: Fecal samples were collected CPV was higher than that of CRV. Age is not a factor from 240 dogs in different age, season, area, in the prevalence of CRV, while CPV showed vaccination and breed. Prevalence of CPV and CRV are significant difference in puppy of different ages. 23.3% (56/240), 9.2% (22/240) respectively (Table 2). There is 1.67% (4/240) co-infection with both rotavirus Proportion of positive detection samples of all ages: and parvovirus in this study, which occurs to 4 non- CPV positive, prevalence is differentiated by age: 1 vaccination mixed-breed puppies in spring in suburbs. month to 1yr 64% (36/56), 1yr~6yrs 22% (12/56), 6yrs~11yrs 7% (4/56), 11yrs~16yrs 7% (4/56), showing Age distribution: Fecal samples were collected that the puppy accounts for higher proportion of from 240 dogs , 60 dogs per age group. CPV: 1 canine parvovirus. In CRV positive, prevalence is month~1yr 60% (36/60), 1yr~6yrs 20% (12/60), differentiated by age, 1 month to 1yr 37% (8/22), 6~11yrs 6.7% (4/60), 11yrs-16 yrs 10% (6/60). CRV: 1 1yr~6yrs 18% (4/22), 6yrs~11yrs 18% (4/22), 11~16yrs

206 Ting C. et al. / Thai J Vet Med. 2019. 49(3): 203-208. 27% (6/22), and the percentage of pups infect CRV was prevalent puppies. In puppies, CPV is also higher than higher. In all age groups, CPV and CRV were the most CRV. Table 2 Enteritis prevalence rate caused by canine parvovirus and rotavirus in pet dogs. Items Kind of virus Various prevalence rates Total Parvovirus Rotavirus 23.3%(56/240) - - - - Age Parvovirus 9.2%(22/240) - - 1 month~1yr - - 11-16 yrs - Rotavirus 60% (36/60) 10% (6/60) 1~ 6yrs 6~11yrs - Parvovirus* 1 month~1yr 20% (12/60) 6.7% (4/60) 11~16yrs 13.3% (8/60) 10% (6/60) - 1~6yrs 6~ 11yrs 1 month~1yr 6.7% (4/60) 6.7% (4/60) 11~16yrs 64% (36/56) 7% (4/56) 1~6yrs 6~11yrs 22% (12/56) 7% (4/56) Season Rotavirus* 1 month~1yr 1~6yrs 6~11yrs 11~16yrs - Area 37% (8/22) 18% (4/22) 18% (4/22) 27% (6/22) Parvovirus - Spring Summer Autumn Winter Rotavirus 50% (30/60) 10% (6/60) 3.3% (2/60) 30% (18/60) - Parvovirus* - Rotavirus* Spring Summer Autumn Winter - Parvovirus 10% (6/60) 3.3% (2/60) 3.3% (2/60) 20% (12/60) - Rotavirus - Parvovirus* Spring Summer Autumn Winter - Rotavirus* 54% (30/56) 11% (6/56) 3% (2/56) 32% (18/56) - Autumn - Spring Summer 9% (2/22) Winter 27% (6/22) 7% (2/22) 55% (12/22) - Suburbs Urban - 41.7% (40/96) 11.1% (16/144) - - Suburbs Urban - 14.6% (14/96) 5.6% (8/144) - - Suburbs Urban - 71% (40/56) 29% (16/56) - - Suburbs Urban - Vaccination Parvovirus 64% (14/22) 36% (8/22) Vaccination - 3.8% (6/156) - -- - Parvovirus Non-vaccination - Maltese -- 59.5% (50/84) 11.1% (4/36) Breed Rotavirus - Maltese - - Parvovirus* Mixed 5.6% (2/36) 65% (36/56) - Pomeranian Other Rotavirus* 9.1% (2/22) 11.1% (2/18) *Proportion of positive samples. Mixed Poodle Pomeranian 55% (12/22) 21.4% (12/56) 9.1% (2/22) Other 11.1% (2/18) Mixed Poodle 33.3% (36/108) 7.1% (4/56) Mixed 11.1% (12/108) Season distribution: In 240 dogs sample, 60 dogs per Proportion of positive detection samples of all season: season group, the prevalence of CPV is as follows, In CPV positive, prevalence was differentiated by February-April (Spring) 50% (30/60), May-July season. February-April (Spring) is 54% (30/56), May- (Summer) 10% (6/60), August-October (Autumn) 3.3% July (Summer) 11% (6/56), August-October (Autumn) (2/60), November-January (Winter) 7.5% 30% (18/60), 3% (2/56), November-January (Winter) 32% (18/56), It showing CPV is most prevalent in February-April shows the prevalence in 2-4 months (spring) is the (Spring). Prevalence of CRV in February-April (Spring) highest. In CRV positive, prevalence was differentiated is 10% (6/60), May-July (Summer) 3.3% (2/60), by season. February-April (Spring) is 27% (6/22), May- August-October (Autumn) 3.3% (2/60), November- July (Summer) 9% (2/22), August-October (Autumn) January (Winter) 20% (12/60). Prevalence of CRV 9% (2/22), November-January (Winter) 55% (12/22). It showed the highest in November ~ January (Winter). shows prevalence in November-January (Winter) is CRV and CPV enteritis both in the spring and winter highest. two-quarter is higher, CRV is higher in winter than in the spring, CPV enteritis is higher in spring than in Area distribution: In 240 dogs (96 in the suburbs, 144 winter. in the urban area), CRV and CPV are detected in suburban and urban areas, with prevalence of CPV in the suburbs equal to 41.7% (40/96, higher), the urban

Ting C. et al. / Thai J Vet Med. 2019. 49(2): 203-208. 207 area 11.1% (16/144). CRV is 14.6% (14/96) higher in the In this study, that prevalence of CRV is shown to be suburbs and 5.6%(8/144) in urban area., CRV and CPV the highest in the winter or spring season. However, enteritis are the most in the suburbs. Prevalence of CPV the climate in southern Taiwan is similar to that of is 71% (40/56) in the suburbs and 29% (16/56) in urban tropic area and exists lower prevalence. CPV does not area. In CRV positive, prevalence is 64% (14/22) in the have a specific seasonal prevalence, it causes CRV suburbs and 36% (8/22) in urban area. enteritis to be neglected easily because it will be diagnosed as indigestion or bacterial infection if the The difference of vaccination or non-vaccination: The sick dog exists diarrhea symptoms, canine parvovirus, efficacy of the vaccine is observed, since the prevalence canine distemper, coronavirus disease, or coccidiosis of 156 dogs with normal canine parvovirus vaccine is will be excluded in general situation which should be 3.8% (6/156) , and 59.5% (50/84) of the dogs with no associated with the immune decline because of the vaccine canine parvovirus is more prone to the disease, stress of cold or temperature changes of animals. showing the effectiveness of vaccine protection. Infection virus can be detected from some dogs feces only after a period of recovery, and it becomes an Breed distribution: Among the two kinds of virus important recessive source of infection (Hoang M, positive, prevalence was differentiated by dog species, 2019; Schoeman JP, 2013 ; Truyen U, 2006). Prevalence of CPV : mixed-breed is 33.3% (36/108 higher), poodle 21.4% (12/56), Maltese 11.1% (4/36), In this study, it shows that CRV exists mostly in the Pomeranian 9.1% (2/22), and others accounted for suburbs dogs and the mixed-breed ones which have 11.1% (2/18). Prevalence of CRV, mixed-breed is 11.1% not been mentioned in the previous studies. This study (/12/108), poodle 7.1% (4/56), Maltese accounted 5.6% makes us know that the results are caused by the poor (2/36), and the other is 9.1% (2/22). Prevalence of CRV raised environment and mostly mixed-breed does in and CPV enteritis are higher in mixed breeds. In each suburban areas. Unfortunately, another dog will be dog species, the prevalence of CPV in mixed breeds of infected after drinking the contaminated water once a dogs accounted for 65% (36/56). Prevalence of CRV is dog is infected with CRV, and the virus is discharged higher in mixed breed 55% (12/22). through the fecal and thus pollutes the environment and drinking water, and will combine with the Conclusion: CPV and CRV enteritis were the highest bacterial enteritis easily to produce diarrhea symptoms among puppies, but age is not so much a factor in the severely as sent to the Vet., and taken samples. case of CRV. Both CPV and CRV have the highest Therefore, this study finds that the mixed dogs in the prevalence in spring and winter, among which the suburbs account for higher prevalence of CRV. CRV was higher in winter than in spring, and the prevalence of CPV was higher in spring than in winter. There is 1.67% (4/240) co-infection with both Both CRV and CPV have the highest in the suburbs, rotavirus and parvovirus in this study, which occurs to with both CRV and CPV having the highest rates of 4 non-vaccination mixed-breed puppies in spring in mixed breeds. Among CPV prevalence, no vaccination suburbs. Then, the first report on circulating canine is higher than the vaccination. rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed using polymerase chain Discussion reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, In this study, experimental data show respectively; 7% of dogs were infected with rotavirus the majority of infectious canine enteritis was still exclusively, while 14% were co-infected with both occurring in puppies, which has been mentioned in the rotavirus and parvovirus; clinical signs in co-infected previous studies. Unvaccinated dogs of all ages and dogs were more severe.(Ariadna Flores Ortega, 2017). breeds are susceptible to infection. These may be due to the decline of maternal antibodies and the infection Acknowledgements of susceptible adult dogs which were not vaccinated are at risk of contracting the virus. Likely only a few Special thanks are given to Dr. Hung-Yi Wu and CPV enteritis cases are caused when a puppy vaccine- Yueh-Fang Lee for outstanding technical support. induced antibody titer is insufficient or an adult canine which vaccine antibody titer decline in the case of References infection, but most are still protected by vaccination. Ariadna Flores Ortega, José Simón Martínez- Purebred dog breeds should be more likely to suffer from CPV than other dog breeds, especially the Castañeda, Linda G. Bautista-Gómez, Raúl Fajardo Rottweiler, Black Labrador, Doberman Pinscher, American Pit Bull Terrier. (Decaro N et al., 2012; Muñoz,and Israel Quijano Hernández Meggiolaro MN, 2017). What is mentioned above is different from our results : CPV and CRV enteritis both 2017.Identification of co-infection by rotavirus and occurred in mixed breeds dogs. The results may be caused by the fact that most of the mixed breeds in the parvovirus in dogs with gastroenteritis in Mexico. case have not been vaccinated or have not been vaccinated on time. Most of these mixed breeds are fed Braz J Microbiol. 48(4): 769–773. by the suburbs host, so the results of study clarified that the highest prevalence of canine parvoviral Bishop RF, Davidson GP, Holmes IH, Ruck BJ enteritis in suburbs. 1973.Virus particles in epithelial cells of duodenal mucosa from children with acute non-bacterial gastroenteritis. Lancet. 2:1281–3. Bishop R, 2009.Discovery of rotavirus: Implications for child health. J Gastroenterol Hepatol.24 Suppl 3:S81-5. Decaro N, and Buonavoglia C 2012.Canine parvovirus- -a review of epidemiological and diagnostic

208 Ting C. et al. / Thai J Vet Med. 2019. 49(3): 203-208. aspects, with emphasis on type 2c. Vet Miranda C, Thompson G 2016.Canine parvovirus: the worldwide occurrence of antigenic variants. J Gen Microbiol.155:1-12. Virol. 97(9):2043-57. Decaro N, Cirone F, Desario C, Elia G, Lorusso E, Ogilvie I, Khoury H, Goetghebeur MM, El Khoury AC, Giaquinto C 2012. Burden of community- Colaianni ML, Martella V, and Buonavoglia C acquired and nosocomial rotavirus gastroenteritis in the pediatric population of Western Europe: a 2009.Severe parvovirus in a 12-year-old dog that scoping review. BMC Infect Dis.12:62. had been repeatedly vaccinated. Vet Rec. 164: 593- S. Nandi and Manoj Kumar 2010.Canine Parvovirus: Current Perspective. Indian J Virol.21(1): 31–44. 595. Schoeman JP, Goddard A, Leisewitz AL Decaro N, Desario C, Elia G, Martella V, Mari V, 2013.Biomarkers in canine parvovirus enteritis.NZ Vet J. 61(4):217-22. Lavazza A, Nardi M, and Buonavoglia C 2008. Shackelton LA, Parrish CR, Truyen U, and Holmes EC Evidence for immunization failure in vaccinated 2005. High rate of viral evolution associated with the emergence of carnivore parvovirus. Proc Natl adult dogs infected with canine parvovirus type 2c. Acad Sci U S A. 102(2): 379–384. New Microbiol.31:125-130. Sokolow SH, Rand C, Marks SL, Drazenovich NL, Kather EJ, and Foley JE 2005. Epidemiologic Decaro N, Martella V, Desario C, Bellacicco AL, evaluation of diarrhea in dogs in an animal shelter. Am J Vet Res. 66: 1018-1024. Camero M, Manna L, d'Aloja D, and Buonavoglia Truyen U 2006.Evolution of canine parvovirus. Vet C 2006.First detection of canine parvovirus type 2c Microbiol. 117 (1):9-13. in pups with haemorrhagic enteritis in Spain. J Vet Wang HC, Chen WD, Lin SL, Chan JP, and Wong ML 2005.Phylogenetic analysis of canine parvovirus Med B Infect Dis Vet Public Health.53: 468-472. VP2 gene in Taiwan. Virus Genes.31: 171-174. Grazia SD, Martella V, Giammanco GM, Gòmara MI, Wang YH, Pang BB, Zhou X, Ghosh S, Tang WF, Peng JS, Hu Q, Zhou DJ, Kobayashi N 2013. Complex Ramirez S, Cascio A, Colomba C, and Arista S evolutionary patterns of two rare human G3P[9] rotavirus strains possessing a feline/canine-like H6 2007.Canine-origin G3P[3] rotavirus strain in child genotype on an AU-1-like genotype constellation. Infect Genet Evol. 16:103-12. with acute gastroenteritis. Emerg Infect Dis. 13(7): 1091–1093. Hoang M, Lin WH, Le VP, Nga BTT, Chiou MT, Lin CN 2019. Molecular epidemiology of canine parvovirus type 2 in Vietnam from November 2016 to February 2018. Virol J.16(1):52. Jane E. Sykes, Craig E. Greene 2016. Canine viral enteritis. In: Infectious Diseases of the Dog and Cat. 4th ed: 67-80. J.S.M. Peiris, 2012. Coronaviruses. Medical Microbiology.18th ed : 587-593. Kilian E, Suchodolski JS, Hartmann K, Mueller RS, Wess G, Unterer S 2018.Long-term effects of canine parvovirus infection in dogs. PLoS One. 13(3):e0192198. Kim HH, Yang DK, Seo BH, Cho IS 2018.Serosurvey of rabies virus, canine distemper virus, parvovirus, and influenza virus in military working dogs in Korea. J Vet Med Sci. 80(9):1424-1430. Kirkwood CD, Ma LF, Carey ME, Steele AD 2017. The rotavirus vaccine development pipeline. Vaccine. pii: S0264-410X(17)30410-3. Le Martella V, Cavalli A, Decaro N, Elia G, Desario C, Campolo M, Bozzo G, Tarsitano E, and Buonavoglia C 2005. Immunogenicity of an intranasally administered modified live canine parvovirus type 2b vaccine in pups with maternally derived antibodies. Clin Diagn Lab Immunol.12: 1243-1245. Matthijnssens J, De Grazia S, Piessens J, Heylen E, Zeller M, Giammanco GM, Bányai K, Buonavoglia C, Ciarlet M, Martella V, Van Ranst M 2011.Multiple reassortment and interspecies transmission events contribute to the diversity of feline, canine and feline/canine-like human group A rotavirus strains. Infect Genet Evol. 11(6):1396- 406. Meggiolaro MN, Ly A, Rysnik-Steck B, Silva C, Zhang J, Higgins DP, Muscatello G, Norris JM, Krockenberger M, Šlapeta J 2017. MT-PCR panel detection of canine parvovirus (CPV-2): Vaccine and wild-type CPV-2 can be difficult to differentiate in canine diagnostic fecal samples. Mol Cell Probes. 33:20-23.

Original Article Validation of commercially available EIA kit for measurement of feline plasma kisspeptin Prattana Tanyapanyachon1 Junpen Suwimonteerabutr1 Olga Amelkina2 Kaywalee Chatdarong1,3* Abstract Circulating kisspeptin is described to be related with the reproductive system. A study of plasma kisspeptin levels, thus, will provide the better understanding of reproductive endocrinology in the domestic cat. The present study aimed (i) to validate the only available commercial kisspeptin EIA kit which is currently used in humans to be used in domestic cats and (ii) to determine and compare the plasma kisspeptin levels at different reproductive stages. The intra-assay coefficient of variation (CV) was 11.13%. The inter-assay CV ranged from 5.00 – 8.25%. The parallel graphs represented the homology between human kisspeptin and feline endogenous kisspeptin. The recovery rate ranged from 78% - 106%. To compare the plasma kisspeptin levels among reproductive status, plasma samples were collected from the prepubertal female cats (n = 6) and sexually mature female cats with an inactive (n = 6) and follicular staged (n = 6). Although no statistically significant difference in the plasma kisspeptin concentration between reproductive stages was observed, there was a tendency that the plasma kisspeptin levels were higher in the prepuberal cats compared with pubertal cats. In conclusion, the commercial EIA kit can be used to determine plasma kisspeptin in the domestic cats. Keywords: ELISA, Enzyme immunoassay, feline, kisspeptin-10, Metastin, plasma 1Department of Obstetrics, Gynaecology and Reproduction, Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand 2Center for Species Survival, Smithsonian Conservation Biology Institute, National Zoological Park, Washington, District of Columbia, USA. 3Research Unit of Obstetrics and Reproduction in Animals, Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand *Correspondence: [email protected] (K. Chatdarong) Thai J Vet Med. 2019. 49(3): 209-215.

210 Tanyapanyachon P. et al. / Thai J Vet Med. 2019. 49(3): 209-215. Introduction Materials and Methods Kisspeptin has been considered to be the key Animals: The study was conducted with ethics regulator of reproductive system, mainly through approval and performed under the license of controlling the secretion of a gonadotropin-releasing Chulalongkorn University of Animal Care and Use hormone (GnRH) at the hypothalamus (Messager et al., (reference number 1831015), with care to comply with the 3R concept. 2005). In response to GnRH, the pituitary gland releases the gonadotropins which subsequently control The plasma samples were obtained from client- the gonadal functions. The mutation of kisspeptin or its owned female cats presented for ovariohysterectomy receptor results in reproductive abnormalities e.g. at the Small Animal Teaching Hospital, Faculty of delayed puberty and ovulatory failure in mice Veterinary Science, Chulalongkorn University. All (Seminara et al., 2003; Lapatto et al., 2007). In addition samples were collected from cats kept in the Bangkok area and the perimeter. Cat owners were informed to the hypothalamus, kisspeptin has also been about thr protocol and signed an agreement to allow identified in various reproduction-related tissues of the participation of the cats. As a routine pre-operative rodents: ovary (Terao et al., 2004), placenta (Terao et al., check-up, all cats received a general physical 2004; Kinsey-Jones et al., 2014), uterus (Zhang et al., examination, basic hematological test and biochemical 2014) and testis (Salehi et al., 2015). Interestingly, the analysis of their blood. fluctuation of Kiss1 expression was demonstrated in a Plasma samples from 42 cats (n = 24 for analytical cyclic-dependent manner in the rat ovary, with the validation of EIA, n = 18 for the determination of highest level during the preovulatory period plasma kisspeptin) were included. For analytical (Castellano et al., 2006). validation of EIA, the samples from female cats (≥10 months to ≤5 years, weighing 2.3 – 4.5 kg) with inactive For clinical study, growing evidence supports that (n = 12), follicular (n = 6) and luteal (n = 6) stages were kisspeptin can be used as the biological markers for used. Their ages were obtained by history taking. For diagnostics in reproductive diseases or the comparison of plasma kisspeptin levels different determination of reproductive stages. In humans, the reproductive stages, plasma samples from prepubertal concentration of plasma kisspeptin can indicate the (≥3 to ≤4 months; weighing 1.27 – 1.64 kg; n = 6), risk of polycystic ovarian syndrome (PCOS) as the sexually mature cats at the inactive stage (≥7 months to relatively high plasma kisspeptin has been observed in ≤2 years, weighing 2.1 – 2.9 kg, n = 6) and follicular patients with a PCOS compared to healthy women stage (≥7 months to ≤2 years, weighing 2.1 – 2.6 kg, n = (Chen et al., 2010). Moreover, the level of circulating 6) were investigated. kisspeptin is closely related to reproductive status in The inactive stage was determined from no both human (Latif and Rafique, 2015) and animals evidence of follicles ≥ 2 mm in diameter and no (Ricu et al., 2012; Mondal et al., 2015). In non-pregnant evidence of corpora lutea (CL) in both ovaries (Uchikura et al., 2011). The follicular stage was cattle, the highest concentration of plasma kisspeptin classified by the presence of follicles ≥ 3 mm in has been observed prior to ovulation; therefore, it is diameter in one or both ovaries with 40 – 60% assumed that kisspeptin might be used as an indicator superficial cells in vaginal cytology (Shille et al., 1979). for the pre-ovulatory period (Mondal et al., 2015). The vaginal epithelial cells were examined at a magnificationx100. The superficial cells were Interestingly, plasma kisspeptin levels are significantly determined as stated in a previous report (Kanca et al., higher in prepubertal female rats compared with 2014). The luteal stage was determined by the presence pubertal female rats; consequently, plasma kisspeptin of CL in one or both ovaries with blood progesterone concentration can be used to identify the pubertal stage ≥2 ng/ml (Shille and Stabenfeldt, 1979). Progesterone in rats (Ricu et al., 2012). Taking these studies into level was evaluated by an automated immunoassay system, Tosoh ST AIA-Pack PROG assay (Tosoh, consideration, the evaluation of plasma kisspeptin Tokyo, Japan), with an assay range of 0.1 – 40 ng/ml levels might be able to specify precise reproductive stages. Blood Collection: Blood samples were obtained prior to ovariohysterectomy. To minimize the possible Domestic cats have long been an important animal effects of circadian rhythm on kisspeptin (Kriegsfeld, model for the study of the reproductive system in 2013), the blood collection was performed between at endangered wildcats. However, the investigation of 08:00 - 11:00 a.m.. kisspeptin in domestic cats has just begun. Recently, kisspeptin was identified in the hypothalamus and Whole blood (3 ml) was collected from the cephalic reproductive tracts of the female cats vein of each cat and placed in a tube containing K3‐ (Tanyapanyachon et al., 2018; Amelkina et al., 2019). In EDTA (Greiner Bio-One GmbH, Kremsmünster, Austria). The blood was further centrifuged at 2,000 g cat ovaries, the expression of kisspeptin encoding for 20 min at 4°c to separate the plasma. The plasma mRNA, Kiss1, has been reported to be related to was then transferred to 1.5 ml polypropylene reproductive stages, with an increased of Kiss1 at eppendorf tubes and stored at -20℃ until the extraction follicular phase (Tanyapanyachon et al., 2018). Thus, it process. is worth investigating whether circulating kisspeptin Sample preparation for the measurement of kisspeptin: in the cats can be used as a useful biological marker to The plasma (1 ml) from each cat was acidified with specify the reproductive status of cats. Therefore, the present study aimed (i) to validate the commercially available kisspeptin enzyme immunoassay (EIA) kit to be used in the domestic cats and (ii) to determine and compare the plasma kisspeptin levels in the domestic cat at different reproductive stages.

Tanyapanyachon P. et al. / Thai J Vet Med. 2019. 49(3): 209-215. 211 buffer A (1 ml) (RK-BA-1, Phoenix Pharmaceuticals of the recovery was determined: (amount observed/ Inc, California, United States) and centrifuged at 6,000 amount expected)*100. The percentage of recovery was g for 20 minutes at 4℃. The solution was then loaded set between 80% – 120%. into a sep-column containing 200 mg of C-18 (RK- SEPCOL-1, Phoenix Pharmaceuticals Inc, California, Measurement of plasma kisspeptin in different United States) which had previously been equilibrated reproductive stages: The plasma obtained from by buffer B (1 ml) (RK-BB-1, Phoenix Pharmaceuticals prepubertal cats (n = 6), sexually mature cats with Inc, California, United States) once and buffer A (3 ml), inactive (n = 6) and follicular (n = 6) stages was respectively. The sep-column was washed with buffer investigated for plasma kisspeptin levels by the A (3 ml) and the solution was discarded. The sep- validated commercial EIA kit following the column was eluted by buffer B. The plasma rich eluant instructions of the manufacturer. Briefly, rich peptide was collected into a polystyrene tube (HCG-1100-TPS, solution (50 µl) from each cat was added into each well Biomed Thailand) and frozen at -20℃ until the drying of the kit in duplicate. Then, the samples were process. The lyophilizer (77535-01, Labconco, incubated with primary antibody (25 µl) and Germany) was used to evaporate and dry the peptide biotinylated peptide (25 µl) at room temperature for 2 rich solution to a peptide rich pellet. The pellet was hours. Then, the contents were discarded and each well then stored at -80℃ until kisseptin measurement. was washed with the assay buffer (350 µl). The immunoreactivity was visualized by incubating with EIA: The plasma rich pellet was reconstituted to streptavidin-horseradish peroxidase (100 µl) and plasma rich solution by adding 1X buffer (125 µl) substrate TMB (100 µl). This reaction was terminated provided by the EIA kit. The concentration of plasma by adding 2 N HCl (100 µl). The concentration of rich solution was 8 times which resulted in a detectable plasma kisspeptin was conducted as mentioned above. range of the commercial EIA kit. The assay was performed following the instruction of the Statistical analyses: All data were statistically manufacturer. The absorbance was measured at 450 nm. The kisspeptin levels were quantified by four analyzed by IBM Corp. Released 2013. IBM SPSS parameter logistic functions (Magellan data analysis software V6.00). The measured concentrations were Statistics for Windows, Version 22.0. Armonk, NY: IBM then divided by 8 to give plasma concentration. Corp. The mean and standard error (SEM) were Assay validation: Intra-assay variability was determined by the coefficient of variability (CV) of a calculated. A one-way analysis of varience (ANOVA) measure of endogenous kisspeptin of pooled plasma which was run in duplicate 7 times within the same and LSD test was performed to compare the assay. These pooled plasma samples were obtained from cats which were categorized as being at different differences of means of plasma kisspeptin levels at the reproductive stages: inactive (n = 5), follicular (n = 5) and luteal (n = 5) stages. The CV was then calculated: different reproductive stages of the cats. CV = (SD/mean)*100. Results Inter-assay was determined by the CV of a measurement of standard kisspeptin provided by EIA Validation of commercial kisspeptin EIA kit: The kit at three different concentrations which were run in intra-assay CV determined using rich plasma solution duplicate in three separate assays. The CV was containing 0.057 ng/ml of endogenous feline calculated: CV = (SD/mean)*100. Such standard kisspeptin was 11.13%. The inter-assay CV determined kisspeptin is known to cross-react with human using standard kisspeptin provided by the company, kisspeptin-10/metastin (45-54). containing 0.1, 1 and 10 ng/ml were 5.00, 4.11 and 8.25%, respectively. The mean ± SEM inter-assay was To study the parallelism, the plasma from cats at 5.78 ± 1.25. the inactive (n = 1), follicular (n = 1) and luteal stages (n = 1) were pooled. These pooled plasma samples The feline endogenous kisspeptin with increasing were diluted serially two fold in assay buffer (1:1(neat), dilution tended to be parallel to the standard curve 1:2, 1:4 and 1:8) and run in duplicate along with a (Fig. 1). Additionally, 1:1 (neat) is the dilution of rich standard curve. The standard curve was plotted by the plasma solution that gave the 50% binding (Fig. 1). known concentrations of standard kisspeptin. Therefore, neat is the suitable dilution for the measurement of cat kisspeptin using this EIA. For the recovery test, the pooled plasma samples from cats at the inactive stage (n = 6) were spiked with The mean ± SEM percentage of recovery was 84.8 an equal amount of 10, 1, 0.1, 0.05 and 0.025 ng/ml of ±5.31. The recovery of the amount expected (x-axis) standard kisspeptin. Additionally, the pooled samples versus observed (y-axis) kisspeptin concentration was were analyzed in the absence of spiked standard shown by linear regression (Fig. 2) and gives the kisspeptin to evaluate the endogenous feline equation, y = 1.0618x – 0.0385. The percentage of kisspeptin. The endogenous feline kisspeptin was then recovery is shown in Table 1. subtracted from each spiked pool sample. The amount expected was calculated: each concentration of Feline plasma kisspeptin profile at different standard kisspeptin/2. The amount observed was calculated: each concentration from each spiked pool reproductive stages: The plasma concentrations of the sample – endogenous feline kisspeptin. The percentage cats at prepuberal, inactive and follicular stages were 7.91 ± 0.53, 6.87 ± 0.53 and 6.25 ± 0.64 pg/ml, respectively. No significant differences in plasma kisspeptin were observed among groups (Fig. 3).

212 Tanyapanyachon P. et al. / Thai J Vet Med. 2019. 49(3): 209-215. Figure 1 Parallelism between standard kisspeptin and two fold diluted cat plasma containing endogenous kisspeptin. Standards of kisspeptin concentrations ranged from 0.001 to 10 ng/ml per well. Figure 2 Linear regression of recovery of amount expected and measured in the assay. Table 1 Recovery of spiked standard kisspeptin in pooled feline plasma Amount expected (ng/ml) %Recovery 5 106 0.5 78 0.05 80 0.025 80 0.0125 80

Tanyapanyachon P. et al. / Thai J Vet Med. 2019. 49(3): 209-215. 213 Figure 3 Plasma kisspeptin concentration (mean±SEM) during the prepubertal (n = 6), inactive (n = 6) and follicular (n = 6) stages of the cat. Discussion the high concentration of circulating kisspeptin is assumed to be related with the elevation of For the first time, kisspeptin was identified and sympathetic activity from ovary and celiac ganglion, measured in the plasma of the cats, using a which is characterized in the rats at prepubertal period commercially available EIA kit. (Ricu et al., 2012). In humans, it is suggested that the increased plasma kisspeptin levels could represent a For validation of the commercially EIA kit to be drive from hypothalamic kisspeptin neurons to initiate used in domestic cats, an intra-assay precision test, the pubertal development (Jayasena et al., 2014). inter-assay precision test, parallel test and recovery test However, whether the cat plasma kisspeptin level is were conducted. The intra- and inter-assay precision associated with the sympathetic nervous system or tests suggest the repeatability of an assay within the hypothalamic neurons remains unclear. single assay and within the different assay, respectively. The parallelism reveals the considerable For pubertal cats, we found no changes in plasma homology between the standard kisspeptin and feline kisspeptin levels between cats at the inactive and kisspeptin. Consequently, the standard curve, plotted follicular stages. Our results are in contrast with the from the standard kisspeptin can be used to determine observation in the cows where a fluctuation of the concentration of plasma kisspeptin in cats. circulating kisspeptin was demonstrated during the Furthermore, the recovery rates show little interference reproductive cycle (Mondal et al., 2015). Therefore, with the sample-specific matrix which is in the plasma kisspeptin cannot be used as biological marker acceptable range (80% - 120%) (Andreasson et al., 2015). to distinguish the different reproductive statuses in Taken together, the commercial kisspeptin EIA kit can domestic cats. It is possible that the circulating be applied to measure plasma kisspeptin levels of kisspeptin is not influenced by the sex steroid, domestic cats, as with humans (Torricelli et al., 2008; estrogen, since the circulating estrogen is reported to Logie et al., 2012; Kaya et al., 2015) and rats (Ricu et al., be increased during the follicular phase in cats (Shille 2012). et al., 1979). Likewise, the circulating kisspeptin in human is not associated with estrogen (Katagiri et al., With the validated EIA kit, the plasma 2015). concentration of kisspeptin in the domestic cat at different reproductive status was determined. In conclusion, the commercial EIA kit can be used Although no statistically significant difference in to determine plasma kisspeptin in domestic cats. plasma kisspeptin concentration between the reproductive stages was observed, there was a Conflict of interest: The authors declare that they have tendency that the plasma kisspeptin levels were higher no conflicts of interest. in prepuberal cats (7.91± 0.53 pg/ml) compared with pubertal cats at both inactive (6.87 ± 0.53 pg/ml) and Acknowledgements follicular stages (6.25 ± 0.64 pg/ml). Our findings are in good agreement with previous studies of rats and This study was supported by the Royal Golden humans where the plasma kisspeptin concentration at Jubilee PhD program (Grant number PHD/01882556). prepubertal period was higher compared to pubertal This work was financially supported by the 90th period (Ricu et al., 2012; Jayasena et al., 2014). In rats, anniversary of Chulalongkorn University fund

214 Tanyapanyachon P. et al. / Thai J Vet Med. 2019. 49(3): 209-215. (Ratchadaphiseksomphot Endowment Fund). We Lapatto R, Pallais JC, Zhang D, Chan YM, Mahan A, gratefully thank staff of the OGR unit at the small animal teaching hospital, Chulalongkorn University Cerrato F, Le WW, Hoffman GE and Seminara SB for providing facilities and samples. We appreciate the help of the staff at the Research Centre for Bioscience 2007. Kiss1-/- mice exhibit more variable in Animal Production, Faculty of Veterinary Science, Chulalongkorn University in providing the facilities in hypogonadism than Gpr54-/- mice. the lyophilize process. Endocrinology. 148(10): 4927-4936. References Latif R and Rafique N 2015. Serum kisspeptin levels Amelkina O, Tanyapanyachon P, Thongphakdee A and Chatdarong K 2019. Identification of feline across different phases of the menstrual cycle and Kiss1 and distribution of immunoreactive kisspeptin in the hypothalamus of the domestic cat. their correlation with serum oestradiol. Neth J Med. J Reprod Dev. 65(4): 335-343. 73(4): 175-178. Amelkina O, Tanyapanyachon P, Thongphakdee A and Chatdarong K 2019. Identification of feline Logie JJ, Denison FC, Riley SC, Ramaesh T, Forbes S, Kiss1 and distribution of immunoreactive kisspeptin in the hypothalamus of the domestic cat. Norman JE and Reynolds RM 2012. Evaluation of J Reprod Dev. 65(4): 335-343. kisspeptin levels in obese pregnancy as a biomarker Andreasson U, Perret-Liaudet A, van Waalwijk van Doorn LJ, Blennow K, Chiasserini D, Engelborghs for pre-eclampsia. Clin Endocrinol (Oxf). 76(6): 887- S, Fladby T, Genc S, Kruse N, Kuiperij HB, Kulic L, Lewczuk P, Mollenhauer B, Mroczko B, Parnetti L, 893. Vanmechelen E, Verbeek MM, Winblad B, Zetterberg H, Koel-Simmelink M and Teunissen CE Messager S, Chatzidaki EE, Ma D, Hendrick AG, Zahn 2015. A Practical Guide to Immunoassay Method Validation. Front Neurol. 6: 179. D, Dixon J, Thresher RR, Malinge I, Lomet D, Castellano JM, Gaytan M, Roa J, Vigo E, Navarro VM, Carlton MB, Colledge WH, Caraty A and Aparicio Bellido C, Dieguez C, Aguilar E, Sanchez-Criado JE, Pellicer A, Pinilla L, Gaytan F and Tena- SA 2005. Kisspeptin directly stimulates Sempere M 2006. Expression of KiSS-1 in rat ovary: putative local regulator of ovulation? gonadotropin-releasing hormone release via G Endocrinology. 147(10): 4852-4862. protein-coupled receptor 54. Proc Natl Acad Sci U Chen X, Mo Y, Li L, Chen Y, Li Y and Yang D 2010. Increased plasma metastin levels in adolescent S A. 102(5): 1761-1766. women with polycystic ovary syndrome. Eur J Obstet Gynecol Reprod Biol. 149(1): 72-76. Mondal M, Baruah KK and Prakash BS 2015. Jayasena CN, Nijher GM, Narayanaswamy S, De Silva Determination of plasma kisspeptin concentrations A, Abbara A, Ghatei MA, Bloom SR, Bridges N and Dhillo WS 2014. Age-dependent elevations in during reproductive cycle and different phases of plasma kisspeptin are observed in boys and girls when compared with adults. Ann Clin Biochem. pregnancy in crossbred cows using bovine specific 51(Pt 1): 89-96. enzyme immunoassay. Gen Comp Endocrinol. 224: Kanca H, Karakas K, Dalgic MA, Salar S and Izgur H 2014. Vaginal cytology after induction of ovulation 168-175. in the queen: comparison of postoestrus and dioestrus. Aust Vet J. 92(3): 65-70. Ricu MA, Ramirez VD, Paredes AH and Lara HE 2012. Katagiri F, Kotani M, Hirai T and Kagawa J 2015. The Evidence for a celiac ganglion-ovarian kisspeptin relationship between circulating kisspeptin and sexual hormones levels in healthy females. neural network in the rat: intraovarian anti- Biochem Biophys Res Commun. 458(3): 663-666. kisspeptin delays vaginal opening and alters Kaya A, Orbak Z, Polat H, Cayir A, Erdil A and Doneray H 2015. Plasma Kisspeptin Levels in estrous cyclicity. Endocrinology. 153(10): 4966- Newborn Infants with Breast Enlargement. J Clin Res Pediatr Endocrinol. 7(3): 192-196. 4977. Kinsey-Jones JS, Beale KE, Cuenco J, Li XF, Bloom SR, Salehi S, Adeshina I, Chen H, Zirkin BR, Hussain MA, O'Byrne KT and Murphy KG 2014. Quantification of rat kisspeptin using a novel radioimmunoassay. Wondisford F, Wolfe A and Radovick S 2015. PLoS One. 9(5): e97611. Developmental and endocrine regulation of Kriegsfeld LJ 2013. Circadian regulation of kisspeptin in female reproductive functioning. Adv Exp Med kisspeptin expression in mouse Leydig cells. Biol. 784: 385-410. Endocrinology. 156(4): 1514-1522. Seminara SB, Messager S, Chatzidaki EE, Thresher RR, Acierno JS, Jr., Shagoury JK, Bo-Abbas Y, Kuohung W, Schwinof KM, Hendrick AG, Zahn D, Dixon J, Kaiser UB, Slaugenhaupt SA, Gusella JF, O'Rahilly S, Carlton MB, Crowley WF, Jr., Aparicio SA and Colledge WH 2003. The GPR54 gene as a regulator of puberty. N Engl J Med. 349(17): 1614-1627. Shille VM, Lundstrom KE and Stabenfeldt GH 1979. Follicular function in the domestic cat as determined by estradiol-17 beta concentrations in plasma: relation to estrous behavior and cornification of exfoliated vaginal epithelium. Biol Reprod. 21(4): 953-963. Shille VM and Stabenfeldt GH 1979. Luteal function in the domestic cat during pseudopregnancy and after treatment with prostaglandin F2 alpha. Biol Reprod. 21(5): 1217-1223. Tanyapanyachon P, Amelkina O and Chatdarong K 2018. The expression of kisspeptin and its receptor in the domestic cat ovary and uterus in different stages of the ovarian cycle. Theriogenology. 117: 40- 48. Terao Y, Kumano S, Takatsu Y, Hattori M, Nishimura A, Ohtaki T and Shintani Y 2004. Expression of KiSS-1, a metastasis suppressor gene, in trophoblast giant cells of the rat placenta. Biochim Biophys Acta. 1678(2-3): 102-110.

Tanyapanyachon P. et al. / Thai J Vet Med. 2019. 49(3): 209-215. 215 Torricelli M, Galleri L, Voltolini C, Biliotti G, Florio P, De Bonis M and Petraglia F 2008. Changes of placental Kiss-1 mRNA expression and maternal/cord kisspeptin levels at preterm delivery. Reprod Sci. 15(8): 779-784. Uchikura K, Nagano M and Hishinuma M 2011. The effect of ovarian status and follicular diameter on maturational ability of domestic cat oocytes. J Vet Med Sci. 73(5): 561-566. Zhang P, Tang M, Zhong T, Lin Y, Zong T, Zhong C, Zhang B, Ren M and Kuang H 2014. Expression and function of kisspeptin during mouse decidualization. PLoS One. 9(5): e97647.



Original Article Development of business models for indigenous genetic improvement in small ruminant farms through reproductive biotechnology Sarawanee Khunmanee1,2 Theerawat Swangchan-Uthai1 Junpen Suwimonteerabutr1 Pintira Thiangthientham1,4 Sanya Supappornchai3 Mongkol Techakumphu1* Abstract This study aimed to establish a business model of reproductive biotechnology in small ruminant. Sets of questionnaires were administered to interview 115 farmers from different regions in Thailand. Data including age, educational background, farm size and type, source of replacement breeders, breeding technology, farm problems and attitude toward the technology were collected. Logistic regression analysis along with neutral network analysis was used to identify factors associated technology interest with P < 0.05. Results showed that among 115 participants, 72.2% were interested in reproductive biotechnology. In univariate logistic regression analysis, farmer’s age [OR=0.96, 95% CI (0.93,1.00)], educational background [OR=1.17, 95% CI (0.13,0.80)], production problems [OR=1.28, 95% CI (1.12,1.478)] and marketing problems [OR=1.40, 95% CI (1.18,1.67)] were independently associated with technology interest (P < 0.05). Similar to the neural network analysis, farmer’s age, overall farm problems, marketing problems, production problems and educational background were the primary factors influencing technology interest of farmers. Next, the data from 18 semi-structured interviews were interpreted to establish suggested business models of reproductive biotechnology package. This indicated that a single business model could not fit the expectation of all farmers. Thus, six business models were established and 2 models were initially implemented in 7 farms with a moderate successful rate. In conclusion, the implement of reproductive biotechnology in small ruminant farm should be addressed to the young farmers with high education to improve the animal genetic value and sustain their livelihoods. However, the different farm managements play a key role in the success of these business models. Keywords: business model, reproductive biotechnology, small ruminant farm 1Department of Obstetrics, Gynaecology and Reproduction, Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand 2School of Agricultural Resources, Chulalongkorn University, Bangkok 10330, Thailand 3Pornchai Intertrade Limited Partnership, Ratchaburi 70120, Thailand 4The Reproduction in Domestic Animal Research Unit, Faculty of Veterinary Sciences, Mahasarakham University, Maha Sarakham 44000, Thailand *Correspondence: [email protected] (M. Techakumphu) Thai J Vet Med. 2019. 49(3): 217-225.

218 Khunmanee S. et al. / Thai J Vet Med. 2019. 49(3): 217-225. Introduction Materials and Methods It has been generally accepted that small ruminant This study conformed to the ethical standards sector plays an important role in economic issued by the National Research Council and was development of rural households world-widely. In approved by Ethic Committee for Human and/or Thailand, the national statistic by the Department of Animal Experimentation No. 1531062, the Faculty of Livestock Development (DLD) reported that about half Veterinary Science, Chulalongkorn University. million of goat and sheep are raised by five hundred thousand families with an average of twelve animals Study area: The study was conducted in 5 regions of per farm (DLD, 2015). However, these small holder Thailand based on sheep and goat production area, i.e. farms frequently encounter the major problems the central region (Bangkok (13°45'0'' N, 100°31'1.20''E) including inbreeding, lack of breeders and lack of and Lopburi (14° 48' 0'' N, 100° 37' 12'' E) province), the disease monitoring in the herd. Utilization of the western region (Ratchaburi (13° 32' 24'' N, 99° 49' 12'' E) reproductive biotechnology such as laparoscopic and Kanchanaburi (14° 0' 15'' N, 99° 32' 57'' E) artificial insemination (LAI) and embryo transfer (ET) province), the eastern region (Chachoengsao (13° 41' can help to solve these problems. These tools promote 24'' N, 101° 4' 12'' E) province), the north-eastern region rapid genetic improvement, minimization of (Saraburi (14° 31' 48'' N, 100° 52' 48'' E), Nakhon inbreeding and prevention of disease transfer among Ratchasima (14° 58' 12'' N, 102° 6' 0'' E), Roi-Et (16° 3' 0'' herds (Leboeuf et al., 1998; Panyaboriban, 2015). The N, 103° 39' 0'' E), Khon Kaen (16° 25' 12'' N, 102° 49' 48'' E), and Udon Thani (17° 24' 36'' N, 102° 47' 24'' E) success rate of LAI reportedly ranges from 60% to 80% province) and the southern region (Krabi (8° 11' 53'' N, (Sathe, 2018). Generally, ET provides a pregnant rate 99° 0' 31'' E) province) (DGA, 2018). about 37% to 80% (Bergstein-Galan et al., 2018). Questionnaire: The goal of the questionnaire was to However, the LAI and ET by Thai government services explore the relationships among factors that influenced are limited encountering approximately only <1% of farmers’ interest in biotechnology. Various factors goat population. We hypothesized that a cooperation related to the technology utilization included farmer’s in a form of “Public-Private-Partnerships: PPPs” by a age, educational background, farm size and type, joint venture between university and private sector source of replacement breeders, breeding technology could be a suitable business model to implement the and problems in the farm as shown in Table 1. The existing biotechnology to help small ruminant farmers. participants (n=115 farmers) were located from the The objective of the present study was to establish central (n=25), north-eastern (n=44) and southern suitable business models for the use of reproductive (n=46) parts of Thailand. All questionnaires were biotechnologies in small ruminants in small holder recorded and analysed for the relationships between farmers. This was performed by studying the factors relevant factors and the technology interest. affecting the farmers’ perception to the technology using questionnaire, semi-structured interview and also testing the efficiency in field practice. Table 1 Details of each factor that used in the study of the relationships with technology interests (n=115). Factors Details Basic information Farmer’s age 1. Age ≤ 46 years (2 groups) 2. Age > 46 years Education background 1. Basic education (2 levels) 2. Certificate/ Higher degree Animal Husbandry Farm size 1. Small farm (<40) (3 sizes) 2. Medium farm (40-80) 3. Large farm (>80) Farming type 1. Breeder farm (4 types) 2. Meat farm 3. Dairy farm 4. Multi-purpose farm Source of replacement breeder 1. Imported (3 sources) 2. Local farm 3. Multiple sources Breeding technology 1. Natural insemination (3 methods) 2. Artificial insemination 3. Both methods Overall farm problems 1. Production problems (11 issues): A (18 list of problems)* 2. Marketing problems (7 issues): B *A) Production problems: 1) expensive breed, 2) sparsity of purebred, 3) lack of high genetic breeder, 4) low conception rate, 5) lack of breeding management knowledge, 6) lack of government support, 7) lack of feed stock, 8) abortion/disease outbreaks, 9) unadapt to condition, 10) low growth rate and 11) inbreeding; B) Marketing problems: 1) unstable price, 2) state regulation of importation, 3) market uncertainty, 4) lack of processing, 5) specific consumer groups, 6) lack of advertising and 7) lack of animal sources. Semi-structured interview: The data was collected north-eastern (n=8) and south (n=2). The data included from 18 farms from central (n=4), east (n=1), west (n=3), the number and source of animals, breed, feeding,

Khunmanee S. et al. / Thai J Vet Med. 2019. 49(3): 217-225. 219 insemination technique, insemination costs, regression; P < 0.05 was set as level of significance and reproductive performance on the farm, interest in neural network analysis. reproductive biotechnology and factors or problems influencing sheep and goat production. Qualitative Results data analysis including preparing and organizing the data, coding, and presentation the data in the form of A total of 72.2% of 115 respondents were interested text (Creswell, 2007) were used to establish suggested in reproductive biotechnology. In line with our business models on reproductive biotechnology. expectations, significant relationships were found between farmers’ technology interest and several On-farm technology testing: Seven from eighteen socio-economic factors using univariate logistic semi-structured interviews at central (n=1), eastern regression analysis (Table 2). The farmer age (Fig. 1a) (n=1), north eastern (n=5) were selected to test our was significant related with the farms’ interest in business models. Farm inclusion criteria included obtaining the technology where older farmers (>46 raising healthy animals, being a brucellosis-free herd, years) were less technology interest [OR=0.96, 95% CI having good animal management practices (0.93,1.00)]. The farmers’ educational background (Fig. (husbandry and reproduction), and compliance with 1b) also significant affected the farmer attitudes which data recording. The procedures for implementation the farmers with a certificate/ higher degree were were started with gathering herd status, pregnancy more technology interest [OR=1.17, 95% CI (0.13,0.80)]. diagnosis. Then, suitable biotechnology, e.g. synchronization program, cervical artificial From the present study, there were no significant insemination (CAI), LAI, ET, and semen relationships between technology interest and farm cryopreservation were chosen to perform according to size, farm type, source of animal replacement and the customer needs and farm performance. After breeding method. Whilst the larger proportion of the checking for the conformity, the results of on-site farmers that were interested in technology are small testing were monitored regularly in order to follow up holder farms (Fig. 1c), producing meat farm type (Fig. the implementation. 1d), purchasing replacement breeders from local farms (Fig. 1e) and using natural insemination (NI) (Fig. 1f). Statistical analysis: The statistical analyses were carried out using IBM SPSS Statistic Version 22.0 (SPSS; Interestingly, we found that overall problems in IBM, Armonk, NY, USA). The data from the farm [OR=1.19, 95% CI (1.09,1.30)] including the total questionnaires and interviews were displayed as score of production problems [OR=1.28, 95% CI descriptive statistics. The relationships among socio- (1.12,1.478)] and the total score of marketing problems economic factors (farmer’s age, educational [OR=1.40, 95% CI (1.18,1.67)] were significant background, farm size, farm type, source of associated with farmers' technology interest as shown replacement breeders, breeding technology, and level in Table 3 and Fig. 1g. Indeed, specific problems in of problems at the farm) and attitudes toward farm that tend to influencing the technology interest of receptivity of reproductive biotechnology were farmers were lack of high genetic breeder [OR=3.14, explored using two methods, i.e. univariate logistic 95% CI (0.93,10.63), P = 0.07], lack of government support [OR=2.98, 95% CI (0.97,9.16), P = 0.06] and low growth rate [OR=0.30, 95% CI (0.07,1.20), P = 0.09]. Table 2 The univariate logistic regression analysis of socio-economic factors influencing farmers' technology interest (n=115) Factor Farmer OR P-value 95% confidence interval number Lower-Upper Basic information Ref. - Age (year) 56 0.96 0.03 - 1. ≤46 59 0.93-1.00 2. >46 Ref. - Education 64 1.17 0.01 - 1. Basic education 51 0.13-0.80 2. Certificate/ Higher degree Ref. 0.49 Animal Husbandry 69 0.76 0.55 - Farm size 33 2.10 0.37 0.31-1.86 1. Small farm (<40) 13 0.42-10.32 2. Medium farm (40-80) Ref. 0.80 3. Large farm (>80) 5 1.61 0.61 - Farm type 82 2.67 0.50 0.25-10.26 1. Breeder farm 5 2.40 0.40 0.16-45.14 2. Meat farm 23 0.31-18.55 3. Dairy farm Ref. 1.00 4. Multi-purpose farm 1 4.22*108 1.00 - Source of replacement breeder 112 1.00 0.00 1. Imported 2 0.00 0.00 2. Local farm 0.68 3. Multiple sources 98 Ref. 0.38 - Breeding technology 1 0.55 1.00 0.15-2.07 1. Natural insemination 16 3.72*108 2. Artificial insemination 0.00 3. Both methods

220 Khunmanee S. et al. / Thai J Vet Med. 2019. 49(3): 217-225. Table 3 The univariate logistic regression analysis of factors related to farm problems that influencing farmers' technology interest (n=115) Factor Farmer OR P-value 95% confidence interval number Lower-Upper Overall farm problems 115 1.19 <0.01 1.09-1.30 Production problems 1. Expensive breed 88 1.59 0.47 0.46-5.54 2. Sparsity of purebred 92 2.45 0.24 0.56-10.75 3. Lack of high genetic 75 3.14 0.07 0.93-10.63 breeder 4. Low conception rate 47 0.46 0.26 0.12-1.79 5. Lack of breeding 84 0.78 0.74 0.18-3.36 management knowledge 6. Lack of government 71 2.98 0.06 0.97-9.16 support 7. Lack of feed stock 59 1.89 0.28 0.59-6.03 8. Abortion/Disease 67 2.80 0.12 0.76-10.38 outbreak 9. Unadapt to condition 65 0.97 0.96 0.29-3.23 10. Low growth rate 73 11. Inbreeding 62 0.30 0.09 0.07-1.20 12. Total score 115 1.46 0.56 0.41-5.15 Marketing problems 1. Unstable price 82 1.28 0.00 1.12-1.47 2. State regulation of 76 importation 1.43 0.61 0.37-5.60 3. Market uncertainty 83 1.18 0.79 0.34-4.16 4. Lack of processing 94 5. Specific consumer 86 0.83 0.79 0.20-3.44 groups 0.28 0.17 0.05-1.69 6. Lack of advertising 83 7. Lack of animal sources 66 0.77 0.71 0.20-2.95 8. Total score 115 1.05 0.95 0.26-4.17 0.27 0.21 0.09-0.82 1.40 0.00 1.18-1.67 In addition, to explore the relationship between Discussion farmers’ technology interest and various factors, the neural network analysis (a deep learning process in The present study explored the relationships IBM SPSS 22) was carried out with the set of data between farmers’ technology interest and underlying training at 75% and testing at 25%. On the basis of the factors including socio-economic status and problems normalized importance, farmer’s age (100%) was found in farm by direct interviewing of 115 small found to be the most important factor influencing ruminant farm owners. Then, the empirical analysis of farmers’ technology interest followed by overall farm 18 semi-structured interviews has revealed six problems (66.1%), marketing problems (55.5%), distinctive types of business models on reproductive production problems (51%) and farmers’ educational biotechnology in small ruminant farm which has never background (42.2 %), respectively (Fig. 2). been reported to the best of the authors' knowledge; in this case, technology acceptance must be made through Based on data from 18 semi-structured interviews, the establishment of business model and actual on- it can be concluded into six different business models farm testing. These developed business models can on reproductive biotechnology (Fig. 3) that resolve help to solve the common pain points of small specific farmer needs as follows: 1. Providing artificial ruminant farm production, e.g. inbreeding, lack of insemination (AI) using fresh semen from breeders in good genetic breeders and these models also aimed at farm or imported frozen semen, 2. Providing fresh or preventing the introduction of disease into herd. frozen embryos transfer to the recipients within farm, 3. Selling pregnant females that inseminated using AI The modern analysis using neural network technique, 4. Selling pregnant females using embryo harmonized with the data from regression analysis in transfer technique, 5. Selling offspring born by AI or ET this study revealed the top 5 primary factors affecting technique and 6. Servicing provision of reproductive farmers' technological interests, i.e. farmer’s age, biotechnology. farmers’ education background, overall farm Lastly, seven potential goat farms were selected to problems, marketing problems and farm production perform on-farm technology testing. The two business problems. This indicates that farmer’s socio-economic models (1 and 6) were initially implemented characteristics play a very important role in technology accordingly to the farmer’s wish and their farm interest. Indeed, the age of the farmer has a negative potential. The pregnancy diagnosis (regarding the impact on technology interest. Therefore, the young business model 6) was carried out toward all farms farmers with a higher educational background were whereas six farms preferred to further our service the prospective customers who interested in using the using LAI (regarding the business model 1) with the technology to improve the herd genetics. Although the successful results varied from 14.3 to 57.1%. Only one farm size did not significantly influenced farmers’ farm that preferred using cervical AI showed technology interest, but using biotechnology in farm to pregnancy rate at 33.3% (Table 4).

Khunmanee S. et al. / Thai J Vet Med. 2019. 49(3): 217-225. 221 enhance the productivity may suitable for small farm useful for farmers. Hence LAI and ET can serve to size because they lack of good breeders. In general, the improve the local and crossbred genetic for meat and goat farms in Thailand for meat production are milk production. Owners of farms that use natural operated with various mixed breeds, local and insemination were highly interested in technology crossbred etc. while dairy farms present only less than because they needed to breed with semen of high 5% of total goat population (DLD, 2018). Since most of quality and high genetic instead of natural mating. small ruminant farm in Thailand are indigenous, However, the AI services by Department of Livestock crossbred and exotic breeds (Anothaisinthawee et al., Development is currently less than 1% coverage (DLD, 2017). Therefore AI service in small ruminant industry 2010) with a lack of systemic breeding improvement. is still in high demand. This is another clue to indicate Typically, it is well known that native species were that farmers have needs to receive technology but growing slower than the imported species services from the public sector may not be sufficient for (Doloksaribu et al., 2000). Therefore, the use of meeting farmers' needs. technology to assist in breeding program was directly Figure 1 The factors affecting on farmers' technological interests including a) farmer’s age, b) educational background, c) farm size, d) farm type, e) source of replacement breeder, f) breeding technology, g) farm problems.

222 Khunmanee S. et al. / Thai J Vet Med. 2019. 49(3): 217-225. Figure 2 The top 5 primary factors affecting farmers' technology interest using the neural network analysis. Figure 3 The business model from 18 semi-structured interviews that used to implement in sheep and goat farms. a) Model 1: Providing AI using fresh semen from breeders in farm or imported frozen semen, b) Model 2: Providing fresh or frozen embryos transfer to the recipients within farm, c) Model 3: Selling pregnant females that inseminated using AI technique, d) Model 4: Selling pregnant females using embryo transfer technique, e) Model 5: Selling offspring born by AI or ET technique and f) Model 6: Servicing provision of reproductive biotechnology such as semen collection and freezing, estrus synchronization.

Khunmanee S. et al. / Thai J Vet Med. 2019. 49(3): 217-225. 223 Table 4 On-farm testing (farms that received technology services) (n=7) Pregnancy rate (%) of CAI 1/3 (33.3%) Services ND ND Farm Province Pregnancy LAI Pregnancy rate (%) CAI ND diagnosis of LAI ND 1 Bangkok ND 2 Chachoengsao 120 21 12 (57.1%) 3 ND 3 25 33.3% 4 Roi-Et1 34 ND ND ND 5 Roi-Et2 20 6 Roi-Et3 25 8 4 (50%) ND 7 Roi-Et4 27 Udon Thani 29 7 1 (14.3%) ND ND, not done Total 282 12 6 (50%) ND 17 7 (41.2%) ND 27 4 (14.8%) ND 92 34 (36.9%) 3 Our study also showed that farmers who faced the AI technology at a relatively low cost while restricting problems in farm were likely to pay attention to adopt the rate of inbreeding and reducing transmissible technology in their farm in order to solve their specific venereal diseases (Van- Arendonk, 2011). Using problems such as lack of high genetic breeder, lack of imported frozen semen may also reduce the cost of government support and low growth rate [OR=0.30, having male breeder in the farm and enable the farmer 95% CI (0.07,1.20), P = 0.09]. Based on this information, opportunity to select the desired characteristics for male breeder. However, the use of frozen semen results the problems that affect farmers’ breeding also involve in lower conception rates compared to the fresh semen. both production efficiency and marketing. Thus, if Frozen-thawed semen showed significantly lower technology can actually tackle breeding problems, the kidding rates (43.9%) than that with fresh semen production and marketing problem should be solved (59.8%) (Apu et al., 2012). However, this model had and farmers will therefore pay more attention to the advanced biotechnology. attracted some attention from the farmers and had been serviced on-farm because the cost is not very The current study also revealed that networking high. Model 2 offers the use of fresh embryos derived plays a important role in promoting participation of from animals within the farm. Many lines of evidences different sectors in the small ruminant industry. A showed that the survival rate of fresh embryos is cooperation in form of Public-Private-Partnerships by higher than that of imported frozen embryos (Pavone et al., 2011; Vladimirov et al., 2017). On the other hand, a joint venture between university and private sector is the key process to implement the business models that imported frozen embryos have high genetic values that covered the use of reproductive biotechnology in enable an increasing of genetic improvement without small/large ruminant farms. The value of AI services the need for having purebred rams in farm. This model can be offered in Model 1 (providing AI using fresh carries some risks and price considerations. Our semen from breeders in farm or imported frozen findings found that there were some farmers who are semen) and Model 3 (selling pregnant females that both ready and not ready to adopt this model in their inseminated using AI technique). The high genetic farms. Model 3 offers farmers to purchase ewes already offspring can be provided in pregnancy ewes by selling pregnant by AI technology. This approach reduces an offspring as in Model 3 and 4 (selling pregnant farmers’ risk of investment because a successful females using embryo transfer technique). If the conception is time-consuming process. However, the farmers need the purebred, they can choose Model 2 genetic values of offspring from those ewes were (providing fresh or frozen embryos transfer to the limited improvement under dependent of genetic from recipients within farm) or Model 4 by earning on-farm semen of rams. Model 4 help rapid increasing of ET services which giving a 100% desired genetics. In breeding management with excellent genetics because addition, our findings indicated that some small- the embryos in the pregnant recipient ewes were holder farmers did not participate in the on-farm selected from the oocytes of high genetic value donor biotechnology testing due to some barriers, i.e. poor ewes which had been inseminated with semen of the herd health management, lack of reproductive top rams. This model is suitable for a small number of management program and without budget constraints. high-performing farms that followed good practices, The veterinary services in reproductive management so this technology is still limited in the narrow band for such as pregnancy diagnosis, estrus synchronization the breeding schemes for small ruminant populations will help to solve the problems such as in developing countries. Model 5 will allow animals pseudopregnancy and increase farm potential. Due to (the offspring born from AI and ET) to adapt defensive a high prize of pure breeder, costing around 1,500 US system to their ambient environments (Vandenbergh et dollars per head, it is suitable to apply model 3, 4 and al., 2002; Wu and Bazer, 2019). It was indicated that 5 (selling offspring born by AI or ET technique) to provide a good genetic of 50% crossbred breeders from most farmers pay attention with this model because it AI or purebred from ET in form of pregnant animals or produces concrete results from reasonable investment. offspring. In addition, the offspring born from ET that However, farmers must accept the risk of loss during offered in Model 5 can be purchased to small-holder taking care of the offspring and also it cannot be farms that couldn’t perform ET services in their farms. guaranteed that all purchased offspring will be able to showed normal reproductive function. Lastly, Model 6 As with any study, each business model developed (servicing provision of reproductive biotechnology) in this study possesses different advantages and provides various choices of on-site reproductive disadvantages. Model 1 is capable of increasing the biotechnology services such as CAI, LAI, embryo rate of genetic improvement of local breeds in farm via

224 Khunmanee S. et al. / Thai J Vet Med. 2019. 49(3): 217-225. flushing, embryo cryopreservation, oestrus Creswell JW 2007. Qualitative inquiry and research synchronization, and pregnancy diagnosis. This model design: Choosing among five approaches. 2nd ed. can be applied in various circumstances because there In: Sage Publication, Inc. are several techniques to use, so that the techniques are tailor-made for each farm. DGA (Digital Government Development Agency (Public Organization) 2018. Latitude and Regarding on-farm implementation, we found that Longitude of Thailand. [Online]. Available: farmers were most accepted to perform pregnancy https://data.go.th/ diagnosis using ultrasonography to screen the DatasetDetail.aspx?id=c6d42e1b-3219-47e1-b6b7- reproductive status of their herds because the dfe914f27910. ultrasound technology provide practical, non-invasive and accurate results. In addition, ultrasound technique DLD 2015. Department of Livestock Development : offers another way to detect reproductive problems, Statistical data of animal husbandry 2015. Pages 1- e.g. pseudopregnancy. In our previous study showed 193. that pseudopregnant ewes can be cured by progesterone implantation in combination with DLD 2017. Department of Livestock Development : prostaglandin F2α (PGF2α) and became pregnant with Statistical data of animal husbandry 2017. Pages 1- a success rate of 40% (2/5) (Khunmanee et al., 2017). In 191. this context, the mean value of pregnancy rate following an implementation of biotechnology was DLD 2018. Department of Livestock Development: lower than the previous study (Panyaboriban et al., Statistical data of animal husbandry 2018. Pages 1- 2018). This result can be explained by many factors 182. including animal fertility, different management program and difficulty to control farm conditions Doloksaribu M, Gatenby R, Subandriyo M and throughout the study period (Duran, 2018). Bradford G 2000. Comparison of Sumatra sheep and hair sheep crossbreds. III. Reproductive In conclusion, six business models for reproductive performance of F2 ewes and weight of lambs. Small biotechnology package in small ruminant farms such Ruminant Res. 38(2): 115–121. as estrus synchronization, pregnancy diagnosis, LAI, ET and reproductive problem solving were established Duran B 2018. Investigation into factors potentially based on the information from questionnaire, semi- influencing the success of laparoscopic artificial structured interview and on site technology testing. insemination in sheep. Iowa State University. This tailor-made solution will help farmers to increase the production efficiency and thus improve their Khunmanee S, Techakumphu M and Swangchan- livelihoods. There are several factors affecting on the Uthai T 2017. Using a combination administration farmer’s perception on technology such as age, of progesterone device and PGF2α to treat educational background and farm problems that we pseudopregnancy in Thai dairy goats. Thai J Vet need to concern. A reliable networking in small Med Suppl. 47: 277-278. ruminant value chain and long-term commitment are needed in order to achieve a successful adoption of this Leboeuf B, Manfredi E, Boue P, Piacère A, Brice G, Baril technology. G, Broqua C, Humblot P and Terquif M 1998. Artificial insemination of dairy goats in France. Acknowledgements Livest Prod Sci. 55(3): 193-203. This work was funded by the Agricultural Research Panyaboriban S 2015. Semen cryopreservaion, Development Agency (Public Organization) ARDA, superovulation using a slow FSH releasing system Thailand (Grant Number 5807010560, 2015); the and embryo transfer in sheep in Thailand. National Research Council of Thailand and the Chulalongkorn University. Industries (RRI) Ph.D. program (Grant Number PHD 58I0089, 2016). Talent Mobility program year 2018 STI- Panyaboriban S, Suwimonteerabutr J, Swangchan- Uthai T, Tharasanit T, Suthikrai W, Suadsong S and (OHEC grant). Techakumphu M 2018. A simplified superovulation protocol using split-single References administration of Folltropin®-V in hyaluronan: application to purebred sheep. Vet Med-Czech. Anothaisinthawee S, Nomura K, Oishi T and Amano T 63(7): 321-328. 2010. Goat genetic resources and breeding strategies in Thailand. J Anim Genet. 38: 41-48. Pavone ME, Innes J, Hirshfeld-Cytron J, Kazer R and Shang J 2011. Comparing thaw survival, Apu A, Husain S, Khandoker M and Notter D 2012. A implantation and live birth rates from Comparative Study of Fresh and Frozen‐Thawed cryopreserved zygotes, embryos and blastocysts. J Semen Quality in Relation to Fertility of Hum Reprod Sci. 4(1): 23-28. BlackBengal Goat. Iran J App Anim Sci. 2(2): 157- 161. Sathe SR 2018. Laparoscopic Artificial Insemination Technique in Small Ruminants-A Procedure Bergstein-Galan T, Busato E, Abreu A and Weiss R Review. Front Vet Sci. 5: 1-9. 2018. Artificial Insemination and EmbryoTransfer in Small Ruminants. Pages 181-199 in Reproduction Vandenbergh J, Alwynelle S and Coffin J 2002. Animal Biotechnology in Farm Animals. Tácia Gomes Biotechnology: Science-Based Concerns In. 1-182. Bergstein-Galan, ed. Avid Science. Van Arendonk, JAM 2011. The role of reproductive technologies in breeding schemes for livestock populations in developing countries. Livest Sci. 136: 29-37. Vladimirov IK, Tacheva D and Diez A 2017. Theory about the Embryo Cry-Treatment. Reprod Med Biol. 16: 118-125. Wu G and Bazer FW 2019. Application of new biotechnologies for improvements in swine

Khunmanee S. et al. / Thai J Vet Med. 2019. 49(3): 217-225. 225 nutrition and pork production. J Anim Sci and Biotechno. 10(1): 28.



Original Article Investigation of Extended-Spectrum Beta-Lactamase (ESBL)- producing Escherichia coli and antimicrobial resistance in dogs with periodontal disease Jirapa Thepmanee1 Jutamart Rodroo1 Nattakarn Awaiwanont2 Montira Intanon3 Kannika Na Lampang3 Niyada Thitaram4 Kriangkrai Thongkorn4* Abstract Oral and faecal samples were collected from thirty four dogs with periodontal disease in Chiang Mai, Thailand to investigate the prevalence of Extended Spectrum Beta Lactamase -producing E. coli (ESBL-EC) and to determine the antimicrobial resistance patterns of isolates against 12 antimicrobial agents. Ten of thirty-four dogs (29.41%) were positive for ESBL-EC, one dog (2.94%) was positive from an oral sample and nine dogs (26.47%) were positive from faecal samples. All ESBL-EC isolates were multi-drug resistant (i.e. against ≥ 3 antimicrobial classes). All isolates were 100% resistant to Ampicillin, Cefazolin, Cephalexin, Ciprofloxacin and Clindamycin, and 100% susceptible to Imipenem. AMP-AMC-KZ-CL-ATM-DO-CIP-SXT-DA was the most common resistance pattern identified. Keywords: shcherichia coli, Extended spectrum β-lactamases, Periodontal disease, Dog 1Graduate School, Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai, Thailand 2Department of Food Animal Clinics, Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai, Thailand, 50100 3Department of Veterinary Bioscience and Veterinary Public Health, Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai, Thailand, 50100 4Department of Companion Animal and Wildlife Clinic, Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai, Thailand, 50100 *Correspondence: [email protected] (K. Thongkorn) Thai J Vet Med. 2019. 49(3): 227-233.

228 Thepmanee J. et al. / Thai J Vet Med. 2019. 49(3): 227-233. Introduction Questionnaire: Data were collected including signalment, vaccination and deworming histories, Periodontal disease (PD) is characterized by localized bacterial infections and an inflammatory antimicrobial usage in the previous 3 months, response that directly affects one or more of the sterilization, diet, faecal appearance and present periodontal tissues, such as the alveolar bone, illness. The protocol for this study was approved by the periodontal ligaments, cementum and gingiva (Kamel Animal Care and Use Committee (ACUC) of the et al., 2007; Kaur et al., 2017).Periodontal disease is Faculty of Veterinary Medicine, Chiang Mai multifactorial, caused primarily by dental plaque microorganisms with predisposing factors including University, Thailand. (Ref.No. R6/2558) environment, chewing behavior, nutrition, oral hygiene, genetics (Albuquerque et al., 2012) and Sample collection and Escherichia coli isolation: systemic health status, for example renal, hepatic or cardiac disorders or immune-mediated disease Faecal and oral biofilms were collected from each dog (Glickman et al., 2009; Pavlica et al., 2008). In many surveys PD was been found in approximately 80% of by swab using a sterile technique. The faecal samples dogs and 70% of cats aged 3 years or older (Harvey, 1998). The prevalence increases with age and small or were collected per rectum using a sterile cotton swab toy breeds are particularly susceptible (Harvey et al., 1994; Kortegaard et al., 2008). Over 500 different species and immediately immersed into 9 ml of Luria Bertani of bacteria have been isolated from dental plaque. The bacterial flora of clinically healthy gingiva is mainly broth at room temperature. Oral biofilm samples were composed of aerobic and facultative anaerobic Gram- positive species (Crossley et al., 1995). With supra- collected using a sterile cotton swab from both buccal gingival plaque accumulation, gingivitis develops and the bacteria shift from Gram-positive to Gram-negative and palatal sites of every tooth and immediately organisms (Marsh, 1994). immersed into 9 ml of Luria Bertani broth at room Although E. coli is not a predominant species in oral biofilms it is commonly found in the gastrointestinal temperature. Samples were transported to the tract of both humans and animals and can be transmitted via the faecal-oral route (Centers for microbiology laboratory within 24 h. Both faecal and Disease Control and Prevention, 2015). There have been many reports of ESBL-EC from the oral samples were streaked onto MacConkey agar and gastrointestinal tract of both sick and healthy dogs, with a worldwide prevalence of up to 40% the MacConkey agar was supplemented with 1µg/mL (Albrechtova et al., 2014; Carattoli et al., 2005; Ewers et al., 2010; Huber et al., 2013; Moreno et al., 2008; Keefe et cefotaxime plates and incubated for 24 h at 37 °C al., 2010; Pasotto et al., 2016; Shaheen et al., 2011; Sun et al., 2010; Tamang et al., 2012; Wagner et al., 2014). In a following a protocol described by Rocha-Gracia et al previous study, Oliveira et al. (2016) detected E. coli in the oral cavity of healthy dogs and demonstrated that (2015) to isolate colonies resistant to cefotaxime and these strains carried the extended spectrum beta- lactamase (ESBL) enzyme. These findings indicate that cephalosporin . Two typical E. coli colonies were tested dogs may contribute to the dissemination of resistant bacteria to other animals and humans. to confirm their identity using Matrix-Assisted Laser The present study was designed to investigate the Desorption/Ionization Time-of-Flight Mass presence of ESBL-EC in dogs with periodontal disease and to determine the antimicrobial resistance patterns Spectrometry (MALDI-TOF MS) (Boonyasiri et al., of any strains that were isolated. 2014; Carbonnelle et al., 2011; Gongora et al., 2015). Materials and Methods Extended-spectrum β-lactamase (ESBL) phenotype Study population: Oral biofilm and faecal samples identification: Two typical CTXr E. coli colonies per were obtained from 34 dogs presented to the dental individual sample from MacConkey agar plus 1µg/mL clinic of the Veterinary Teaching Hospital, Chiang Mai cefotaxime plates were examined for extended- University, from November 2015 - November 2016 with stage 2 periodontal disease, classified as early spectrum β-lactamase (ESBL) production by the periodontitis, with 25% or less of alveolar bone loss combination disk test. This involved streaking colonies (American Veterinary Dental College, 2009). This on Mueller Hinton agar plates containing cefotaxime number was estimated with an expected prevalence of (CTX, 30µg) and ceftazidime (CAZ, 30µg) alone and in 10%, with a precision of 5% and 95% confidence. Dogs combination with clavulanic acid (CAL) (CTX 30 µg + showing signs of gingivitis and periodontitis were included in the study and samples were collected by CAL 10µg, CAZ 30µg + CAL 10µg) (Clinical and purposive sampling of any age, breed and sex. All dog Laboratory Standards Institute, 2014). The inhibition owners gave written informed consent and completed zone around the cephalosporin disc combined with a questionnaire before enrollment in this study. clavulanic acid was compared with the zone around the disc with the cephalosporin alone. The test was positive if the inhibition zone diameter was ≥ 5 mm with clavulanic acid rather than without. Antibiotic susceptibility testing: Antimicrobial susceptibility testing was performed by disc diffusion method for ampicillin (AMP, 10µg), amoxicillin- clavulanic acid (AMC, 30µg), cefazolin (KZ, 30 µg), cephalexin (CL, 30 µg), aztreonam (ATM, 30 µg), imipenem (IPM, 10 µg), gentamicin (CN, 10 µg), doxycycline (DO, 30 µg), norfloxacin (NOR, 10 µg), ciprofloxacin (CIP, 5 µg), trimethoprim- sulfamethoxazole (SXT, 25 µg), and clindamycin (DA, 2 µg) following Clinical and Laboratory Standards Institute M100-S24guidelines (Clinical and Laboratory Standards Institute, 2014). Isolates were classified as susceptibile or resistant according to the guidelines. Intermediate isolates were reported as susceptible. E .coli ATCC 25922 was used as a quality control strain.

Thepmanee J. et al. / Thai J Vet Med. 2019. 49(3): 227-233. 229 Statistical analysis: R program version 3.3.2 was used common sex of the dogs was male (n = 6/10) .The most to identify antimicrobial drug resistance patterns. common breed of dog was poodle (n= 5/10), the other Independent variables were created from the breeds were mixed breed, shih tzu and mini bull terrier questionnaires. Logistic regression and Fisher’s exact (n = 3, 1 and 1 respectively). test were used to examine the association between variables and all outcomes. A significant level is P ≤ Antimicrobial resistance: Results of agar disk 0.05. diffusion indicated that all 20 ESBL E. coli isolates (two isolates per individual dog) were resistant to AMP, KZ, Results CL, CIP and DA (20 isolates, 100%), followed by ATM (18 isolates, 90%), DO and SXT (12 isolates, 60%), CN Phenotypic detection of ESBL: CTXR positive E. coli and NOR (8 isolates, 40%) and AMC (6 isolates, 30%). isolates were detected in 10/34 (29.41%) dogs with In contrast, IMP was susceptible to all isolates. Nine periodontal disease. All the CTXR positive E. coli antimicrobial resistance patterns were identified from isolates exhibited an ESBL phenotype. Of the 10 dogs the 20 E. coli isolates and all could be classified as that produced ESBL enzymes, one dog (2.94%) was multidrug resistant (MDR) (Table1). The largest positive from an oral biofilm sample and nine different number of antimicrobial drug resistant was 11 drugs, dogs (26.47%) were positive from faecal samples. All 10 while the least of antimicrobial drug resistant were 6 dogs had both gingivitis and periodontitis and were drugs. The same isolates from individuals exhibited treated by dental scaling and polishing. The median the same antimicrobial resistance patterns. age of the dogs was 5 years (range: 3-13 y). The most Table 1 Antimicrobial resistance patterns of ESBL producing E.coli isolates using agar disk diffusion method. Isolate source Antimicrobial resistance pattern Periodontal disease Dog P1 Biofilm 1 AMP-KZ-CL-ATM-CN-DO-NOR-CIP-DA Dog P1 Biofilm 2 AMP-KZ-CL-ATM-CN-DO-NOR-CIP-DA Dog P2 Feces 1 AMP-AMC-KZ-CL-ATM-CN-DO-NOR-CIP-SXT-DA Dog P2 feces 2 AMP-AMC-KZ-CL-ATM-CN-DO-NOR-CIP-SXT-DA Dog P3 feces 1 AMP-AMC-KZ-CL-ATM-DO-CIP-SXT-DA Dog P3 feces 2 AMP-AMC-KZ-CL-ATM-DO-CIP-SXT-DA Dog P4 feces 1 AMP-AMC-KZ-CL-ATM-DO-CIP-SXT-DA Dog P4 feces 2 AMP-AMC-KZ-CL-ATM-DO-CIP-SXT-DA Dog P5 feces 1 AMP-KZ-CL-ATM-CN-NOR-CIP-DA Dog P5 feces 2 AMP-KZ-CL-ATM-CN-NOR-CIP-DA Dog P6 feces 1 AMP-KZ-CL-ATM-NOR-CIP-SXT-DA Dog P6 feces 2 AMP-KZ-CL-ATM-NOR-CIP-SXT-DA Dog P7 feces 1 AMP-KZ-CL-CN-DO-CIP-SXT-DA Dog P7 feces 2 AMP-KZ-CL-CN-DO-CIP-SXT-DA Dog P8 feces 1 AMP-KZ-CL-ATM-CIP-SXT-DA Dog P8 feces 2 AMP-KZ-CL-ATM-CIP-SXT-DA Dog P9 feces 1 AMP-KZ-CL-ATM-DO-CIP-DA Dog P9 feces 2 AMP-KZ-CL-ATM-DO-CIP-DA Dog P10 feces 1 AMP-KZ-CL-ATM-CIP-DA Dog P10 feces 2 AMP-KZ-CL-ATM-CIP-DA AMP,ampicillin; AMC, amoxicillin-clavulanic acid; KZ, cefazolin; CL, cephalexin; ATM, azetreonam; IPM, imipenem; CN, gentamicin; DO, doxycycline; NOR, norfloxacin; CIP, ciprofloxacin; SXT, sulfamethoxazole trimethoprim; DA, clindamycin. Logistical regression; ESBL producing E. coli with prevalences of ESBL-producing E. coli have been questionnaire data: The questionnaires from dog recorded from feces of healthy rural Thai people, owners were divided into two parts; general questions ranging from 29.3% to 76.2% (Luvsansharav et al. 2012). and questions for periodontal disease. Logistical regression in both univariable and multivariable ESBL producing E. coli have been recovered from models found no relationship between variables and healthy dogs in many parts of the world, including ESBL production; all variables found P > 0.05 (Table 2). Angola (75%) (Albrechtova et al., 2014), Tunisia (16.3%) (Sallem et al., 2013), Portugal (15%) (Belas et al., 2014), Discussion Mexico (6%) (Gracia et al., 2015) and the United To our knowledge, this is the first detection of ESBL Kingdom (1.36%) (Schmidt et al., 2015). Subsequently, producing E. coli from canine oral plaque samples in in sick dogs was found 5.6% in Germany (Ewers et al., Thailand. Our study found a high prevalence of ESBL 2010), 1.91% in Korea (Tamang et al., 2012), 3% United producing E .coli in dogs with periodontal disease, states (Shaheen et al., 2011) and 3.74% Switzerland 10/43(29.41%). These strains had not been recovered (Huber et al., 2013). ESBL producing E. coli have also from the oral cavity of humans with periodontal disease (Søraas et al., 2014). Previously, ESBL been recovered from environmental samples, producing E. coli had been recovered in Thailand from including water, fresh meat and vegetables infected dogs (9.89%) (Hanhaboon et al., 2015), cows (Hanhaboon et al., 2015; Singh et al., 2017). with mastitis (6.5%) (Hinthong et al., 2017) and piglets with diarrhea (12.2%) (Kramomtong et al., 2008). High In this study, ESBL producing E. coli was not found in both faecal and oral biofilm samples from an individual dog. This does not support the idea of intra- species transmission. Contrastingly, a previous study found inter-species and intra-species ESBL producing

230 Thepmanee J. et al. / Thai J Vet Med. 2019. 49(3): 227-233. E. coli transmission from the same household microorganisms on the teeth surface, including Gram- environment (Leite-Martins et al., 2015). There is the positive species (e.g. Actinomyces spp., Streptococcus suggestion that oral plaque ESBL producing E. coli in spp.) and Gram-negative, motile, anaerobic bacteria our results was received from environments such as (e.g. Porphyromonas spp., Actinomyces spp., Neisseria water and soil because of licking behavior (Singh et al., spp.) (Albuquerque et al., 2012; Elliott et al., 2005; 2017). Kasempimolporn et al., 2003; Misirligil et al., 1990). The oral infection with ESBL-producing E. coli could have In this study we detected ESBL producing E. coli occurred as a result of environmental contamination from the oral biofilm sample from one dog. Escherichia from an unknown source and the licking habits of this coli is not a common microorganism in oral biofilms. dog. Normally, plaque is a community of cooperating Table 2 Characteristics of dog with periodontal disease carrying ESBL enzyme in oral biofilm or faecal samples. Question AESBL BESBL Ρ-value N=1 N=9 AESBL BESBL General question Vaccination 1 0.1547 - Yes 19 - No 00 Deworming 1 0.0547* - Yes 18 - No 01 Sterilization 1 0.3796 - Yes 04 - No 15 Diet 1 0.6196 - Commercial food 0 4 - Homemade food 1 5 Faecal appearance 1 0.9851 - Hard 03 - Soft stool 16 - Watery 00 Home care 1 0.7280 - In home 00 - Away from home 1 4 - Both in home and 0 5 away from home Previous illness history 1 0.4181 - Yes 04 - No 15 Previous antibiotic drug used 1 0.0606* - Yes 05 - No 14 Question for periodontal disease Problem 1 0.2555 - Dental tartar 00 - Gingivitis/periodontiti 1 8 s - Dental loss 00 - Halitalsis 01 Duration 1 0.1974 - <1 wk 01 - 1-4 wk 01 - >1 mo 01 - 1-3 mo 02 - >3 mo 14 Dental floss usage 1 0.2723 - Yes 11 - No 08 Other illness 1 0.2639 - Yes 01 - No 18 AESBL= ESBL producing E.coli was found in oral biofilm, BESBL=ESBL producing E.coli was found in faecal. Markable number univaliable was found in the relationship between variables and ESBL production but the dog with a previous antibiotic drug usage and deworming a P value close to 0.05 All ESBL-producing E. coli strains isolates in this susceptible to the carbapenem group (imepenem). This study were resistant to the aminobenzyl-penicillin is similar to the results of a previous study (Huber et al., group (ampicillin), cephalosporin group (cefazolin and 2013). The prevalence of antimicrobial resistance was cephalexin), fluoroquinolone group (ciprofloxacin) higher in the dogs carrying ESBL E. coli than dogs and lincosamide group (clindamycin) while all were carrying normal E. coli (Costa et al., 2004). Our results

Thepmanee J. et al. / Thai J Vet Med. 2019. 49(3): 227-233. 231 revealed resistance to common antimicrobial drugs observed in stray dogs in rural Angola. Microbial used in both human and animal medicines and the prevalence of antimicrobial resistance (AMR) may Drug Resistance (Larchmont, N.Y.), 20(4), 372–375. have increased in such populations over time. This suggests that AMR is starting to attach the attention of Albrechtova, K., Kubelova, M., Mazancova, J., the public. Previous studies showed that all ESBL producing E. coli isolated from feces of healthy or sick Dolejska, M., Literak, I., & Cizek, A. (2014). High dogs were multidrug resistant (MDR) (Carattoli et al., 2005; Moreno et al., 2008; Shaheen et al., 2011; Tamang prevalence and variability of CTX-M-15-producing et al., 2012), similar to the results from our study. In addition, we found that oral biofilm isolates of ESBL and fluoroquinolone-resistant Escherichia coli producing E. coli were also MDR. observed in stray dogs in rural Angola. Microbial Normally the antibiotics recommended for the treatment of dogs with periodontal disease are Drug Resistance (Larchmont, N.Y.), 20(4), 372–375. amoxicillin, amoxicillin-clavulanic acid, clindamycin and metronidazole (Albuquerque et al., 2012; Albuquerque, C., Morinha, F., Requicha, J., Martins, T., Senhorinho et al., 2012; Nelson et al., 2013). These antibiotics may be effective when the biofilm contains Dias, I., Guedes-Pinto, H., Viegas, C. (2012). Canine normal microflora, however, ESBL producing E. coli found in the biofilm of one dog in our research was periodontitis: The dog as an important model for resistant to all the recommended antibiotics. This could be the result of the use of new generation periodontal studies. The Veterinary Journal, 191(3), cephalosporins in dogs infected with ESBL producing E. coli and this could lead to antimicrobial resistance 299–305. development. American Veterinary Dental College. (2009). AVDC Results from our questionnaire differed from observations previously reported on risk factors for the Nomenclature Committee | AVDC - American carriage of ESBL producing E. coli. In previous studies, dogs with a history of antimicrobial therapy in the past Veterinary Dental College. Retrieved January 7, year, dogs from shelters or breeders (Belas et al., 2014) and the consumption of raw meat (Schmidt et al., 2015) 2018, from https://www.avdc.org/ had a higher risk of being carriers of ESBL- producing E. coli, however there was no relationship to these risk nomenclature3.html#perio factors from our questionnaire. Belas, A., Salazar, A. S., Gama, L. T. da, Couto, N., & In conclusions, the high prevalence of ESBL producing E. coli in dogs with periodontal disease can Pomba, C. (2014). Risk factors for faecal develop multidrug resistance leading to the failure of antimicrobial drug use in animal. Further research colonisation with Escherichia coli producing could also be conducted to detect the antimicrobial resistance gene, phylogroup and molecular typing extended-spectrum and plasmid-mediated AmpC isolate in the future. β-lactamases in dogs. The Veterinary Record, Conflict of interest statement: None of the authors has any financial or personal relationships that could 175(8), 202. inappropriately influence or bias the content of this paper. Boonyasiri, A., Tangkoskul, T., Seenama, C., Saiyarin, Acknowledgements J., Tiengrim, S., & Thamlikitkul, V. (2014). The authors would like to thank the Faculty of Prevalence of antibiotic resistant bacteria in healthy Veterinary Medicine and staff of the Small Animal Hospital and Central Laboratory, Chiang Mai adults, foods, food animals, and the environment in University, who supported our data collection efforts. We would also like to show our gratitude to CP selected areas in Thailand. Pathogens and Global company for providing the use of Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Health, 108(5), 235–245. Spectrometry (MALDI-TOF MS). Carattoli, A., Lovari, S., Franco, A., Cordaro, G., Di References Matteo, P., & Battisti, A. (2005). Extended-Spectrum Albrechtova, K., Kubelova, M., Mazancova, J., Dolejska, M., Literak, I., & Cizek, A. (2014). High β-Lactamases in Escherichia coli Isolated from prevalence and variability of CTX-M-15-producing and fluoroquinolone-resistant Escherichia coli Dogs and Cats in Rome, Italy, from 2001 to 2003. Antimicrobial Agents and Chemotherapy, 49(2), 833–835. Carbonnelle, E., Mesquita, C., Bille, E., Day, N., Dauphin, B., Beretti, J.-L., Nassif, X. (2011). MALDI- TOF mass spectrometry tools for bacterial identification in clinical microbiology laboratory. Clinical Biochemistry, 44(1), 104–109. Centers for Disease Control and Prevention. (2015). General Information| E.coli | CDC. Retrieved January 8, 2018, from https://www.cdc.gov/ ecoli/general/index.html Clinical and labortory standaras institute, & Clinical and labortory standaras institute. (2014). M100-S24 Performance standards for Anitimicrebial Susceptibility Testing; Twenty-Fourth Informational Supplement. USA: Wayne, PA. Costa, D., Poeta, P., Briñas, L., Sáenz, Y., Rodrigues, J., & Torres, C. (2004). Detection of CTX-M-1 and TEM-52 beta-lactamases in Escherichia coli strains from healthy pets in Portugal. The Journal of Antimicrobial Chemotherapy, 54(5), 960–961. David A. Crossley, Penman, S., & British Small Animal Veterinary Association. (1995). Manual of small animal dentistry. British Small Animal Veterinary Association. Retrieved from https://books.google. co.th/ books?id=AS5qAAAAMAAJ El-Kamel, A. H., Ashri, L. Y., & Alsarra, I. A. (2007). Micromatricial metronidazole benzoate film as a local mucoadhesive delivery system for treatment of periodontal diseases. AAPS PharmSciTech, 8(3), E75.

232 Thepmanee J. et al. / Thai J Vet Med. 2019. 49(3): 227-233. Elliott, D. R., Wilson, M., Buckley, C. M. F., & Spratt, D. Piglets (Vol. 2008, pp. 233–234). Presented at the A. (2005). Cultivable Oral Microbiota of Domestic Dogs. Journal of Clinical Microbiology, 43(11), Proceedings, The 15th Congress of FAVA FAVA - 5470–5476. OIE Joint Symposium on Emerging Diseases, Espinosa-Gongora, C., Qaswar Ali Shah, S., Jessen, L. R., Bortolaia, V., Langebaek, R., Bjornvad, C. R., & Bangkok: FAVA. Guardabassi, L. (2015). Quantitative assessment of faecal shedding of beta-lactam-resistant Leite-Martins, L., Meireles, D., Beça, N., Bessa, L. J., de Escherichia coli and enterococci in dogs. Veterinary Microbiology, 181(3–4), 298–302. Matos, A. J. F., & Martins da Costa, P. (2015). Ewers, C., Grobbel, M., Stamm, I., Kopp, P. A., Diehl, Spread of multidrug-resistant Escherichia coli I., Semmler, T., Guenther, S. (2010). Emergence of human pandemic O25:H4-ST131 CTX-M-15 within domestic aggregates (humans, pets, and extended-spectrum-beta-lactamase-producing Escherichia coli among companion animals. The household environment). Journal of Veterinary Journal of Antimicrobial Chemotherapy, 65(4), 651–660. Behavior: Clinical Applications and Research, Glickman, L. T., Glickman, N. W., Moore, G. E., 10(6), 549–555. Goldstein, G. S., & Lewis, H. B. (2009). Evaluation of the risk of endocarditis and other cardiovascular https://doi.org/10.1016/j.jveb.2015.07. 040 events on the basis of the severity of periodontal disease in dogs. Journal of the American Veterinary Luvsansharav, U.-O., Hirai, I., Nakata, A., Imura, K., Medical Association, 234(4), 486–494. Yamauchi, K., Niki, M., Yamamoto, Y. (2012). Hanhaboon, P., Kimprasit, T., Wajjwalku, W., & Amavisit, P. (2015). Extended Spectrum Beta- Prevalence of and risk factors associated with faecal lactamase Producing Escherichia coli Isolated from Infected Canines. The Thai Journal of Veterinary carriage of CTX-M β-lactamase-producing Medicine, 45(2), 263–267. Enterobacteriaceae in rural Thai communities. The Harvey, C. E. (1998). Periodontal disease in dogs. Etiopathogenesis, prevalence, and significance. The Journal of Antimicrobial Chemotherapy, 67(7), Veterinary Clinics of North America. Small Animal Practice, 28(5), 1111–1128, vi. 1769–1774. Harvey, C. E., Shofer, F. S., & Laster, L. (1994). Luvsansharav, U.-O., Hirai, I., Niki, M., Sasaki, T., Association of age and body weight with periodontal disease in North American dogs. Makimoto, K., Komalamisra, C., Yamamoto, Y. Journal of Veterinary Dentistry, 11(3), 94–105. (2011). Analysis of risk factors for a high prevalence Hinthong, W., Pumipuntu, N., Santajit, S., Kulpeanprasit, S., Buranasinsup, S., Sookrung, N., of extended-spectrum {beta}-lactamase-producing Indrawattana, N. (2017). Detection and drug resistance profile of Escherichia coli from Enterobacteriaceae in asymptomatic individuals in subclinical mastitis cows and water supply in dairy farms in Saraburi Province, Thailand. PeerJ, 5, rural Thailand. Journal of Medical Microbiology, e3431. 60(Pt 5), 619–624. Huber, H., Zweifel, C., Wittenbrink, M. M., & Stephan, R. (2013). ESBL-producing uropathogenic Marsh, P. D. (1994). Microbial ecology of dental plaque Escherichia coli isolated from dogs and cats in Switzerland. Veterinary Microbiology, 162(2–4), and its significance in health and disease. Advances 992–996. in Dental Research, 8(2), 263–271. Kasempimolporn, S., Benjavongkulchai, M., Saengseesom, W., & Sitprija, V. (2003). Oral Misirligil, A., & Tuncer, I. (1990). [Oral bacterial flora bacterial flora of dogs with and without rabies: a preliminary study in Thailand. Journal of the of dogs]. Ankara Universitesi Dis Hekimligi Medical Association of Thailand = Chotmaihet Thangphaet, 86(12), 1162–1166. Fakultesi Dergisi = The Journal of the Dental Kaur, G., Mohindra, K., & Singla, S. (2017). Faculty of Ankara University, 17(1), 79–82. Autoimmunity—Basics and link with periodontal disease. Autoimmunity Reviews, 16(1), 64–71. Moreno, A., Bello, H., Guggiana, D., Domínguez, M., & Kortegaard, H. E., Eriksen, T., & Baelum, V. (2008). González, G. (2008). Extended-spectrum beta- Periodontal disease in research beagle dogs--an epidemiological study. The Journal of Small lactamases belonging to CTX-M group produced Animal Practice, 49(12), 610–616. by Escherichia coli strains isolated from companion Kramomtong, I., Tripipat, T., Nantawan na Ayudhya, S., Tummaruk, P., & Leangyodleuchakul, S. (2008). animals treated with enrofloxacin. Veterinary Extended-Spectrum Beta-lactamase Produced by Escherichia coli Strains Isolated from Diarrheal Microbiology, 129(1–2), 203–208. O’Keefe, A., Hutton, T. A., Schifferli, D. M., & Rankin, S. C. (2010). First detection of CTX-M and SHV extended-spectrum beta-lactamases in Escherichia coli urinary tract isolates from dogs and cats in the United States. Antimicrobial Agents and Chemotherapy, 54(8), 3489–3492. Pasotto, D., Menandro, M. L., Dotto, G., Tonellato, F. R., Mondin, A., & Martini, M. (2016). Prevalence of ESBL-producing Escherichia coli from different canine populations in Italy. International Journal of Infectious Diseases, 53, 49–50. Pavlica, Z., Petelin, M., Juntes, P., Erzen, D., Crossley, D. A., & Skaleric, U. (2008). Periodontal disease burden and pathological changes in organs of dogs. Journal of Veterinary Dentistry, 25(2), 97–105. Rocha-Gracia, R. C., Cortés-Cortés, G., Lozano-Zarain, P., Bello, F., Martínez-Laguna, Y., & Torres, C. (2015). Faecal Escherichia coli isolates from healthy dogs harbour CTX-M-15 and CMY-2 β-lactamases. The Veterinary Journal, 203(3), 315–319. Sallem, R. B., Gharsa, H., Slama, K. B., Rojo-Bezares, B., Estepa, V., Porres-Osante, N., Torres, C. (2013). First detection of CTX-M-1, CMY-2, and QnrB19 resistance mechanisms in faecal Escherichia coli isolates from healthy pets in Tunisia. Vector Borne

Thepmanee J. et al. / Thai J Vet Med. 2019. 49(3): 227-233. 2331 and Zoonotic Diseases (Larchmont, N.Y.), 13(2), phylotypes, lower prevalence of virulence determinants and ampC-replicons. Veterinary 98–102. Microbiology, 169(3–4), 171–178. Sasaki, T., Hirai, I., Niki, M., Nakamura, T., Komalamisra, C., Maipanich, W., Yamamoto, Y. (2010). High prevalence of CTX-M beta-lactamase- producing Enterobacteriaceae in stool specimens obtained from healthy individuals in Thailand. The Journal of Antimicrobial Chemotherapy, 65(4), 666–668. Schmidt, V. M., Pinchbeck, G. L., Nuttall, T., McEwan, N., Dawson, S., & Williams, N. J. (2015). Antimicrobial resistance risk factors and characterisation of faecal E. coli isolated from healthy Labrador retrievers in the United Kingdom. Preventive Veterinary Medicine, 119(1– 2), 31–40. Senhorinho, G. N. A., Nakano, V., Liu, C., Song, Y., Finegold, S. M., & Avila-Campos, M. J. (2012). Occurrence and antimicrobial susceptibility of Porphyromonas spp. and Fusobacterium spp. in dogs with and without periodontitis. Anaerobe, 18(4), 381–385. Shaheen, B. W., Nayak, R., Foley, S. L., Kweon, O., Deck, J., Park, M., Boothe, D. M. (2011). Molecular characterization of resistance to extended- spectrum cephalosporins in clinical Escherichia coli isolates from companion animals in the United States. Antimicrobial Agents and Chemotherapy, 55(12), 5666–5675. Singh, F., Hirpurkar, S. D., Shakya, S., Rawat, N., Devangan, P., Khan, F. F., & Bhandekar, S. K. (2017). Presence of enterobacteria producing extended-spectrum β-lactamases and/or carbapenemases in animals, humans and environment in India. The Thai Journal of Veterinary Medicine, 47(1), 35–43. Nelson, R., Couto, C. (2013). Small Animal Internal Medicine. 5th Ed. Elsevier publishing; 2013. Søraas, A., Olsen, I., Sundsfjord, A., Handal, T., Bjørang, O., & Jenum, P. A. (2014). Extended- spectrum beta-lactamase-producing bacteria are not detected in supragingival plaque samples from human faecal carriers of ESBL-producing Enterobacteriaceae. Journal of Oral Microbiology, 6. Sun, Y., Zeng, Z., Chen, S., Ma, J., He, L., Liu, Y., Liu, J.-H. (2010). High prevalence of bla(CTX-M) extended-spectrum β-lactamase genes in Escherichia coli isolates from pets and emergence of CTX-M-64 in China. Clinical Microbiology and Infection: The Official Publication of the European Society of Clinical Microbiology and Infectious Diseases, 16(9), 1475–1481. Tamang, M. D., Nam, H.-M., Jang, G.-C., Kim, S.-R., Chae, M. H., Jung, S.-C., Lim, S.-K. (2012). Molecular characterization of extended-spectrum- β-lactamase-producing and plasmid-mediated AmpC β-lactamase-producing Escherichia coli isolated from stray dogs in South Korea. Antimicrobial Agents and Chemotherapy, 56(5), 2705–2712. Wagner, S., Gally, D. L., & Argyle, S. A. (2014). Multidrug-resistant Escherichia coli from canine urinary tract infections tend to have commensal



Original Article Gene expression profiling of NGF, BDNF, NT-3 and TrkB receptor in the development of prehierarchical follicles of Zi Geese (Anser cygnoides) Cornelius Tlotliso Sello1† Chang Liu1† Yujian Sui1† Hui Yang1 Ziqiu Wang1 Hongtao Lu1 Jingtao Hu3 Yongfeng Sun1,2* Abstract The expression patterns of neurotrophins (NTs) at the gene and protein level including nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), and TrkB receptor were investigated in the prehierarchical follicles of Zi Geese by RT-qPCR and Western blotting analysis. The mRNA levels of NGF, BDNF, NT- 3 and TrkB receptor increased significantly in the small white follicles (SWF), and more interesting by BDNF and NT- 3 transcripts were not detectable in small yellow follicles (SYF) marked as the last stage of prehierarchical ovarian development before transition into preovulatory follicles. Western blot revealed the presence of all the target neurotrophins and high-affinity receptor at the protein level with varying predominance at each stage of follicle classifications. These results indicate that NGF, BDNF, NT-3, and TrkB are implicated in the folliculogenesis and may have an influential effect during the development and growth of the Zi Geese reproductive system. Keywords: Folliculogenesis, neurotrophins, RT-qPCR, Western blot 1Department of Animal Genetics, Breeding and Reproduction, College of Animal Science and Technology, Xincheng Street, No: 2888. Changchun City, Jilin Agricultural University, Changchun, People’s Republic of China 2Key laboratory for animal production, product quality and safety of ministry of education, China 3College of Animal Science and Technology, Jilin Provincial Engineering Research Centre of Animal Probiotics, Jilin Agricultural University, Changchun 130118, Jilin, China †Sello Cornelius Tlotliso, Liu Chang and Sui Yujian contributed equally to this work. *Correspondence: [email protected] (Y. Sun) Thai J Vet Med. 2019. 49(3): 235-241.

236 Sello C. et al. / Thai J Vet Med. 2019. 49(3): 235-241. Introduction prehierachical follicular development and the manner in which the neutrophins are expressed at each stage of Follicle development and growth in poultry is a prehierarchical growth has gained little or no attention. complicated and well - organized process that includes Therefore, the aim of this study was to investigate the paracrine, autocrine, and endocrine control factors mRNA and protein expression levels of NGF, BDNF, throughout the developmental stages to reach the NT-3 and TrkB as high-affinity BDNF receptor during maturity stage (Lyu et al. 2016). Conversely, most of the the development of prehierarchical follicles of Zi geese. ovarian follicles from a resting pool of primordial This study will further add information to reaffirm the follicles cannot develop to the ovulatory stage due to task unveiled by neurotrophins in ovarian follicle the selection mechanism of healthy single follicle per development and maturation. reproduction cycle (Johnson and Lee, 2016). Immediately before and after the transition of Materials and Methods primordial follicles into the prehierarchical follicles, a wide variety of cell anatomic and physiological Animals and sample collection: To ensure that Animal activities transpire, for example, angiogenesis welfare control measures were observed, this assembly to facilitate the formation of new blood experiment was authorized by the Animal Health and vessels at each cyclic recruitment before ovulation Care Committee of the College of Animal Science and (Retamalesortega et al. 2017). Therefore, the relative Technology, Jilin Agricultural University (Approval expression levels of genes encoding neurotrophins at code GR(J) 18-003). The geese were reared in a deep mRNA and protein are prerequisite and retained litter system under semi-intensive production within the prehierarchical follicles development in a management. The animals were fed ration locally stage-dependent manner. Also, many cell-signaling formulated in the farm composed of 17.34% Crude pathways are implicated in the ovarian follicle protein, energy, 12.36 ME(MJ/kg), 13.35 DE(MJ/kg), development process, in which the neurotrophin 2.57% Calcium, and 0.26% Phosphorus at ad libitum signaling pathway has recently been a primary focus of with free access to water and were exposed to natural interest (Streiter et al. 2015; Alqudah and Aldwairi, sunlight and uncontrolled environmental climatic 2016). conditions. There are two major families of neurotrophic Six geese (35-38 weeks old) with a regular laying growth factors: the neurotrophins (NT) and glia- sequence of 2-3 eggs were randomly selected to take derived neurotrophic factor. The neurotrophins consist part in the experiment. The birds were anaesthetized of five tight morphological identical peptides namely with ether and slaughtered via the jugular vein. Before nerve growth factor (NGF), brain-derived surgery, the abdominal area was treated with tampon neurotrophic factor (BDNF), neurotrophin-3 (NT-3) alcohol disinfectant. The geese follicles were placed on and neurotrophin-4/5 (NT-4/5) interacting with a plate containing a pre-cooled Phosphate-Buffered tyrosine kinase receptors or p75 neurotrophin receptor Saline (PBS) followed by the removal of the vascular and thus NGF binds to TrkA, BDNF, and NT-4/5 bind membrane of the outermost layer of the follicles. The to TrkB and NT-3 binds to TrkC to enable functional anterior follicular size formed the basis for intracellular signaling response (Gatta et al. 2016). classification of the prehierarchical follicles, which Neurotrophins maintain growth, development, and were grouped as primary follicles (PE, ˂ 2mm), small regulate apoptosis of neuronal populations in the white follicles (SWF, 2-4mm), middle white follicles central and peripheral nervous system and the (MWF, 4-6mm), large white follicles (LWF, 6-10mm), mammalian productive tract system such as rabbits, and small yellow follicles (SYF, 10-15mm). After guinea pigs, mice, pigs, and horses (Kuhn, 2015; classification, the follicles were ruptured to remove the Maranesi et al. 2016). Recent studies have shown that follicular liquid and the oocyte, thoroughly rinsed with neurotrophins and their receptors are extensively PBS buffer then immediately stored in a -80°C expressed in testicular development and refrigerator for experimental analysis. spermatogenesis in both rats and humans indicating that they may have a functional role in testicular RNA extraction and cDNA synthesis: Total RNA from development (Li and Zhou, 2013). Furthermore, prehierarchical follicle tissues was extracted with neurotrophins (NGF, BDNF and NT-3) and their Trizol using a commercial kit following the specific receptors (TrkA, TrkB and TrkC) have been manufacturer’s instructions (RNAiso Plus, Code No. studied in the oviduct of egg-laying Japanese quails 9108, Takara, Kusatsu, Japan). The pre-hierarchical (Maruccio et al. 2016). Some previous studies revealed follicles tissues were crushed to a powder using a that NTs and their respective receptors play a mortar and pestle and homogenized with 200µl Trizol; significant role in folliculogenesis, oogenesis, and the mixture was kept in the deep freeze at -20°C for 5 ovary development from the initial developmental mins, and then centrifuged at 13,500 rpm for 5 mins at stage of primordial follicles transiting to secondary 4°C. Then 200 µl of Chloroform was added to the first follicles observed through cell proliferation and aqueous phase. After 5 mins in the refrigerator (-20°C) differentiation leading to ovarian maturation (Dissen et the solution was centrifuged at 13,500 rpm for 15 mins al.2009; Chaves et al. 2013). Other studies have been at 4°C. Isopropanol (500µl) was then added to the conducted to evaluate neurotrophins mechanisms in separated upper aqueous solution of the three phases regulating ovarian follicular development and and centrifuged at 13,500 rpm for 10 min at 4°C. The function in humans and other species (Linhermelville resulting pellet was washed with 100µl of 75% ethanol and Li, 2013). However, as to whether neurotrophins and centrifuged at 7500 rpm for 5 min, air-dried and exert the similar or different roles in controlling geese dissolved in 30 µl of RNase free water. The total RNA

Sello C. et al. / Thai J Vet Med. 2019. 49(3): 235-241. 237 for each sample was treated with DNAse 1 transcriptional kit (ReverTra Ace qPCR RT Kit, Code (Ambion/Life Technologies) to avoid genomic DNA No. FSQ- 101, Toyobo, Osaka, Japan) according to the contamination. The concentration and quality of total manufacturer’s instructions which consisted of 17.5µl RNA was determined by measuring the absorbance at Nuclease-free water, 5µl 5X RT Buffer, 1.25µl of primer 260 nm using a spectrophotometer (NanoDrop 2000c mix, 1.25µl and 0.5µl of mRNA. The reverse ThermoScientific, Bremen, Germany). The quantity transcriptional response was followed by moderate and quality of RNA were estimated using centrifugation at 37°C for 15 mins and at 98°C enzyme spectrophotometric measurements at 260 and 280 nm inactivation for 5 min, the synthesized cDNA was kept and 1% agarose gel electrophoresis as shown in Figure at -20°C for further experiment. 1. The cDNA was synthesized using a reverse Figure 1 Gel electrophoresis bands of RNA isolated from prehierarchical follicle tissues of geese. In this experiment both 28s and 18s bands were intact showing high molecular weight fractions whereas 5s bands were blurry indicating low molecular weight fractions. Primer design, Polymerase Chain Reaction (PCR) and USA) under ultraviolet illumination as illustrated in Real-Time Quantitative Polymerase Chain Reaction Figure 2. Real-Time Quantitative Polymerase Chain (RT-qPCR): Transcriptome sequencing of NGF mRNA Reaction (RT-qPCR) was performed using THUNDERBIRD SYRB Green Kit (TOYOBO, Osaka, (K02582), BDNF (K04355), NT-3 (K04356) and TrkB Japan) for quantitative analysis of the mRNA levels of mRNA (K03176) were screened with KEGG (Kyoto Encyclopedia of Genes and Genomes) and the β-actin NGF, BDNF, NT-3 and TrkB genes in Geese sequence was obtained from NCBI (GeneBank: prehierarchical follicles. The RT-qPCR reaction total M26111.1). The conventional PCR was performed volume of 20 µl contained 10 µl Thunderbird SYBR qPCR mix, 0.6 µl of both forward and reverse primers, using specific primers for NGF, BDNF, NT-3, and TrkB 2µl of cDNA, 6.4µl Dd H2O RNase free and 0.4 µl 50 x genes designed by Primer Premier 5.0 software Rox reference dye. The thermal cycle employed was (Primer-E Ltd., Plymouth, UK) which are shown in 95°C for 75 sec, 59°C the 60 sec, 95°C for 15 sec with 40 Table 1. The PCR conditions consisted of 35 cycles; the cycles. The multicolored Real-Time PCR Detection System CFX manager (Bio-Rad Laboratories, samples were initially heated at 94°C for 5 min Mississauga, ON, Canada) was used to calculate the followed by denaturation at 94°C for 30 sec, annealing at 59.0°C for 30 sec and extending at 72°C for 30 sec. relative expression levels of the candidate genes in the The PCR product was visualized under 1% agarose gel prehierarchical follicles based on the 2 –ΔΔCt method. electrophoresis which was buffered with Tris base The β-actin was used as the control gene to normalize the mRNA expression levels of the target genes. Acetic acid and EDTA (TAE) including 0.15µl Gel Red Nucleic Acid Gel Stain (Biotium Inc, Hayward, CA, Table 1 Primers assembled for RT-qPCR Primer Primer sequence (5’-3’) Annealing Amplicon size (bp) name temperature (°C) NGF F: CACCACAACACACACCTTTG 59 116 R: GTCTCCCTGACTTCCTGCTAA BDNF F: ATGAAAGCTGCCCCGATGAA 58 143 R: AAAGTGTCCGCCAGTGATGT NT3 F: TGGTGAACAGAACCTCTCG 59 132 R: CCTGGTGTCCTCTAATGTCAA TrkB F: AACTGCGACTTACCCTCAGC 59 119 R: AGCACCCAGGACACATTAGG β-actin F: GCATGCCACACCGTGCCCATCTATGAG 59 205 R: AAGCTTGGCCATCTCCTGCTCGAAGT The candidate genes NGF: nerve growth factor, BDNF: brain-derived neurotrophic factor, NT-3: neurotrophin-3, and TrkB: tyrosine kinase receptor B encode ngf, bdnf, nt-3, and trkb, respectively; β-actin. F denotes forward primers and R denotes reverse primers

238 Sello C. et al. / Thai J Vet Med. 2019. 49(3): 235-241. Figure 2 Neurotrophins (NGF, BDNF, NT-3 and TrkB) genes mRNA expression on 1 % electrophoresis gel. Conventional PCR product bands confirmed the desired amplification size indicating the efficiency and quality of the designed primers. M represents the marker. Western blot analysis: The procedure followed to Results examine neurotrophin related genes protein expression on the prehierarchical follicles has The mRNA expression levels of NGF, BDNF, NT-3 and previously been described by Du et al. (2015) with TrkB receptor in prehierarchical follicles: Real-time modifications. The BCA method (Pierce, Thermo qPCR analysis was performed to determine the mRNA Fisher Scientific Inc., Rockford, IL, USA) was used to expression levels of the neurotrophins target genes determine the concentration of protein in the samples. (NGF, BDNF, NT-3, and TrkB) in the prehierarchical The total protein (10 µg) from each sample was loaded follicles classified according to size in diameter (PE, onto a 10% SDS-PAGE gel and an electro blotting SWF, MWF, LWF, and SYF). As presented in Figure 3, method performed to transfer the proteins onto a the different expression levels of NGF and TrkB genes nitrocellulose membrane (Pall, Port Washington, NY, were detected in all the prehierarchical stages of the USA). To avoid the binding of non-specific amino acids development of the follicles. In contrast, BDNF and the membranes were blocked with 5% dry milk at room NT-3 genes were undetected at the last stage of temperature (about 25°C) for 1 h and subsequently the prehierachical growth (SYF). Moreover, the expression membranes were incubated at 4 °C overnight levels of all NTs genes from SWF to LWF revealed a immersed with the following primary antibody: anti- down-regulated pattern with maximum expression in NGF (1:2000, sc-365944), anti-BDNF (1:1000, sc-20981), SWF (P˂0.05). However, there was no statistical anti-NT-3 (1:1000, sc-80250) and anti-TrkB (1:1000, sc- difference between PE and MWF for the BDNF gene as 119) (Santa Cruz Biotechnology, Santa Cruz, CA, USA). well as PE and SYF for the NGF gene (P>0.05). The The membranes were then thoroughly washed three BDNF gene was highly expressed in PE while the NGF times for 15 min each with TBST and the membranes showed the least expression in PE between the target were incubated with HRP-conjugated Affinipure Goat genes (P˂0.05). anti-Mouse IgG (H+L) for 1 h at room temperature (Wuhan, Hubei, China). The blotted membranes were Protein expression levels of NGF, BDNF, NT-3 and rigorously washed with TBST and visualized under TrkB receptor in prehierarchical follicles: We used the ECL Western blot detection kit (NC15080; Thermo Western blotting technique to study the neurotrophic Fisher Scientific, Waltham, MA, USA). Eventually, the genes in the prehierarchical follicles samples of Zi comparative intensities on each protein band were geese. The Western blot results in Figure 4, confirmed quantified using the ImageJ software and β-actin was the quantitative expression of NGF, BDNF, NT-3 and used as an internal control. TrkB receptor genes in all samples of prehierarchical follicles. The NGF protein expression was dominant in Statistical analysis: The relative expression levels of SWF and significantly different from that in PE, MWF, target genes in different grades of prehierarchical LWF and SYF (P˂0.05). There was no significant follicles were analyzed by SPSS23.0 statistical software. difference in the expression of NGF protein levels in Single factor analysis of variance (One-way ANOVA) PE, MWF and SYF (P>0.05). The highest protein level was used among groups and least square significant in BDNF was detected in PE followed by SWF, MWF, difference (LSD) test was used to compare the means. LWF and SYF (P˂0.05) in descending order, of which The significant difference of the data was indicated as MWF and LWF had no significant difference (P>0.05). P<0.05 and P>0.05 denoted no significant difference. Interestingly, the protein expression of NT-3 reflected an upward-regulated pattern from PE to LWF from which there was still no significant difference between

Sello C. et al. / Thai J Vet Med. 2019. 49(3): 235-241. 239 MWF and LWF (P>0.05) respectively. Furthermore, expressed in SYF, and there was a significant difference SYF had the least NT-3 protein, and PE, SWF, MWF, between PE, SWF, MWF, LWF, and SYF (P˂0.05). and LWF protein expressions were significantly Although the expression level in LWF was higher than different (P˂0.05). Similar to BDNF, the TrkB protein that of MWF, there was no statistical difference expression level was excessively high in PE and least between the two (P>0.05). Figure 3 Expression of genes encoding nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT- 3) and tyrosine kinase receptor B (TrkB) in the prehierarchical follicles of Zi geese. The data are represented as means ± SEM; n = 6 geese and the different letters indicate the significant difference of mRNA expression between different sizes of prehierarchical follicles (P˂0.05) reported in arbitrary units (AU) normalised with β-actin. The vertical ordinate represents the relative mRNA expression level of each neurotrophin-related gene. The horizontal ordinate indicates the sampled follicle sizes. PE: primary follicles, SWF: small white follicles, MWF: middle white follicles, LWF: large white follicles, and SYF: small yellow follicles. Figure 4 Western blot analysis comparing the densitometric means of the protein bands for NGF, BDNF, NT-3, and TrkB in prehierarchical stages of geese follicles (n=6). The upper four panels show the measurable quantities NGF, BDNF, NT-3, and TrkB, in prehierarchical follicles at different growth stages. The lower panel indicates the β-actin as an internal control in all samples. Each sample is shown as mean ± SEM of the ratio of the relative density of NGF, BDNF, NT-3, and TrkB to β-actin. The different superscripts indicate statistically significant differences (P<0.05). The difference between the five means was statistically significant at (P˂0.05). PE: primary follicles, SWF: small white follicles, MWF: middle white follicles, LWF: large white follicles, and SYF: small yellow follicles.

240 Sello C. et al. / Thai J Vet Med. 2019. 49(3): 235-241. Discussion affinity Trk receptors in various non-neural tissues resulted in the decision that the NTs may play a critical The neurotrophin family regulates the important role both in anatomic and physiological functions of functions in folliculogenesis and ovarian development animal organs and systems such as reproductive, by maintaining the survival of the nerve cells through immune, endocrine, and cardiovascular systems paracrine and autocrine mechanisms (Meinel et al. (Paredes et al. 2004). In this current research, the 2015). The mRNA levels of nerve growth factor (NGF) expression of TrkB receptor was investigated, wherein were markedly evident in the three stages of its presence was determined in the prehierarchical prehierarchical follicles development with profound follicles. The TrkB mRNA transcripts were expression in SWF and low quantities were detectable predominantly expressed in SWF whereas it was high in PE and SYF. At the protein level, NGF showed in PE at the protein level. These findings suggest that explicit expression at each stage. Conversely, it the TrkB receptor may significantly be involved in maintained the highest measure in SWF with no regulation in the early stages of ovarian follicular statistical significance between PE and SYF. The development and may have less functional findings of this study are consistent with that contributory effects as the prehierarchical follicles determined in the sex organs of male rabbits (Maranesi reach the preovulatory stage. In ovaries from the et al. 2015) and (Jana et al. 2011) in porcine ovaries in human fetus and adults, the expression of TrkB was which NGF also showed irregularity in the expression predominant in the granulosa cells of the primordial, pattern. The spatial-temporal expression of NGF in the primary, and secondary follicles with the highest prehierarchical follicles implies its possible functions quantity in granulosa cells of the primordial follicles in the control of follicular development in a stage- categorically (Harel et al. 2006). Jensen and Johnson, dependent manner. Studies have previously been (2001) revealing that TrkB mRNA significantly conducted on the expression of BDNF as a member of increased in preovulatory follicles as compared to the neurotrophin family and its potential biological prehierarchical follicle in domestic hens (Gallus Gallus functions in the ovarian development and oocyte Domesticus). It is worth noticing that all the target genes maturation in animals and humans (Anderson et al. at mRNA level increased significantly at SWF whereas 2009; Xie et al. 2017). In this study, it was also found at protein level showed varying significance in their that BDNF transcripts were undetectable in SYF as the expression pattern levels at different stages of follicle transit to the hierarchical stage. This went prehierarchical follicle development. These findings further to the protein level where significantly low suggest that the candidate neurotrophins might have a amounts of protein were detected in SYF (P˂0.05) and substantial contributory effect at SWF compared to the the high expression level in PE (P˂0.05). The results of other stages of development. Furthermore, the the present study were concurrent with the findings of variations of the target genes at protein level may be Mirshokraei et al. (2013) where the undetectable due to incredible successions of interrelated processes transcripts of BDNF were observed in the cervix of such as the post-transcriptional modification non-pregnant ewes and the isthmus of pregnant ewes. regulation and translation rate modulation (Vogel and The other comparative study conducted by Garcés et al. Marcotte, 2012). (2014) indicated that BDNF protein level decreased towards the end of gestation in both human and rat In conclusion, this research findings provide placenta. The existence of the BDNF gene at mRNA indications that NGF, BNDF, NT-3 and TrkB receptors and protein level in prehierarchical follicles provides are expressed differently at each prehierarchical stage clear evidence of its involvement in follicular to enhance the molecular physiological functions in the development and physiology. We further investigated follicular development of geese. These results also the presence of NT-3 gene in goose prehierarchical provide the basis for further studies on interactive cell follicles. It has been indicated that NT-3 was localized regulatory mechanisms of neurotrophins related genes in different ovarian cell types, predominantly in the in ovarian follicle growth and development. granulosa cells and oocytes to endorse the transition of primordial follicles into primary follicles (Nilsson et al. Acknowledgements 2009). Similarly, NT-3 at mRNA level was present in only four prehierarchical categories and undetectable This work was supported by the Jilin Province amounts were identified in SYF to produce Science and Technology Development Project quantifiable signals. Wherein NT-3 protein expression (20180201034NY, 20150204025NY), the Jilin Province was detectable in all the samples classification even Scientific Activities of Selected Returned Overseas though SYF showed the least quantity of expression. Professionals and the Jilin Agricultural University These results suggest that the casual expression pattern youth talent support program (2018). We thank the of NT-3 could be associated with the structural Jilin Agricultural University Goose Farm for providing development and physiological differences during the experimental animals. folliculogenesis. It has been documented that NT-3 expression was significantly higher in both brain References selective breast cancer cell lines compared with the non-brain selective breast cancer cell lines and hence Alqudah MA and Aldwairi A 2016. Mechanisms and promoting metastatic breast cancer brain growth regulation of neurotrophin synthesis and secretion. (Louie et al. 2013). It was initially believed that NTs Neurosciences. 21(4): 306. were mainly obligatory for the development of the nervous system; however the abundance of the high- Alqudah MA and Aldwairi A 2016. Mechanisms and regulation of neurotrophin synthesis and secretion. Neurosciences. 21(4): 306.

Sello C. et al. / Thai J Vet Med. 2019. 49(3): 235-241. 241 Anderson RA, Sciorio R, Kinnell H, Bayne RAL, Thong growth of breast cancer brain metastasis. KJ, de Sousa PA and Pickering S 2009. Cumulus Oncogene. 32(35):4064. gene expression as a predictor of human oocyte Lyu Z, Qin N, Tyasi TL, Zhu H, Liu D, Yuan S and Xu fertilisation, embryo development and competence R 2016. The Hippo/MST Pathway Member SAV1 to establish a pregnancy. Reprod. 138(4): 629-37. Plays a Suppressive Role in Development of the Prehierarchical Follicles in Hen Ovary. Plos one. Chaves RN, Alves AMCV, Lima LF, Matos HMT, 11(8): e0160896. Rodrigues APR and Figueiredo JR 2013. Role of Maranesi M, Parillo F, Leonardi L, Rebollar PG, Alonso nerve growth factor (NGF) and its receptors in B, Petrucci L, Gobbetti A, Boiti C Arruda-Alencar J folliculogenesis. Zygote. 21(2): 187-97. and Moura A. Expression of nerve growth factor and its receptors in the uterus of rabbits: functional Dissen GA, Garcia-Rudaz C and Ojeda SR 2009. Role of involvement in prostaglandin synthesis. Dom neurotrophic factors in early ovarian development. Anim Endocrin. 56: 20-28. Seminars in reproductive medicine. 27(1): 24-31. Maranesi M, Zerani M, Leonardi L, Pistilli A, Arruda‐ Alencar J, Stabile AM, Rende M, Castellini C, Du XH, Zhou XL, Cao R, Xiao P, Teng Y, Ning CB and Petrucci L and Parillo F 2015. Gene expression and Liu HL 2015. FSH-induced p38-MAPK-mediated localization of NGF and its cognate receptors dephosphorylation at serine 727 of the signal NTRK1 and NGFR in the sex organs of male transducer and activator of transcription 1 rabbits. Reprod Dom Anim. 50(6): 918-25. decreases Cyp1b1 expression in mouse granulosa Maruccio L, Castaldo L, D’Angelo L, Gatta C, Lucini C, cells. Cellular signalling. 27(1): 6-14. Cotea C, Solcan C and Nechita EL 2016. Neurotrophins and specific receptors in the oviduct Garcés MF, Sanchez E, Torressierra AL, Ruíz‐ Parra tracts of Japanese quail (Coturnix coturnix AI, Angel‐ Müller E, Alzate JP, Sánchez ÁY, japonica). ANN ANAT. 207: 38-46. Gomez MA, Romero XC and Castañeda ZE 2014. Meinel S, Blohberger J, Berg D, Berg U, Dissen GA, Brain‐ derived neurotrophic factor is expressed in Ojeda SR and Mayerhofer A 2015. Pro-nerve rat and human placenta and its serum levels are growth factor in the ovary and human granulosa similarly regulated throughout pregnancy in both cells. Horm Mol Biol Clin Investig. 24(2): 91-99. species. Clin Endocrinol. 81(1): 141-51. Mirshokraei P, Hassanpour H, Rahnama A and Foster WG 2013. Gene expression of BDNF and its Gatta C, Altamura G, Avallone L, Castaldo L, receptors, TrkB and p75 in the uterus and oviduct Corteggio A, D'Angelo L, de Girolamo P and Lucini of pregnant and non-pregnant ewes. Res C 2016. Neurotrophins and their Trk‐ receptors in Veterinary Sci. 95(1): 164-68. the cerebellum of zebrafish. J Morphol. 277(6): 725- Nilsson E, Dole G and Skinner MK 2009. Neurotrophin 36. NT3 promotes ovarian primordial to primary follicle transition. Reprod. 138(4): 697-707. Harel S, Jin S, Fisch B, Feldberg D, Krissi H, Felz C, Paredes A, Romero C, Dissen GA, DeChiara TM, Freimann, S, Tan SL, Ao A and Abir R 2006. Reichardt L, Cornea A, Ojeda SR and Xu B 2004. Tyrosine kinase B receptor and its activated TrkB receptors are required for follicular growth neurotrophins in ovaries from human fetuses and and oocyte survival in the mammalian ovary. adults. MHR: Basic science of reproductive Devel Biol. 267(2): 430-49. medicine. 12(6): 357-65. Retamalesortega R, Oróstica L, Vera C, Cuevas P, Hernández A, Hurtado I, Vega M and Romero C Jana B, Koszykowska M and Czarzasta J 2011. 2017. Role of nerve growth factor (NGF) and Expression of nerve growth factor and its receptors, miRNAs in epithelial ovarian cancer. Int J Mol TrkA and p75, in porcine ovaries. J Reprod Devel. Sciences. 18(3): 507. 57(4): 468-74. Streiter S, Fisch B, Sabbah B, Ao A and Abir R 2015. The importance of neuronal growth factors in the Jensen T and Johnson AL 2001. Expression and ovary. MHR: Basic science of reproductive function of brain-derived neurotrophin factor and medicine. 22(1): 3-17. its receptor, TrkB, in ovarian follicles from the Vogel C and Marcotte EM 2012. Insights into the domestic hen (Gallus gallus domesticus). J Exp Biol. regulation of protein abundance from proteomic 204(12): 2087-95. and transcriptomic analyses. Nat Rev Genet. 13(4): 227-32. Johnson AL and Lee J 2016. Granulosa cell Xie M, Li M, Zhou J, Ding X, Shao Y, Jing J, Liu Y and responsiveness to follicle stimulating hormone Yao B 2017. Brain-derived neurotrophic factor during early growth of hen ovarian follicles. promotes human granulosa-like tumor cell Poultry Sci. 95(1): 108-14. steroidogenesis and proliferation by activating the FSH receptor-mediated signaling pathway. Sci Kuhn HG 2015. Control of cell survival in adult Rep. 7(1): 180. mammalian neurogenesis. Cold Spring Harbor perspectives in biology. 7(12): a018895. Li C and Zhou X 2013. The potential roles of neurotrophins in male reproduction. Reprod. 145(4): 89-95. Linhermelville K and Li J 2013. The roles of glial cell line-derived neurotrophic factor, brain-derived neurotrophic factor and nerve growth factor during the final stage of folliculogenesis: a focus on oocyte maturation. Reprod. 145(2): 43-54. Louie E, Chen XF, Coomes A, Ji K, Tsirka S and Chen EI 2013. Neurotrophin-3 modulates breast cancer cells and the microenvironment to promote the



Original Article Screening antimicrobial properties against mastitis pathogens of turmeric extract after combination with various antiseptics Wasana Chaisri1,2 Noppason Pangprasit1,2 Anyaphat Srithanasuwan1,2 Montira Intanon1,3 Witaya Suriyasathaporn1,2* Abstract The aim of this study was to determine the screening for antimicrobial properties against mastitis pathogens of turmeric extract in combination with various antiseptics. The antibacterial effects of turmeric extract in combination with various antiseptics (5% povidone iodine, 0.5% v/v hydrogen peroxide (H2O2), 0.5% v/v chlorine (Cl2), and 0.5% v/v chlorhexidine) were determined using the agar well diffusion method. Results showed that additional turmeric extract had significantly decreased the antimicrobial activities of either Cl2 or chlorhexidine against almost all mastitis pathogens, except S. agalactiae for Cl2 and gram negative bacteria for chlorhexidine. In contrast, no negative effect was found between turmeric extract and H2O2 against most mastitis pathogens. In addition, a positive antimicrobial effect of turmeric extract and H2O2 against other Streptococcus spp was found. In conclusion, H2O2 was the only antiseptic that can combine with turmeric extract and might support the advantages of the combination to improve wound healing and the antiseptic properties of H2O2 for further development for a future antiseptic product for teat dipping, especially for cows with teat end score damage. Keywords: turmeric extract, antiseptic, mastitis, teat dipping, antibacterial activity 1Research Center of Producing and Development of Products and Innovations for Animal Health, Chiang Mai University, Chiang Mai 50100, Thailand 2Department of Food Animal Clinics, Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai 50100, Thailand 3Department of Veterinary Bioscience and Veterinary Public Health, Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai 50100, Thailand *Correspondence: [email protected] (W. Suriyasathaporn) Thai J Vet Med. 2019. 49(3): 243-248.