TJVM Vol. 49 No. 2 June 2019

148 Kun Z. et al. / Thai J Vet Med. 2019. 49(2): 147-154. Introduction researches of poultry eggshell color. The Leizhou black duck is a famous local duck Materials and Methods distributed in the Leizhou Peninsula of Guangdong Province of China with a high production rate, a large All the animals were maintained and studied in egg weight and a high rate of blue eggshell (Xu et al., accordance with the National Institute of Health (NIH) 2016). The average thickness of egg weight, eggshell, guidelines for the care and use of laboratory animals egg yolk weight, protein height and Haugh unit of blue and all protocols were approved in advance by the shell egg are higher than the parameters of white shell Animal Care Committee of Guangdong Ocean eggs in the Leizhou black duck (Huang, 2016). The University of China (No. NXY20160172). Leizhou black duck does not only show excellent traits in blue shell laying but also blue shell eggs are more Experimental animals: 120 female ducks (BSD 60, WSD nutritious. A study has observed that customers prefer 60) of the same heath, size, weight, nutrition level and blue shell eggs (Dalirsefat, 2015). It has been reported feeding condition were provided by the Hengcheng that the color of the eggshell is related to eggshell Breeding Cooperative (Guangdong, China). All ducks quality (Gervais et al., 2016; Sirri, 2018). Aygun (2014) were transferred to individual cage in a semiconfined found that eggshell color was associated with eggshell house. strength and thickness. A correlation has been shown between eggshell color and the damage rate of eggs RNA isolation and RT-qPCR: Five each of BSD and (Radwan et al., 2015). The eggshell color as an indicator WSD tissues including the uterus, oviduct and liver, to evaluate egg and eggshell quality should be were sampled at 27, 35, 43, 51 and 59 weeks. Total RNA considered important (Kim et al., 2014; Liang et al., from the above tissues was isolated by TRIZON 2017). Reagent kit (TAKARA, Dalian) to explore the expression profile of Leizhou black duck The LOC101800257 is one of the solute carriers LOC101800257. The RNA quality was evaluated by (SLC) organic anion transporter polypeptide (OATP) family members and its encoded protein is OATP-1C1. 1.2% agarose electrophoresis and then was reverse It is a novel solute transporter polypeptide gene of transcribed by Prime Script TMRT reagent Kit with duck based on the research of the chicken blue shell cDNA Eraser (TAKARA, Dalian) to synthetize cDNA. candidate gene SLCO1B3 (Hagenbuch et al., 2004). The cDNA was used as template to amplify the coding According to sequence alignment analysis, the region of the LOC101800257. The RT-qPCR was LOC101800257 perform 70% homology with the SLCO1B3 and SLCO1C1 genes, indicating that they performed according to YBR FSAT qPCR Kit may have similar functions (Law et al., 2004). (TAKARA, Dalian). The reaction procedure of RT- Moreover, LOC101792412, LOC101798111 and qPCR was 94°C, 35s; followed by 40 cycle (94°C, 20s; LOC101800520 genes were not only related to the color formation of duck egg shell, but also participated in the 57°C, 35s; lighting; 72°C, 25s)；95°C, 15s; 60°C, 1 min; regulation of the calcium ion concentration in the calcium channel and affected the strength of egg shell 95°C, 15s. Primers for LOC101800257 and β-actin gene through the transcriptome analysis of the glandular for RT-qPCR were designed by Primer Premier 5.0 tissues of BSD and WSD (Liang, 2017). Wang et al. (Table 1), according to the mRNA sequence (GenBank (2013) found that the insertion of EAV-HP in the accession XM_005023034.1) of the Anas platyrhynchos promoter region of SLCO1B3 gene on chromosome 1 of LOC101800257 and β-actin gene (GenBank accession hens made the SLCO1B3 gene specifically expressed in EF667345.1) published in GenBank. the egg glands of hens, indicating the specific formation mechanism of blue eggshells. Zhao et al. DNA isolation and SNPs screening: The DNA from 120 (2017) detected blue-shell in Dongxiang and White female ducks at 27 weeks was extracted from 1 ml Leghorn chickens potential selected regions (PRS) by blood and was sampled to filter the SNPs of the Eigen GWAS and efficient mixed-model association Leizhou black duck LOC101800257. The 10 primers expedited methods, Gene Ontology and Quantitative (Table 1) were designed by Primer Premier 5.0 to Trait Locus analysis, revealed that there were a large identify the SNPs of LOC101800257, according to number of SLCO1B3 genes in the PRS of Dongxiang complete sequence of LOC101800257 (GenBank chickens. They also found six related amino acids, lipid accession NW_004677350). Randomly the DNA metabolism and signal transduction pathways. A samples from 30 BSD and 30 WSD were selected for study by Xu et al. (2018) analyzed the mRNA and building mixed pools. The PCR amplification was miRNA expression profiles of ducks and found that conducted by the mixed pools as a template to amplify there were 124 differential expressed genes between the exon and intron of LOC101800257. The reaction BSD and WSD, which were involved in ATP-binding system of PCR contained 2 μl cDNA, 1 μl forward cassette and the solute carrier. Currently, the research primer, 1 μl reverse primer, 25 μl Premix Taq on eggshell color mainly focuses on SLCO1B3, (TAKARA, Dalian) and 21 μl double distilled water. SLCO2B1 and SLCO1C1, while the LOC101800257 as a PCR productions were detected by 1% agarose candidate gene for duck eggshell color has less been electrophoresis and then were carried out to purify and documented. Therefore, this study used the Leizhou bi-directional sequence. The results of sequence were black ducks as research materials to explore the analyzed by Chromas and Blast software to screen the relationship between LOC101800257 and eggshell SNPs. color, aiming to provide theoretical basis for the

Kun Z. et al. / Thai J Vet Med. 2019. 49(2): 147-154. 149 Table 1 The primer sequences for this study Gene Primer Primer sequence (5’ to 3’) Fragments size Annealing Application name （bp） Temp (℃) LOC101800257 R1 F:CCGCTGGGTGGGTGAATGGT 175 60 RT-qPCR R:GTATGTGTCTTCCTGATGGCT β-actin R2 F: CGCAAATGCTTCTAAACC 167 60 Internal R:AGACTGCTGCTGATACCTT control P1 F: GAGCCAAACCTTTCCAGTG 372 55 R:GTAATGCCAAATCTTGAATGAG P2 F: CCAGTTTTCCTGTCCCTA 620 54 R: TTTGTTGTCCAGAAGTTGAT P3 F: TTTGTCACTATTCCCCATTCA 450 55 R: CTTTCACTTTACCTCTGCTTCA P4 F: GAAGCATCACTATCACTCCAC 257 60 R: AAAACACTTGCCTTTCATCAT P5 F: ACAACCCAAGGATTAGGC 500 54 Screening R: AGGCTGACACTCTGATGAC P6 F: GGGCTTGTGAGATGGAT 457 54 SNP R: AAGGTCTATGTCTTCTATGCTG P7 F: AGGTCCCACAAAATCCGTT 251 57 R: GGAAAAGTTCAATCATCAGC P8 F: GAGGGTATCCCCGCTTGA 350 55 R: TGACAGACCGAGGAGTTTC P9 F: CTTACTTGCTTGCGTTCCTTT 298 57 R:AGATTTACTACCAGTTTGCCTTTC P10 F: AAAAGTCTCCCTTAGCATTCTCG 265 59 R: AAAAGTCTCCCTTAGCATTCTCG M1 F: ACAAGCCAGGGACATCAGC 255 60 R:TGGTTCTCACAGCCAACAAAA 267 Genotyping M2 F: CAAATGTGCCACCAATGT 55 R: CTATGTCTGCTATGCTGTTCA SNP, single nucleotide polymorphism; F, forward primer; R, reverse primer; RT-qPCR, real-time quantitative Polymerase Chain Reaction; PCR-SSCP for genotyping: According to screening WSD, the BSD had higher expressions than WSD. SNPs loci, the primers (Table 1) about 150~300bp DNA There was a significant difference between BSD and fragments were designed by Primer Premier 5.0. PCR WSD of the expression in the liver (P<0.05) while no amplification was carried out to amplify 150~300bp significant difference was found in the uterus and DNA fragments. PCR productions were detected by oviduct (P>0.05). In addition, there was an extremely 1% agarose electrophoresis and then were genotyped significant difference between the expression in uterus by 10% polyacrylamide gel electrophoresis. The bands and oviduct and expression in the liver between BSD from genotyping were recycled by one lyse plasmid kit and WSD (P<0.01). The results show that (Megen, Guangzhou) and transformed with T-vector LOC101800257 was not involved in major controls in to clone the DNA fragments. Finally, recombinant the uterus and oviduct. Therefore, this study explored plasmids were isolated by one lyse plasmid kit (Megen, the temporal expression pattern of LOC101800257 in Guangzhou). The cloning fragments were sequenced the liver. and analyzed in Blast. This study examined the expression level of BSD Data analysis: This study obtained data statistics of and WSD LOC101800257 in the liver at 27, 35, 43, 51 RT-qPCR whose method was referenced to 2-△△CT. and 59 weeks of experiment which displayed that there The general linear model was used for analyzing the was fluctuation in the general expression level (Figure correlation SSCP genotype of LOC101800257 with the 2). In the BSD group, the highest expression of eggshell color of Leizhou black duck. The linear model LOC101800257 was at 27 weeks (0.385), dropping to the is Yij = μ+G i +e ij (Yij, observation of different lowest at 43 weeks (0.022), and then rising to 59 weeks breeding traits; μ, average value of all population; G i, (0.251). There was an extremely significant difference the effect of each genotype; e ij, random error). between 27 weeks and 43 weeks (P<0.01). In WSD group, the expression of LOC101800257 was 0.085 at 27 Results weeks, declining to the lowest at 43 weeks (0.006) and increasing to the highest at 59 weeks (0.103). There was Expression pattern of LOC101800257 in BSD and a significant difference between 43 weeks and 59 weeks WSD: The tissue expression level at 43 weeks is shown (P<0.05). The temporal expression trends of (Figure 1) due to peak laying days. The results show LOC101800257 in BSD and WSD declined from 27 that LOC101800257 was expressed in most tissues, the weeks to 43 weeks and then increased from 43 weeks highest expression was in the liver, the second to 59 weeks, with 43 weeks as the lowest point. The expression was in the uterus and the lowest expression LOC101800257 expression of BSD was higher than in the oviduct. Comparing the LOC101800257 WSD at 27, 35, 43, 51 and 59 weeks of experiment, expression levels of the same tissues between BSD and which was found by comparing BSD with WSD at Thai J Vet Med. 2019. 49(2): 147-154.

150 Kun Z. et al. / Thai J Vet Med. 2019. 49(2): 147-154. same weeks of experiment. There was a significant groups at 27 weeks and 43 weeks (P<0.05), but no difference in the relative expression between the 2 significant difference at 35, 51 and 59 weeks (P>0.05). Figure 1 The different tissues expression of the LOC101800257 at 43 weeks of the Leizhou black duck. abcd, Values bearing different superscripts significantly differ from each other; BSD, blue shell ducks; WSD, white shell ducks. Figure 2 The temporal expression of the LOC101800257 in the liver of the Leizhou black duck. abcd, Values bearing different superscripts significantly differ from each other; BSD, blue shell ducks; WSD, white shell ducks. Polymorphisms of LOC101800257 gene: There Both SNPs loci had moderate polymorphism were two mutation loci in 13815bp (exon 9) and 15325bp (intron 11) of LOC101800257 (Figure 3), which (0.25<PIC<0.5) and were in the Hardy-Weinberg non- equilibrium state (P<0.01). There existed higher were named c.1406A>G （A→G）and c.1642+16A>G heterozygosity at both SNPs loci, indicating their genetic polymorphisms were abundant (Table 2). （A→G）respectively (Dunnen et al., 2001). Using There was no correlation between the six genotypes 10% polyacrylamide gel electrophoresis and (c.1406A>G: AA, GG, AG; c.1642+16A>G: AA, GG, sequencing, three different band types (AA, GG and AG) of LOC101800257 and eggshell color traits (P>0.05) (Table 3). However, association analysis AG) were detected at c.1406A>G（A→G）and showed that there was a correlation between combinative genotype GGGG and eggshell color c.1642+16A> G (Figure 4, 5, 6). The c.1406A>G caused original encoding amino acid isoleucine (ILe) to (P<0.05) but no correlation between other combinative proline (Val) in the mutation; and the mutated amino genotypes (AAAA, AAAG, AAGG, AGAA, AGAG, acid site was in the MFS region of the protein. The AGGG, GGAA, GGAG) and eggshell color traits c.1642+16A>G located in intron and was a (P>0.05) (Table 3). synonymous mutation. Data statistic: The study obtained heterozygous AG as the dominant type in the c.1406A>G locus, and wild- type AA was dominant type in the c.1642+16 A>G.

Kun Z. et al. / Thai J Vet Med. 2019. 49(2): 147-154. 151 Figure 3 The SNPs in exon 9 and intron11 of LOC101800257 gene. SNP, single nucleotide polymorphism. Figure 4 The sequence of different genotypes in c.1406A>G and c.1642+16A>G of LOC101800257 gene. SNP, single nucleotide polymorphism. Figure 5 The PCR-SSCP pattern of c.1406A>G of LOC101800257 gene. There were 3 different electrophoresis strips in c.1406A>G of LOC101800257 gene. PCR-SSCP, Polymerase Chain Reaction-Single Strand Conformation Polymorphism; P1, genotype AG; P2, genotype GG; P3, genotype AA. Figure 6 The PCR-SSCP pattern of c.1642+16A>G of LOC101800257 gene. There were 3 different electrophoresis strips in c.1642+16A>G of LOC101800257 gene. PCR-SSCP, Polymerase Chain Reaction-Single Strand Conformation Polymorphism; P1, genotype AG; P2, genotype GG; P3, genotype AA. Thai J Vet Med. 2019. 49(2): 147-154.

152 Kun Z. et al. / Thai J Vet Med. 2019. 49(2): 147-154. Figure 7 The multispecies alignment of LOC gene protein sequence. Missense mutation of ILe435Val is indicate by red box. The wild type ILe was homologous to the white-tailed pheasant lepturus, and the mutant Val was homologous to phalacrocorax carbo. Table 2 The allele frequency and genetic polymorphism of LOC101800257 SNP in Leizhou black ducks SNP Genotype and frequency Allele loci frequency Individual χ2 Ho He HO Ne PIC number AG Genotype Frequency c.1406 AA 40 0.333 A>G AG GG 53 0.442 0.554 0.446 1.353 0.506 0.494 0.442 1.977 0.372 27 0.225 c.1642+ AA 57 0.475 16 AG 50 0.417 0.683 0.317 0.166 0.567 0.433 0.417 1.763 0.339 A>G GG 13 0.108 SNP, single nucleotide polymorphism; χ2, Chi-square test; Ho, genetic homozygosity; He, expected heterozygosity; HO, observed heterozygosity; Ne, effective number of alleles; PIC, polymorphism information content. Table 3 The correlation analysis on single SNP and blue eggshell trait SNP loci Genotype Blue eggshell traits P-Value and χ2 BSD number WSD number c.1406A>G AA 19 21 P=0.636 AG 29 24 χ2=0.905 GG 12 15 c.1642+16 AA 25 32 P=0.169 A>G χ2=3.552 AG 30 20 GG 5 8 AAAA 15 18 P=0.728 AAAG 1 3 - AAGG 3 0 - Combination AGAA 8 10 P=0.815 genotypes AGAG 19 13 P=0.377 AGGG 2 1 - GGAA 2 4 P=0.678 GGAG 10 4 P=0.180 GGGG 0 7 P=0.016* SNP, single nucleotide polymorphisms; BSD, blue shell ducks; WSD, white shell ducks; χ2, Chi-square test. -, no statistical significance; *, differ significantly at P≤0.05 level. Discussion Surprisingly, SLCO1C1, SLCO2B1 and SLCO1B3 of the Temporal and tissues expression pattern: The main same family as LOC101800257 can regulate the components of eggshell pigments, including transport of biliverdin in different ways to control the protoporphyrin and biliverdin, are intermediates in the synthesis or metabolism of heme in the body formation of blue eggshells (Wang et al., 2013; Wang et (Wang et al., 2013). It has been reported that OATP1A2, al., 2017; Yu et al., 2016). Therefore, LOC101800257 may OATP1B1 and OATP1B3 are involved in mediating the be involved in the regulation of eggshell color through transport of biliverin on the basolateral membrane of its function in the liver. the liver (Hagenbuch et al., 2010). The formation of blue eggshell regulated by polygene was closely However, temporal expression results showed that interrelated to the transport of biliverdin (Guang et al., 2017). Therefore, the liver is a necessary organ for the the expression trend of LOC101800257 was high-low- formation of blue eggshells. The results from tissues high like a cyclic form from 27 weeks to 59 weeks. The expression showed that LOC101800257 was mainly high expression level of LOC101800257 was at 27 expressed in the liver, and there was significant weeks and 59 weeks and the low expression was at the difference between BSD and WSD (P<0.05). peak period of laying (35, 43, 51 weeks). The results of the temporal expressions of LOC101800257 were inversely correlated with the biliverdin transport. Numerous reports have shown that increase in blue shell eggs is dependent on the increased amount of biliverdin transport (Liu et al., 2009; Badás et al., 2017).

Kun Z. et al. / Thai J Vet Med. 2019. 49(2): 147-154. 153 In other words, the more blue shell eggs, the more the In conclusion, LOC101800257 may be involved in transport of biliverdin, and the higher the expression the regulation of eggshell color through its function in of LOC101800257. In actual production, the color of the the liver, but the function strength may vary at blue shell egg may become lighter with the production different periods. Moreover, the GGGG combined of the blue shell egg increasing (Wang et al., 2013; genotype can serve as a novel genetic marker for David et al., 2013; Zheng et al., 2014). Moreover, the eggshell color, which may have certain significance in function of LOC101800257 may have different the evolution of the Leizhou black duck. strengths at different times. Thus, the expression level of LOC101800257 may be normal, and its specific Acknowledgements regulatory mechanism still needs further research. Nevertheless, it is undeniable that LOC101800257 was The authors are thankful to the Science and involved in the regulation of eggshell color, according Technology Plan Project of Guangdong Province to the differential expression between WSD and BSD. (2017A020208066) and Guangdong Ocean University Liu et al. (2009) proposed that the duck eggshell color Excellent Dissertation Cultivation Project (No. 201610) was observed due to the transport of biliverdin from for providing financial support. Guangdong provincial the liver to the eggshell gland through the bile duct to key platform and major scientific research project the uterus. Therefore, the bile duct as an important (2017KZDXM043), Guangdong Science and channel for transporting biliverdin and other ion in the Technology Plan Project (No.2014A020208123). liver may be an important research object in the future. Conflict of interest: The authors declare that they have Polymorphism and association analysis of eggshell no competing interests. color: LOC101800257 is a member of the SLC family and may be related to the transport of biliverdin. A References study has reported that the expression level of SLC family members is regulated by SNP sites and it plays Aygun A 2014. The relationship between eggshell color an important regulatory role in eggshell color and egg quality traits in table eggs. Indian J Anim formation (Shen et al., 2017). Eggshell color is a micro- Sc Res. 48(3):290-302. effect multi-gene determined quality trait, and this trait is regulated by multiple sites (Liu et al., 2017; Badás, EP, Martínez J and Rivero-De AJ 2017. Eggshell Tuiskulahaavisto et al., 2018). Wang et al., found pigmentation in the blue tit: male quality mutation site g.67419892-67419904del13 of SLCO1C1 matters[J]. Behav Ecol Sociobiol. 71(3):57-71. caused variation of Ala528Glu, and the mutation site significantly correlated with the transport of biliverdin Dalirsefat SB 2015. Analysis of eggshell pigmentation of chickens (Wang et al., 2017). EAV-HP inserted into in the Chinese indigenous blue-shelled chickens startup area of SLCO1B3 caused biliverdin transport [master’s thesis]. Beijing, CN: China Agricultural abnormalities in chickens to form blue shell eggs University. (Wang et al., 2013). The results of this study showed GGGG combined genotype significantly correlates David W, Mwacharo JM, Alcalde JA, Wang C, Han JL with the eggshell color (P<0.05), while other genotypes and Jaime G 2013. Correction: endogenous were not related to the eggshell color (P>0.05). The retrovirus EAV-HP linked to blue egg phenotype in WSD (11.7%) was much higher than BSD (0%) in the mapuche fowl. Plos One. 8(8):e71393. GGGG genotype frequency (P<0.05). The c.1406A>G caused original encoding amino acid isoleucine (ILe) to Dunnen JT and Antonarakis SE 2001. Nomenclature proline (Val) in the mutation; and the mutated amino the description of human sequence variations. acid site is in the MFS region of the protein. A study of Human Genetics. 109(1):121-124. melamine mutation has observed that proline affects the affinity of the GABA receptor complex (Tian et al., Fernandez IB, Calixto LFL, Lemos MJD, Togashi CK, 2013). Whether the mutation site correlates with the Souza DSD and Alves ODS 2018. Feeding time biliverdin transport function remains to be further under performance and eggs quality of quails in studied. The c.1642+16A>G is located in intron but production. Rev Bras Saúde Prod Anim. 19(1):136- there are inducible enhancer actions or expression 143. regulatory elements of mRNA alternative splicing on introns affecting gene expression indirectly (Nott et al., Guang-qi L, Cong-jiao S, Gui-qin W, Feng-ying S, Ai- 2003). Several researches have indicated that, single qiao L and Hao S 2017. Transcriptome sequencing based mutations in introns affect the expression of identifies potential regulatory genes involved in functional genes (Reen et al., 2017). Moreover, chicken eggshell brownness. Hereditas. comparing different species of amino acid sequence of 39(11):1102-1111. LOC genes (solute carrier organic anion transporter family member 1C1-like protein), found that the amino Gervais O, Nirasawa K, Vincenot CE, Nagamine Y and acid sequence of the duck was highly homologous to Moriya K 2016. Long-term selection using a single other birds, but there were many mutations in the trait criterion, non-destructive deformation, in amino acid at the 435th position (Figure 7). The above- White Leghorns: Effect over time on genetic suggested SNPs identified in this study may have an parameters for traits related to egg production. effect on the mutation of LOC101800257 and may have Anim Sci J. 88(2):222-230. certain significance for the evolution of the Leizhou black duck. Hagenbuch B and Meier PJ 2004. Organic anion transporting polypeptides of the OATP/SLC21 family: phylogenetic classification as OATP/SLCO superfamily new nomenclature and molecular/ functional properties. Pflugers Arch. 447(5):653- 665. Huang HG 2016. Study on the features and candidate genes of egg production in the base breeding group Thai J Vet Med. 2019. 49(2): 147-154.

154 Kun Z. et al. / Thai J Vet Med. 2019. 49(2): 147-154. of Leizhou black duck [master’s thesis]. eggshell color in the Jinding duck (Anas Guangdong, CN: Guangdong Ocean University. platyrhynchos). BMC Genomics. 18(1):725-733. Kim EJ, Purswell JL, Evans JD and Branton SL 2014. Wang XT, Zhao CJ, Li JY, Xu GY, Lian LS and Wu CX Production characteristics of Hy-Line W36 laying 2010. Heme oxygenase-1 is important to the hens hatched from white and tinted eggs. Poult Sci. formation of eggshell biliverdin in chicken. J App 93(8):2123-2128. Anim Res. 38(2):229-332. Law CJ, Maloney PC and Wang DN 2008. Ins and outs Xu C, SU Y, Huang H, Cui H, Huang J and Chang Y of major facilitator superfamily antiporters. Annu 2016. Expression and function of embryonic Rev Microbio. 62(2):289-296. skeletal muscle development of leizhou black duck. Liang SY, Wen ZG, Xie M, Huang W, Hou SS and Fu- Biotechnol Bull. 32(9):149-155. Huang LI 2017. Study on quality of mallard eggs Xu FQ, Li A, Lan JJ, Wang YM, Yan MJ and Lian SY and screening of genes related to eggshell strength. 2018. Study of formation of green eggshell color in Chin J Anim Sci. 8(12):112-122. ducks through global gene expression. Plos One. Liu HC, Hsiao MC, Hu YH, Lee SR and Cheng W 2009. 13(1):e0191564. Eggshell pigmentation study in blue-shelled and Yu D 2016. Exploring genetic mechanisms underlying white-shelled ducks. Asian Australas J Anim Sci. eggshell color of duck eggs and relationship 23(2):162-168. between eggshell color and quality [master’s Liu W, Li D, Liu J, Chen S, Qu L and Zheng J 2011. A thesis]. Shanxi, CN: Northwest A & F University. genome-wide snp scan reveals novel loci for egg Zhao Q, Liao RR, Sun H, Zhang Z, Wang QS and Yang production and quality traits in white leghorn and CS 2017. Identifying genetic differences between brown-egg dwarf layers. Plos One. 6(12):e28600. dongxiang blue-shelled and white leghorn Nott A, Meislin SH and Moore MJ 2003. A quantitative chickens using sequencing data. G3. 8(2):469-476. analysis of intron effects on mammalian gene Zheng C, Li Z, Yang N and Ning Z 2014. Quantitative expression. Rna-a Publication of the RNA Society. expression of candidate genes affecting eggshell 9(5):607-617. color. Anim Sci J. 85(5):506-510. Reen JK, Kerekoppa R, Deginal R, Ahirwar MK, Kannegundla U and Chandra S 2017. Luteinizing hormone beta gene polymorphism and its effect on semen quality traits and luteinizing hormone concentrations in Murrah buffalo bulls. Asian Australas J Anim Sci. 9(2): 236-243. Radwan LM, Galal A and Shemeis AR 2015. Prediction of eggshell ultrastructure via some non-destructive and destructive measurements in fayoumi breed. Asian Australas J Anim Sci. 28(7):993-998. Shen J, Zheng CW, Pan AL, Liang ZH, Yan WU and Jin- Ping DU 2017. Study on pigments of eggshell color and candidate genes analysis of jianghan chicken. Hubei Agri Sci. 23(12):526-532. Sirri F, Zampiga M, Berardinelli A and Meluzzi A 2018. Variability and interaction of some egg physical and eggshell quality attributes during the entire laying hen cycle. Poult Sci. 97(5):1818-1823. Tian M, Mei D, Freri E, Hernandez CC, Granata T and Shen W 2013. Impaired surface αβγ GABA(A) receptor expression in familial epilepsy due to a GABRG2 frameshift mutation. Neurobiol Dis. 50(2):135-141. Tuiskulahaavisto M, Honkatukia M, Dunn IC, Bain MM, De DK and Preisinger R 2018. Validated quantitative trait loci for eggshell quality in experimental and commercial laying hens. Anim Genet. 49(4):329-333. Wang Z, Qu L, Yao J, Yang X, Li G and Zhang Y 2013. An EAV-HP insertion in 5′ flanking region of slco1b3 causes blue eggshell in the chicken. Plos Genetics. 9(1):e1003183. Wang ZP, Liu RF, Wang AR, Min YN, Gao YP and Liu FZ 2013. Relationship of SLCO1C1 gene and formation of chicken blue-shelled egg. J Northwest A & F University. 9(12):53-61. Wang Z, Meng G, Bai Y, Liu R, Du Y and Su L 2017. Comparative transcriptome analysis provides clues to molecular mechanisms underlying blue-green

Original Article Identification of blood meal from field collected filarial vector mosquitoes, Armigeres subalbatus by multiplex PCR Rungfar Boonserm1 Ratchadaporn Jantorn2 Atchara Phumee1,3 Sriwatapron Sor-suwan1 Narissara Jariyapan4 Sonthaya Tiawsirisup5 Padet Siriyasatien1* Abstract Mosquitoes act as vectors of many diseases affecting humans and animal health, including Zika, malaria, dengue, chikungunya, viral encephalitis, and filariasis. One of the best strategies to control these vector- borne diseases is to control the mosquito vectors. Female mosquitoes require a blood source for egg development. As female mosquitoes take blood meals pathogens are released into the vertebrate host. Identification of the types of vertebrate blood sucked by the mosquito is essential information required to develop an effective strategy to control the mosquito populations and the related mosquito borne diseases. Objective of this study was to identify types of mammal blood in Armigeres subalbatus mosquito, the principal vector of filarial parasites especially Dirofilaria spp. . A total of 210 female Ar. subalbatus mosquitoes were collected from different place of Sai Kaew beaches, Samed Island, Rayong province, eastern Thailand. The blood meals of Ar. subalbatus were identified using multiplex PCR specific primers on mitochondrial cytochrome b gene. The result showed that 74 samples of Ar. subalbatus blood meals was positive for human (17.14%), pig ( 5. 24% ) , cow ( 2. 38% ) , dog ( 0. 48% ) , and other mammals blood ( 10% ) . The 136 samples of negative detection by multiplex PCR were also positive 2 ( 0. 95%) samples of avian blood, but 134 ( 63. 81%) samples were not detected for vertebrate blood meal DNA. The benefits of this study are to understand the natural feeding behavior of Ar. subalbatus mosquitoes. Information obtained from the study would be applied to develop the effective control strategies for Ar. subalbatus and may provide indirect data suggesting what reservoirs are significant in the mosquito-borne diseases. Keywords: Armigeres subalbatus, Mosquito, blood meal, Multiplex PCR 1Vector Biology and Vector Borne Diseases Research Unit, Department of Parasitology, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand 2Central laboratory, Ratchaphiphat hospital, Bangkok, Thailand 3Thai Red Cross Emerging Infectious Disease-Health Science Centre, World Health Organization Collaborating Centre for Research and Training on Viral Zoonoses, Chulalongkorn Hospital, Bangkok, Thailand 4Department of Parasitology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand 5Veterinary Parasitology Unit, Department of Veterinary Pathology, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailand *Correspondence: [email protected] (P. Siriyasatien) Thai J Vet Med. 2019. 49(2): 155-160.

156 Boonserm R. et al. / Thai J Vet Med. 2019. 49(2): 155-160. Introduction sent to the Vector Biology and Vector Borne Diseases Research Unit, Department of Parasitology, Faculty of Mosquitoes are vectors for many pathogens of Medicine, Chulalongkorn University. medical and veterinary importance (Sanchez-Vargas et al., 2004). Female mosquitoes need a blood meal for egg DNA extraction: Two hundred microliter of human reproduction. The female mosquito can also transmit (Homo sapiens), dog (Canis familiaris), cow (Bos tarsus), pathogens into the human or animal host whilst taking pig (Sus scrofa), and chicken (Gallus domesticus) blood a blood meal (Foster, 1995). Identification of the blood samples, and individual female Ar. subalbatus meal from mosquitoes provides information on host mosquito samples were transferred into 1.5 ml feeding patterns and preference of mosquitoes in microcentrifuge tubes containing 400 μl of lysis buffer. nature. In addition, it may assist in understanding Ar. subalbatus mosquito samples were ground with indirect data to determine the reservoir hosts for any sterile plastic pestles prior to DNA extraction vector-borne diseases (Edman and Taylor, 1968; processes. Samples were then processed for total DNA Edman, 1971; Edman et al., 1972; Lee et al., 2002). extraction by a tissue DNA extraction kit (Invisorb® Several studies demonstrated mosquito blood meals Spin Tissue Mini Kit, Invitek, Germany) according to using different methods including serologic techniques the manufacturer’s instructions. DNA was eluted in 80 such as the latex agglutination (Boorman et al., 1977), μl of elution buffer; quantity and quality were enzyme-linked immunosorbent assay (ELISA) (Beier et determined by a Nanodrop 2000c apparatus (Thermo al., 1988) and precipitin test (Gomes et al., 2001). Scientific, USA). The genomic DNA was stored for an However, these techniques have low sensitivity, are extended time at -80°C for long-term storage. time-consuming and cross-reactions also occur. Nowadays, molecular techniques have been developed Multiplex-PCR: Multiplex-PCR amplification was for detection of blood meal in haematophagous insects used to detect mammal DNA, the reactions were such as multiplex polymerase chain reaction (PCR) in performed in PCR Mastercycler® pro (Eppendorf, mosquitoes (Kent and Norris, 2005) and real-time PCR Germany) under the following conditions: in the phlebotomine sand fly (Sales et al., 2015). In this denaturation at 95 °C for 5 min, followed by 40 cycles study, we were interested in identifying blood meals of of 95°C for 1 min, annealing at 58°C for 1 min; and field caught Ar. subalbatus collected from a tourist extension at 72°C for 1 min, with the final extension at attractant island of eastern Thailand. Ar. subalbatus is 72°C for 7 min. The forward and reverse primers are known to be a vector of filarial heart worm, Dirofilaria described in Table 1. immitis in dog (Cheong et al., 1981), Wuchereria bancrofti (Das et al., 1983), Japanese encephalitis (Liu et al., 2013), PCR was used to detect avian blood, with the Brugia pahangi (Muslim et al., 2013) and most recently conditions as follow conditions: initial denaturation at Zika virus was detected in this mosquito species 93°C for 5 min, followed by 35 cycles of denaturation (Tawatsin et al., 2018). Ar. subalbatus is commonly 93°C for 1 min, annealing at 50°C for 1 min, and extension at 72°C for 1 min, and a final extension after found in early morning and night biting mosquito and the last cycle at 72°C for 7 min the method was feeds on both human and animals (Srinivas et al, 1994). modified from Cicero and Johnson (2001). The However, little is known about the prevalence and products were analyzed by 1.5% agarose gel type of vertebrate blood feeding of Ar. subalbatus. electrophoresis, stained with 0.5 µg/ml ethidium bromide and visualized with Quantity One Therefore, this study presented blood meal type from quantification analysis software, version 4.5.2 Gel Doc field collected filarial vector mosquitoes, Ar. subalbatus EQ system (Bio-Rad, USA). by multiplex-PCR based on mitochondrial cytochrome b (CytB) gene. Results Materials and Methods A multiplex polymerase chain reaction (PCR) base on CytB gene was used to identify host blood meals Mosquito collection: The study was approved by from field-collected Ar. subalbatus mosquitoes. First of Institutional Animal Care and Use Committees of the all, we screened the mammal’s blood meal DNA in Ar. Faculty of Medicine, Chulalongkorn University, subalbatus using the primer UNFOR403 and Bangkok, Thailand (COA no. 006/2015). The mosquito UNREV1025. The result revealed that 74 of 210 samples were collected from different location on the mosquitoes showed apparent DNA in the blood meal Sai Kaew beaches, Samed Island, Rayong province (Figure 1B). Among the 74 samples, for 36 (17.14%), 11 using CDC light traps (25-W bulb) without CO2 during (5.24%), 5 (2.38%), 1 (0.48%), and 21(10%) were positive November 20-22, 2015 for 3 nights. The 10 traps were with human, pig, cow, dog, and other mammals blood placed around human settlements, open space, rock DNA, respectively (Figure 1A). For avian blood holes, bamboo trees, and small forests overnight from detection, we found 2 of 210 positive samples by using 6.00 pm to 6.00 am. Ar. subalbatus were collected from specific primers (L15557 and H16065) (Figure 1C, Table the light traps the following day and anesthetized 2). Ar. subalbatus detected the types of vertebrate blood, using chloroform-soaked cotton balls. The mosquitoes which the most is human, other mammals, pig, cow, were morphologically identified using taxonomic key dog, and avian, respectively. (Barraund. 1934; Christophers. 1993; Darsie and Pradhan 1990). All Ar. subalbatus mosquitoes were differentiated according to their gender. After identification the mosquitoes were stored in microcentrifuge tubes, in a box containing dry ice and

Boonserm R. et al. / Thai J Vet Med. 2019. 49(2): 155-160. 157 Table 1 Sequences of specific primers used for PCR amplification Primer 5’- 3’ sequence Target host Product size References (bp) Human741F GGCTTACTTCTCTTCATTCTCTCCT Human 334 Kent and Pig573F CCTCGCAGCCGTACATCTC Pig 453 Norris, 2005 Cow121F CATCGGCACAAATTTAGTCG Cow 561 Dog368F GGAATTGTACTATTATTCGCAACCAT Dog 680 Cicero and UNFOR403 TGAGGACAAATATCATTCTGAGG Johnson, 2001. UNREV1025 GGTTGTCCTCCAATTCATGTTA Other 623 L15557 GACTGTGACAAAATCCC[A/G/C/T]TTCCA mammals H16065 GGTCTTCATCT[C/T][A/T/C]GG[C/T]TTACAAGAC - Avian 508 - Table 2 The number and percentages of blood meal identification in Ar. subalbatus mosquitoes by using multiplex PCR Blood Human Mammals [n (%)] Dog Other Avian Not detected type 36 (17.14) Pig Cow mammals [n (%)] 134 (63.81) 11 (5.24) 5 (2.38) 1 (0.48) 21 (10) 2 (0.95) Total 74 (35.24) 2 (0.95) 134 (63.81) Figure 1 PCR amplification of CytB gene against Human’s blood, Pig’ blood, Cow’ blood, Dog’ blood DNA (A), Mammals’ blood DNA (B), and Chicken’ blood DNA (C) from Ar. subalbatus. PCR products were analyzed by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide. Lane D, C, P, and H: Dog’ blood, Cow’ blood, Pig’ blood, and Human’s blood, respectively, lane S1-S7, S36-S38 and S64: Ar. subalbatus sample, lane M: molecular mass marker (100 basepairs [bp]), lane P: positive control, lane N: negative control (no DNA template: double-distilled water)

158 Boonserm R. et al. / Thai J Vet Med. 2019. 49(2): 155-160. Discussion during first round PCR amplification, but re- amplification PCR showed 16% of PCR products had The blood meal source of hematophagous visible band. Re- amplification was required because arthropods such as mosquitoes, ticks, stable flies, sand the host DNA was at low concentration in the source flies, and black flies have been detected by serological extraction. However, no positive band was found with technique and molecular technique ( Washino and re-amplification PCR. The Ar. subalbatus samples were Tempelis, 1983; Kirstein and Gray, 1996; Pitzer et al. , collected outside near human residence. Therefore, our 2011; Sant’ Anna et al. , 2008; Hunter and Bayly, 1991) . preliminary data revealed that most of the vertebrate Washino and Tempelis (1983) revealed that eight blood type detected was human, other mammals, pig, serological techniques: have been used to identify cow, dog, and avian, respectively. No co- blood meal blood meal of mosquitoes, Ring test, Precipitin test, feeding was present in this study. The previous study Agar gel diffusion, Microplate, Gel surface precipitin in Thailand by Khaklang and Kittayapong (2014) test, Fluorescent antibody technique FA) , Passive investigated blood meals of Armigeres spp. collected hemagglutination inhibition technique (PHI) , and from a tourist island, Koh Chang, Thailand. Using by Enzyme- linked immunosorbent assay (ELISA) . ELISA technique it was determined vertebrate hosts However, the predominant serological methods were were dog ( 50% ) and mixed human & monkey ( 50% ) . precipitin test and ELISA techniques. Moreover, the Ar. subalbatus from rural areas of Southern Tamil molecular techniques have been used to detect a blood Nadu, India showed a host preference for humans meal source of vector- borne disease mosquitoes, (93.33%) and cows (6.66%) using double-gel diffusion especially, Anopheles spp. , Culex spp. , and Aedes spp. tests ( DGD) ( Wilson and Sevarkodiyone, 2015) . (Kent, 2009). Recently, MALDI-TOF/MS technique has However, our study was found human, dog, and cow been used to detect blood source of blood- feeding DNA from Ar. subalbatus was 17.14%, 2.38%, and 0.4%, arthropods because this technique can detect specific respectively, detected by multiplex-PCR. The reasons species ( Niare et al. , 2016) . In the advent of molecular were suspected that the detection of blood meal may techniques, several molecular techniques have been be non- detection of blood meal in the mosquitoes. used to identify blood meal in some arthropods. These Moreover, the sample size of this study was quite low techniques are more specific species to identify the in number and taken from a small area. To increase the blood source in arthropods when compared to accuracy of blood patterns in Ar. subalbatus, a larger serological technique. Moreover, for the time course of sample size and several regions might be needed. detection, the serological technique can be detected of blood meal source of mosquitoes specimen up to 48 Several reports showed that Ar. subalbatus has been hours when stored at room temperature (Washino and mentioned as a vector of animal filariasis in Southeast Tempelis, 1983) while, MALDI-TOF/MS technique can Asia and it is suspected for a potential vector of W. be detected within 24 hours (Niare et al., 2016; Tandina bancrofti and Zika in Thailand (Cheong et al., 1981; Das et al., 2018) but molecular technique can be detected up et al. , 1983; Liu et al. , 2013; Muslim et al. , 2013; to 96 hours at the same condition ( Kent and Norris, Thongsripong et al., 2013; Tawatsin et al., 2018). Recent 2005; Siriyasatien et al., 2010). Therefore, this study was report of ocular dirofilariasis in a Thai patient who focused on blood meal identification of Ar. sulbabatus reside in Bangkok, Thailand, the capital of the country by using multiplex-PCR, due to the sensitivity and has been documented ( Sukudom et al. , 2018) . In this specificity described previously. study, we found human DNA is the most detected in this mosquito species. Therefore, this report is Previous studies of blood meal identification by increasing the awareness of Ar. subalbatus as a potential using ELISA technique of Ar. subalbatus have been of vector for disease transmission to human. Moreover, reported in India and Thailand. The results revealed the human behavior has been changed such as that preference host of Ar. subalbatus in India were traveling into forest areas for holidays, this would also human (93.33%) and cow (6.66%) respectively (Wilson increasing the potential risk of disease caused by a and Sevarkodiyone, 2015) . Similar to previous results close contact between human and wild animals which in Thailand, showed that mixed human-monkey blood would transmitted by Ar. subalbatus mosquitoes. (50%) and dog blood (50%) respectively (Khaklang and Kittayapong, 2014). In conclusion, blood feeding pattern of Ar. subalbatus investigated by the molecular techniques This is the first study of using the molecular showed that they prefer to feed on humans more than techniques to identify blood meal of Ar. subalbatus in animal. The results indicated that they are more Thailand. In the present study, we used multiplex-PCR anthropophilic mosquito. Several pathogens have been assays for the identification of Ar. subalbatus blood found in Ar. subalbatus mosquitoes. The present study meals. This assays can detect even a low level of host provides data for the future study of diseases DNA in field- collected females stored at - 20°C. There transmitted by Ar. subalbatus mosquito and, therefore, are reports that important factors such as the the vector control strategies of some diseases especially environment of mosquito collection, digestion of the those diseases transmitted by Ar. subalbatus mosquito blood meal, storage conditions of samples after field should be re-evaluated. collection, and the methods used for detection and identification affect the detection of blood source in Competing interests: The authors declare that they mosquitoes (Santos et al., 2019). Molecular techniques have no competing interests. can show false negatives when detecting the host of individual blood- fed mosquitoes because host DNA concentrations may be insufficient for detection. Kent and Norris ( 2005) suggested that blood meals failed

Boonserm R. et al. / Thai J Vet Med. 2019. 49(2): 155-160. 159 Acknowledgements fluviatilis (Lutz) mosquitoes experimentally fed on feline, canine and human hosts. Mem Inst Oswaldo This study was supported by the National Research Cruz. 96: 693–695. Hunter FF and Bayly R 1991. ELISA for identification Council of. Thailand (NRCT) and Faculty of Medicine, of blood meal source in black flies (Diptera: Simuliidae). J Med Entomol. 28(4): 527-532. Chulalongkorn University (grant No: Khaklang S and Kittayapong P 2014. Species composition and blood meal analysis of GRB_APS_11_59_30_10), National Science and mosquitoes collected from a tourist island, Koh Chang, Thailand. J Vector Ecol. 39: 448-452. Technology Development Agency (Thailand) and Kent RJ and Norris DE 2005. Identification of mammalian blood meals in mosquitoes by a Health Systems Research Institute (Grant No. 61-003), multiplexed polymerase chain reaction targeting cytochrome B. Am J Trop Med Hyg. 73(2): 336-342. and the World Health Organization Thailand (WHO- Kent RJ 2009. Molecular methods for arthropod bloodmeal identification and applications to Thailand) and the United States Agency for ecological and vector-borne disease studies. Mol Ecol Resour. 9(1): 4-18. doi: 10.1111/j.1755- International Development (USAID) grant.. 0998.2008.02469.x. Kirstein F, Gray JS 1996. A molecular marker for the References identification of the zoonotic reservoirs of Lyme borreliosis by analysis of the blood meal in its Barraud PJ 1934. Family Culicidae. Tribes Megarhinini European vector Ixodes ricinus. Appl Environ and Culicini. The fauna of British India, including Microbiol. 62: 4060–4065. Ceylon and Burma. Diptera Vol. V, 473 pp. London. Lee JH, Hassan H, Hill G, Cupp EW, Higazi TB, Mitchell CJ, Godsey MS Jr and Unnasch TR 2002. Beier JC, Perkins PV, Wirtz RA, Koros J, Diggs D, Identification of mosquito avian-derived blood Gargan TP and Koech DK 1988. Blood meal meals by polymerase chain reaction-heteroduplex identification by direct enzyme-linked analysis. Am J Trop Med Hyg. 66(5): 599-604. immunosorbent assay (ELISA), tested on Anopheles Liu H, Lu HJ, Liu ZJ, Jing J, Ren JQ, Liu YY, Lu F and (Diptera: Culicidae) in Kenya. J Med Entomol. 25: Jin NY 2013. Japanese encephalitis virus in 9–16. mosquitoes and swine in Yunnan province, China 2009–2010. Vector Borne Zoonotic Dis. 13: 41-49. Boorman J, Mellor PS, Boreham PFL and Hewett RS Muslim A, Fong MY, Mahmud R, Lau YL and 1977. A latex agglutination test for the Sivanandam S 2013. Armigeres subalbatus identification of blood-meals of Culicoides (Diptera: incriminated as a vector of zoonotic Brugia pahangi Ceratopogonidae). Bull Entomol Res. 67: 305–311. filariasis in suburban Kuala Lumpur, Peninsular Malaysia. Parasit Vectors. 6: 219. Cheong WH, Mak JW, Naidu S and Mahadevan S 1981. Niare S, Berenger JM, Dieme C, Doumbo O, Raoult D, Armigeres subalbatus incriminated as an important Parola P and Almeras L 2016. Identification of vector of the dog heartworm Dirofilaria immitis and blood meal sources in the main African malaria the bird Cardiofilaria in urban Kuala Lumpur. mosquito vector by MALDI-TOF MS. Malar J. 15: Southeast Asian J Trop Med Public Health. 12: 611– 87. doi: 10.1186/s12936-016-1152-6. 612. Pitzer JB, Kaufman PE, Tenbroeck SH and Maruniak JE 2011. Host blood meal identification by multiplex Christophers SR 1933. Family Culicidae. Tribe polymerase chain reaction for dispersal evidence of Anophelini. The fauna of British India, including stable flies (Diptera: Muscidae) between livestock Ceylon and Burma. Diptera Vol. IV, 371 pp. facilities. J Med Entomol. 48(1): 53-60. London. Sales KG, Costa PL, de Morais RC, Otranto D, Brandão- Filho SP, Cavalcanti Mde P and Dantas-Torres F Das P, Bhattacharya S, Palit CA, Das S, Ghosh KK and 2015. Identification of phlebotomine sand fly blood Hati AK 1983. Diurnal man-biting activity of meals by real-time PCR. Parasit Vectors. 8: 230. doi: Armigeres subalbatus (Coquillet, 1898) in a village in 10.1186/s13071-015-0840-3. West Bengal. Indian J Med Res. 78: 794–798. Sanchez-Vargas I, Travanty EA, Keene KM, Franz AW, Beaty BJ, Blair CD, Olson KE 2004. RNA Edman JD and Taylor DJ 1968. Culex nigripalpus: interference, arthropod-borne viruses, and seasonal shift in bird-mammal feeding ratio in a mosquitoes. Virus Res. 102: 65-74. mosquito vector of encephalitis. Science. 161: 67– Sant’Anna MR, Jones NG, Hindley JA, Mendes-Sousa 68. AF, Dillon RJ 2008. Cavalcante RR, Alexander B and Bates PA. Blood meal identification and Edman JD 1971. Host-feeding patterns of Florida parasite detection in laboratory-fed and field- mosquitoes. I. Aedes, Anopheles, Coquillettidia, captured Lutzomyia longipalpis by PCR using FTA Mansonia and Psorophora. J Med Entomol. 8: 687– databasing paper. Acta Trop. 107(3): 230–237. 695. Santos CS, Pie MR, da Rocha TC, Navarro-Silva MA 2019. Molecular identification of blood meals in Edman JD, Webber LA and Kale HW 1972. Host- feeding patterns of Florida mosquitoes. II. Culiseta. J Med Entomol. 9: 429–434. Foster WA 1995. Mosquito sugar feeding and reproductive energetics. Annu Rev Entomol. 40: 443-474. Cicero C and Johnson NK 2001. Higher-level phylogeny of new world vireos (aves: vireonidae) based on sequences of multiple mitochondrial DNA genes. Mol Phylogen Evol. 20: 27-40. Darsie RF and Pradhan SP 1990. The mosquitoes of Nepal: Their identification, distribution and biology. Mosquito Syst, 22(2): 69-130. Gomes LA, Duarte R, Lima DC, Diniz BS, Serrão ML and Labarthe N 2001. Comparison between precipitin and ELISA tests in the bloodmeal detection of Aedes aegypti (Linnaeus) and Aedes

15608 Boonserm R. et al. / Thai J Vet Med. 2019. 49(2): 155-160. mosquitoes (Diptera, Culicidae) in urban and forested habitats in southern Brazil. PLoS One. 14(2):e0212517. doi: 10.1371/journal.pone.0212517. Siriyasatien P, Pengsakul T, Kittichai V, Phumee A, Kaewsaitiam S, Thavara U, Tawatsin A, Asavadachanukorn P and Mulla MS 2010. Identification of blood meal of field caught Aedes aegypti (L.) by multiplex-PCR. Southeast Asian J Trop Med Public Health. 41(1): 43-47. Srinivas SD, Pandian RS and Dwarakanath SK 1994. Biting behaviour of Armigeres subalbatus (Coquillett) with reference to host selection and landing. Indian J Exp Biol. 32: 348-350. Sukudom P, Phumee A and Siriyasatien P 2018. First report on subconjunctival dirofilariasis in Thailand caused by a Dirofilaria sp. closely related to D. hongkongensis. Academia Journal of Scientific Research. 6(3): 114-116. doi: 10.15413/ajsr.2017 .0179. Tandina F, Laroche M, Davoust B, K Doumbo O and Parola P 2018. Blood meal identification in the cryptic species Anopheles gambiae and Anopheles coluzzii using MALDI-TOF MS. Parasite. 25: 40. doi: 10.1051/parasite/2018041. Epub 2018 Jul 27. Tawatsin A, Phumee A, Thavara U, Sirisopa P, Ritthison W, Thammakosol K, Intayot P, Joyjinda Y, Wacharapluesadee S, Hemachudha T and Siriyasatien P 2018. High infection rate of Zika virus in mosquitoes collected from an area of active Zika virus transmission of eastern Thailand. Thai J Vet Med. 48(8): 551-558. Thongsripong P, Green A, Kittayapong P, Kapan D, Wilcox B and Bennett S 2013. Mosquito vector diversity across habitats in central Thailand endemic for dengue and other arthropod-borne diseases. PLoS Negl Trop Dis. 31; 7: e2507. doi:10.1371/journal.pntd.0002507. Washino RK and Tempelis CH 1983. Mosquito host blood meal identification: methodology and data analysis. Annu Rev Entomol. 28: 179-201. Wilson JJ and Sevarkodiyone SP 2015. Host preference of blood feeding mosquitoes in rural areas of southern Tamil Nadu, India. Acad J Entomol 8: 80- 83.

Original Article A monitoring report for Salmonella spp. in an HACCP standard pig slaughterhouse Xin Wu1 Sunpetch Angkititrakul1 Teerarat Prasertsee2,3 Nalita Adsanychan1,4 Fanan Suksawat1,5* Abstract To monitor the prevalence of Salmonella spp. in a Hazard Analysis and Critical Control Point (HACCP) standard pork slaughterhouse, a comprehensive inspection of an HACCP slaughterhouse was carried out. One hundred and eighty pairs of fecal and pork samples (n=360) and 65 pairs of important hygiene samples from the before and after working area (n=130) were collected, isolated and serotype identified, in an HACCP standard slaughterhouse in northeast Thailand. These isolates were then antimicrobial susceptibility tested against ampicillin, ciprofloxacin, chloramphenicol, nalidixic acid, streptomycin, tetracycline, sulfamethoxazole/trimethoprim, and colistin. As a result, there were 61.11% Salmonella spp. isolated from total fecal samples (110/180), 12.78% of pork (23/180) and 6.15% from hygiene test (8/130), and the most common antimicrobial resistance was against ampicillin, streptomycin, and tetracycline. The PFGE result shows the Salmonella isolates of pork were contaminated from their own farm, and these dominant isolates can be sorted into 3 major sources with high similarity. Furthermore, nine fecal and ten pork Salmonella spp. isolates shared the same serotype and PFGE pattern in the paired samples of the dual positive fecal and carcass isolates from the total 180 pairs. The relativity rate of Salmonella spp. isolates from feces to pork was 5.00% (9 pairs of 180 pairs). In conclusion, there is a low rate of Salmonella spp. from farm via direct slaughter contamination, and the most reported cases could be from cross-contamination during the next process of transporting and storage. More work should be carried out focusing on improving meat production, transportation, and storage. Keywords: Salmonella spp., Hazard Analysis and Critical Control Point, pig slaughterhouse 1Research Group for Animal Health Technology, Faculty of Veterinary Medicine, Khon Kaen University, 40002, Khon Kaen, Thailand. 2Graduate Program in Veterinary Science, Faculty of Veterinary Medicine, Chiang Mai University, 50100, Chiang Mai, Thailand 3Integrative Research Center for Veterinary Preventive Medicine, Faculty of Veterinary Medicine, Chiang Mai University, 50100, Chiang Mai, Thailand 4Faculty of Agriculture, National University of Laos, 7322, Vientiane, Lao PDR 5Research and Diagnostic Center for Emerging Infectious Diseases, Khon Kaen University, 40002, Khon Kaen, Thailand *Correspondence: [email protected] (F. Suksawat) Thai J Vet Med. 2019. 49(2): 161-165.

162 Wu X. et al. / Thai J Vet Med. 2019. 49(2): 161-165. Introduction Salmonella isolation: All samples were isolated and identified for Salmonella spp., following the ISO Salmonella spp. is the most common and standard 6579-1:2002 (ISO, 2002). The positive threatening pathogenic bacteria to human beings, Salmonella spp. colonies were further sent to the WHO which can lead to salmonellosis. The non-typhoidal National Salmonella and Shigella Center for serotype Salmonella enterica results in the highest burden of all identification. the foodborne diseases, causing 4.07 million disability- adjusted life years (Kirk et al., 2015). The data from the Antimicrobial susceptibility test: The Salmonella spp. World Health Organization show that there are isolates were examined for antimicrobial susceptibility approximately 11,800 non-typhoidal Salmonella against ampicillin (AMP) 10 μg, ciprofloxacin (CIP) 5 enterica cases per 100,000 persons in the world. Human μg, chloramphenicol (C) 30 μg, nalidixic acid (NA) 30 outbreaks are caused by consuming incompetently μg, streptomycin (S) 10 μg, cooked meat mostly, while pork is one of the most sulfamethoxazole/trimethoprim (SXT) 25 μg, popular meats (EFSA et al., 2017). And 95% of all cases tetracycline (TE) 30 μg and colistin (CT) 10 μg, of salmonellosis are caused by contaminated animal following the Clinical and Laboratory Standards products (Foley et al., 2008). Institute guidelines (CLSI, 2014). The Hazard Analysis and Critical Control Point Genetic relatedness test: The predominant isolates, the (HACCP) program was introduced to produce safe positive paired sample units and some related isolates meat products for consumers. HACCP is a were tested by pulsed field gel electrophoresis (PFGE), management system to provide safe meat products by following the CDC standard (Control & Prevention, controlling the biological, chemical, and physical 2013). The 'positive paired sample units' means the hazards of meat, though monitoring and organizing paired fecal and pork samples which share the same the whole procedure. This management system was serotype. The DNA fragments were separated by a accepted after the USDA’s Food Safety and Inspection CHEF-DRⅢ Pulsed-Field Electrophoresis System. The Service (FSIS) announced the rule in 1996 for chicken gel was stained with ethidium bromide and products. After that, there were 190,000 cases less over documented by ChemiDocTM XRS+ (Bio-Rad). The 1996-2000 (Williams & Ebel, 2012), and little affliction dendrograms were produced using the band cluster afterwards (Ollinger et al., 2017). method by BioNumerics version 7.6.3 HACCP is not a perfect system to stop all of the Data analysis: The fecal and pork positive isolates spread of Salmonella spp. after slaughtering, even were compared, in which relativity results were though it is the best one for now. Systematic reviews analyzed by Calculate and Draw Custom Venn (Wilhelm et al., 2011) from 14 studies of evaluating the Diagrams online (Ghent University, 2018). effectiveness from beef, pork and poultry HACCP abattoirs were carried out, and most of the studies Results reported positive Salmonella spp. outcome, which indicates multiple factors that would contribute to There were 61.11% Salmonella spp. isolated from contaminated meat production in the HACCP total fecal samples (110/180), 12.78% from pork procedure. To assess the efficiency of the HACCP (23/180) and 6.15% from hygiene tests (8/130) in one system in the quality of pork production, and obtain slaughterhouse. The predominant serotypes identified more detailed information about the production in feces were Enterica type I 1,4,[5],12:i:- (50.00%), process, a comprehensive inspection of a pork HACCP Rissen (13.64%), Kedougou (12.73%), Enterica 4,12:-:- slaughterhouse was performed. The fecal and carcass (9.09%) and Bovismorbificans (8.18%); in pork they samples of the slaughter process were monitored in were Enterica type I 1,4,[5],12:i:- (60.87%) and Enterica pairs, while hygiene samples before and after work 4,12:-:- (34.78%); while in the hygiene test there was were taken as well. Enterica type I 1,4,[5],12:i:- (75.00%) (Table 1). Materials and Methods These Salmonella isolates were then tested against 8 antimicrobial agents. The positive isolates from feces Sample collection: One hundred and eighty fecal and were resistant to AMP (76.36%), C (11.82%), S (60.00%), 180 pork samples were collected in pairs (n=360) from SXT (17.27%) and TE (85.45%), the positive Salmonella an HACCP standard slaughterhouse in northeast spp. from pork were resistant to AMP (95.65%), S Thailand, and 30 pairs each time from 6 farms. (95.65%) and TE (95.65%), while those from the Additionally, 65 pairs from 5 important hygiene zones hygiene test were resistant to AMP (37.50%), S from before and after working areas (n=130) were (25.00%), SXT (12.50%) and TE (87.50%) (Table 2). In tested. These 5 zones included 9 points in the personal summary, the most common resistance was similar to hygiene semi-clean zone, 11 points in the personal the prevalence in the north of Thailand, AMP (53%), S hygiene clean zone, 15 points in the equipment clean (44%) and TE (53%) (Patchanee et al., 2016). zone, 16 points in the machine clean zone and 14 in the equipment unclean zone. The fecal samples were Twenty one Salmonella Typhimurium and collected by sterile rectal swab, the carcass samples Typhimurium variant isolates were selected and were collected by sterile swab covering a 600 cm2 area analyzed by PFGE (monophasic variants of S. of each carcass, and for the hygiene-test samples were Typhimurium grouped by the European Food Safety collected by wiping over a 25 cm2 area of the target. The Authority (Authority et al., 2017). The PFGE result procedures have been approved by the Institutional shows the Salmonella isolates of pork were Animal Care and Use Committee of Khon Kaen University, ID: IACUC-KKU-13/62.

Wu X. et al. / Thai J Vet Med. 2019. 49(2): 161-165. 163 contaminated from their own farm. Moreover, these sorted into three clusters and keep a high level of Typhimurium and Typhimurium variants can be similarity (Figure 2). Table 1 Serotypes of Salmonella spp. isolated from an HACCP pig slaughterhouse Source No. of isolates (%) Serotypes (Number of isolates) Feces 110 (61.11) Enterica type I 1,4,[5],12:i:- (55), Rissen (15), Kedougou (14), Enterica 4,12:-:- (10), Carcass 23 (12.78) Bovismorbificans (9), Derby (4), Krefeld (1), Typhimurium (1), Enterica 4,5,12:-:1,2 (1) Hygiene 8 (6.15) Enterica type I 1,4,[5],12:i:- (14), Enterica 4,12:-:- (8), Bovismorbificans (1) Enterica type I 1,4,[5],12:i:- (6), Enterica 3,10:-:- (1), Rissen (1) Table 2 Antimicrobial resistance of Salmonella spp. isolated from an HACCP pig slaughterhouse by serotypes Source Serotype (n) Antimicrobial resistance agents* AMP C CIP NA S SXT TE CT Feces total 84 (76.36) 13(11.82) 0 0 66(60.00) 19(17.27) 94(85.45) 0 (110) I 1,4,[5],12:i:- (55) 51(60.71) 0 0 0 50(75.76) 2(10.53) 52(55.32) 0 Rissen (15) 15(17.86) 0 00 4 (6.06) 12(63.16) 15(15.96) 0 Kedougou (14) 1(1.19) 13(100) 0 0 0 0 14(14.89) 0 4,12:-:- (10) 10(11.90) 0 00 9(13.64) 1(5.26) 10(10.64) 0 Bovismorbificans (9) 0 0 00 0 0 00 Derby (4) 4(4.76) 0 00 0 4(21.05) 00 Krefeld (1) 1(1.19) 0 00 1(1.52) 0 1(1.06) 0 Typhimurium (1) 1(1.19) 0 00 1(1.52) 0 1(1.06) 0 4,5,12:-:1,2 (1) 1(1.19) 0 00 1(1.52) 0 1(1.06) 0 Pork total 22(95.65) 0 0 0 22(95.65) 0 22(95.65) 0 (23) 4,12:i:- (14) 14(63.64) 0 0 0 14(63.64) 0 14(63.64) 0 4,12:-:- (8) 8(36.36) 0 00 8(36.36) 0 8(36.36) 0 Bovismorbificans (1) 0 0 00 0 0 00 Hygiene total 3(37.50) 0 00 2(25.00) 1(12.50) 7(87.5) 0 (8) I 1,4,[5],12:i:- (6) 2(66.67) 0 0 0 2(100) 0 6(85.71) 0 3,10:-:- (1) 0 0 00 0 1(100) 00 Rissen (1) 1(33.33) 0 0 0 0 0 1(14.29) 0 Note: The clear zone of disk diffusion test of Colistin in this study followed the standard of Escherichia coli, which also belongs to Enterobacteriaceae (CLSI, 2014). Discussion major serotypes included Enterica type I 1,4,[5],12:i:-, Kedougou, and Rissen. These serotypes belong to the The positive rate of Salmonella spp. from feces was top 10 most common serotypes from patients in 61.11% and from carcass was 12.78%, which showed the HACCP system could block the spread of Thailand (Hendriksen et al., 2009). This reveals a close pathogens during slaughter. According to the results correlation between retail pork and patients. (Figure 1), the HACCP system can stop these Furthermore, these serotypes (Enterica type I pathogens most of the time, but the most cross- 1,4,[5],12:i:-, Enterica 1,4,[5],12:-:1,2 and Enterica contamination is concentrated in one time process, 1,4,[5],12:-:-) are variants of Enterica revealing that a tiny mistake can reduce the pork quality. Additionally, these isolates of the predominant Typhimurium(Bugarel et al., 2012). This indicates a prevalent serotypes are similar to the report from high prevalence of Enterica Typhimurium variant Chiang Mai, Thailand (Patchanee et al., 2016), that isolates in northeast Thailand during the sample collection time. Figure 1 Positive Salmonella spp. isolates from feces and pork sources

164 Wu X. et al. / Thai J Vet Med. 2019. 49(2): 161-165. Note: Monophasic variants of S. Typhimurium are marked by antigenic formula. Figure 2 Genetic relatedness of the predominant and paired serotype Salmonella spp. Isolates The serotype and antimicrobial resistance results transportation via the belt. For example, the grinder from the hygiene test are presented in Tables 1 and 2, machine could be improved with a disinfection while the sources of hygiene test isolates are shown in function, and the staff should disinfect their hands Table 3, and some weak points of the HACCP system thoroughly before handling or dressing other carcasses. in this slaughterhouse are mentioned. There were 3 Salmonella-contaminated points in the hygienic clean Nine feces and 9 pork Salmonella spp. isolates were part (belt conveyor No. 1, belt conveyor metal detector serotype and PFGE matched in the paired samples of the 110 fecal and 23 carcass isolates from the total 180 No. 3 and pork grinder production staff). Multiple pathogen subtypes could infect the procedure. The belt pair samples (n=360) (Figures 1 & 3). The relativity rate is not only the transportation equipment that of Salmonella spp. isolates from feces to pork was 5.00% transports the product in the working line, but it also (9/180) (Figure 1 & 3). It reveals a low relativity rate provides convenience to spread pathogens. Since the from feces to pork directly in the process of the HACCP standard slaughtering. However, farm source (from pork grinder is a gathering part, it would crossly contaminate to other pork and staff. For a better feces) contributes 39.13% of total contaminations hygienic product, this system can improve the belt (9/23) and the remaining 60.87% (14/23) is from cross- conveyor part, the pork grinder part, and their contamination during the slaughter process. This peripheral devices. It is suggested that the part for indicates that the direct way from farm to pork is still a dominant source of contamination. grinding each carcass should be separated and disinfected, and could be separated by a tray during Table 3 Positive Salmonella spp. hygiene test of 5 zones isolated from a pig HACCP slaughterhouse Region time Positive points Serotype Machine Clean Zone After work Belt conveyor NO.1 3,10:-:- Machine Clean Zone After work Belt conveyor metal detector NO.3 I 1,4,[5],12:i:- Personal Hygiene Clean Zone After work Pork grinder production staff I 1,4,[5],12:i:- Personal Hygiene Semi Clean Zone Before work Pork grinder production staff I 1,4,[5],12:i:- Equipment Unclean Zone After work Pork grinder production staff I 1,4,[5],12:i:- Equipment Unclean Zone Before work Pig stomach washing machine Rissen Equipment Unclean Zone After work Pig stomach washing machine I 1,4,[5],12:i:- Equipment Unclean Zone After work Roller after pig dehairing I 1,4,[5],12:i:- Conclusion conveyor, pork grinder and their peripheral devices. To our knowledge, this is the first study to estimate the The findings from this study suggest that the direct and cross contamination rate revealing the HACCP system needs to be improved to stop pathogens spreading, especially at some weak points probability of the contamination source during the during the production procedure including the belt production process. The rate of the Salmonella spp.

Wu X. et al. / Thai J Vet Med. 2019. 49(2): 161-165. 165 from farm to retail via direct contamination is low, and should be from the following cross-contamination. most cases are stopped by HACCP slaughter. Further works should focus on improving the meat However, the high prevalence report of retail infection production, transport and storage. Note: The 110 feces source isolates (item A) and 23 pork source isolates (item B) were isolated and serotypes identified from 180 pairs of fecal and pork samples. Nine pair isolates were serotype and PFGE matched. Figure 3 Proportional relationship of Salmonella spp. isolates between feces and pork source shown by Venn diagram. Acknowledgements Ghent University 2018. “Calculate and Draw Custom Venn Diagrams online.” [Online]. Available: This study was conducted with financial support http://bioinformatics.psb.ugent.be/webtools/Ve from the Faculty of Veterinary Medicine, Khon Kaen nn/ Accessed February 26, 2019. University, Thailand. The authors would also like to thank the WHO National Salmonella and Shigella Kirk MD, Pires SM, Black RE, Caipo M, Crump JA, Center (NSSC), Thailand for their help in serotype identification. Devleesschauwer B and Angulo FJ 2015. World Health Organization estimates of the global and References regional disease burden of 22 foodborne bacterial, protozoal, and viral diseases, 2010: a data synthesis. Bugarel M, Granier SA, Bonin E, Vignaud ML, Roussel PLoS Med, 12(12): e1001921. S, Fach P and Brisabois A 2012. Genetic diversity in monophasic (1,4,[5],12:i:- and 1,4,[5],12:-:1,2) and in Ollinger M, Wilkus J, Hrdlicka M and Bovay J 2017. non-motile (1,4,[5],12:-:-) variants of Salmonella Public disclosure of tests for Salmonella: the effects enterica S. Typhimurium. Food Res Int, 45(2): 1016- on food safety performance in chicken slaughter 1024. establishments. ERR-231, U.S. Department of Agriculture, Economic Research Service, May 2017, CLSI 2014. Performance standard for antimicrobial susceptibility testing twenty-fourth informational No:1477-2017-3949. supplement M200–S24. PA.2014: Wayne. Patchanee P, Tansiricharoenkul K, Buawiratlert T, CDC 2013. Standard operating procedure for PulseNet Wiratsudakul A, Angchokchatchawal K, Yamsakul PFGE of Escherichia coli O157: H7, Escherichia coli P and Tadee P 2016. Salmonella in pork retail outlets non-O157 (STEC), Salmonella serotypes, Shigella and dissemination of its pulsotypes through pig sonnei and Shigella flexneri. Centers for Disease Control and Prevention, Atlanta. production chain in Chiang Mai and surrounding areas, Thailand. Prev Vet Med, 130: 99-105. EFSA 2017. The European Union summary report on Wilhelm B, Rajic A, Greig JD, Waddell L and Harris J trends and sources of zoonoses, zoonotic agents 2011. The effect of hazard analysis critical control and food-borne outbreaks in 2016. EFSA Journal, point programs on microbial contamination of 15(12): e05077. carcasses in abattoirs: a systematic review of Foley SL and Lynne AM 2008. Food animal-associated published data. Foodborne Pathog Dis, 8(9): 949- Salmonella challenges: pathogenicity and 960. antimicrobial resistance. J Anim Sci, 86(14 Suppl): Williams MS and Ebel ED 2012. Estimating changes in E173-187. public health following implementation of hazard Hendriksen RS, Bangtrakulnonth A, Pulsrikarn C, analysis and critical control point in the United Pornruangwong S, Noppornphan G, Emborg HD States broiler slaughter industry. Foodborne and Aarestrup FM 2009. Risk factors and Pathog Dis, 9(1): 59-67. epidemiology of the ten most common Salmonella serotypes from patients in Thailand: 2002-2007. Foodborne Pathog Dis, 6(8): 1009-1019. ISO2002. Microbiology of food and animal feeding stuffs - Horizontal method for the detection of Salmonella spp. Vol. ISO 6579 : 2002 (E), Switzerland, Geneva.



Original Article Genetic evolution of porcine reproductive and respiratory syndrome virus based on ORF5 on 7 Taiwanese pig farms Chien-Ho Yu1,a Kraijak Kaewprom2,3,a Chih-Cheng Chang4* Ming-Tang Chiou2,5,6* Chao-Nan Lin2,5* Abstract Porcine reproductive and respiratory syndrome virus (PRRSV) is an RNA virus with high genetic variation. Open reading frame 5 (ORF5) is the most suitable genomic region for the identification of strains that have previously circulated on a farm. Herein, 30 ORF5 sequences from 7 Taiwanese pig farms (A, E, F, H, L, S, U) were collected from 2002 to 2014 for analysis of the within-herd genetic evolution of PRRSV analysis. VR-2332, Lelystad, and MD001 (Taiwanese prototype) were selected as reference strains. Nucleotide sequences showing an identity of less than 97% and belonging to different clusters than last isolate from the same farm were considered to represent exotic strains. Our results showed that the identities of these isolates to VR-2332, Lelystad, and MD001 were 84.9-88.4%, 62.1-65.3%, and 85.9-89.6%, respectively. All of these studied strains belonged to PRRSV type II and evolved separately. Two nucleotide sequences from Farm A collected 10 years apart showed 95.5% identity but belonged to the same cluster and were considered to be the same strain endemic to the farm. On the other 6 farms, at least 1 exotic strain was detected during this period. We concluded that in the area, the spread and new invasions of exotic PRRSV strains at the farm level are common events in Taiwan. Keywords: PRRSV, ORF5, within herd, evolution, Taiwan 1Ph. D. Program of Agriculture Science, Veterinary Medicine, National Chiayi University, Chiayi, Taiwan 2Department of Veterinary Medicine, College of Veterinary Medicine, National Pingtung University of Science and Technology, Pingtung, Taiwan 3Program of Veterinary Technology, Faculty of Agricultural Technology, Rajabhat Mahasarakham University, Mahasarakham, Thailand 4Department of Veterinary Medicine, College of Veterinary Medicine, National Chiayi University, Chiayi, Taiwan 5Animal Disease Diagnostic Center, College of Veterinary Medicine, National Pingtung University of Science and Technology, Pingtung, Taiwan 6Research Center for Animal Biologics, National Pingtung University of Science and Technology, Pingtung, Taiwan aThese authors contributed equally to this work. *Correspondence: [email protected] (C. Chang) Thai J Vet Med. 2019. 49(2): 167-174.

168 Yu C. et al. / Thai J Vet Med. 2019. 49(2): 167-174. Introduction within herds to better understand the dynamics of PRRSV at the farm level. Porcine reproductive and respiratory syndrome (PRRS) is one of the major swine diseases and causes Materials and Methods economic impacts to the industry worldwide (Zimmerman, 2012). The etiological agent of the Specimen collection: Clinical samples that were disease is PRRS virus (PRRSV), which was first submitted to the Animal Diseases Diagnostic Center identified in the Europe in 1991 and referred to (ADDC) of National Pingtung University of Science Lelystad virus (Wensvoort et al., 1991). Later, in the US, and Technology (NPUST) and tested positive for the same virus was isolated and referred to as VR-2332 PRRSV by real‐ time polymerase chain reaction (Benfield et al., 1992). The total cost of productivity described previously (Lin et al., 2013) were collected losses due to PRRS in the US is estimated to be $664 from 2002 to 2014. Seven farms that submitted more million annually, including $52.19 per sow, $2.36 per than two PRRSV-positive samples included in this weaned pig, and $4.67 per marketed pig per year dataset were selected for this study. In totally, 29 (Holtkamp et al., 2013). samples were obtained from these farms. PRRSV is a positive, single-stranded, enveloped ORF5 amplification and sequencing: The ORF5 gene RNA virus belonging to the family Arteriviridae in the was amplified using two reported primers (Iseki et al., order Nidovirales. Its genome is approximately 15 kb in 2011; Xie et al., 2013). The PCR products from these size and contains at least ten open reading frames samples were cloned with the yT&A cloning kit (ORFs). ORFs 1a and 1b encode the viral RNA (Yeastern Biotech, Taiwan) according to the polymerase, and ORFs 2-7 encode structural proteins manufacturer’s instructions and submitted to Mission GP 2-5, M, and N. Two additional structural proteins, Biotech Company (Taipei, Taiwan) for sequencing. The E and ORF5a, were recently reported (Wu et al., 2001; nucleotide sequences were determined from both Johnson et al., 2011). According to the genotype, orientations by an ABI 3730XL DNA analyzer (Applied PRRSV can be divided into type I (European, EU) or Biosystems, Foster City, CA). type II (North American, NA), which share approximately 60% identity over the entire genome Phylogenetic analysis: The nucleotide sequences (Nelsen et al., 1999). obtained were compared with VR-2332, Lelystad, and MD001 using Clustal W methods in the MegAlign ORF5 encodes the major envelope protein GP5, program (DNASTAR Inc., WI, U.S.A.). A phylogenetic which is reported to include a neutralizing epitope tree was constructed via the maximum likelihood (Ostrowski et al., 2002). GP5 is located on the surface of method in MEGA 5.05 as described in a previous study the virion and plays an important role in viral (Kimura, 1980). Samples from different years from the infectivity (Dea et al., 2000). It contains important same farm were chosen for within-herd genetic immunological domains associated with viral variation analysis. Nucleotide sequences with an neutralization (Gonin et al., 1999). ORF5 is also the identity of less than 97% that belonged to a different most variable gene of PRRSV and has been used to cluster than the previous isolate from the same farm investigate genetic diversity. A phylogenetic tree based were considered to represent an exotic strain on ORF5 showed consistency with the results obtained (Murtaugh, 2012). for the full genome (Kvisgaard et al., 2013). Genetic analyses of PRRSV based on ORF5 have been reported Amino acid sequence analysis: Important sites in GP5 in many countries (Thannawongnuwech et al., 2004; of the PRRSV isolates including the decoy epitope Cha et al., 2006; Thuy et al., 2013). Therefore, ORF5 has (DCE) located at residues 27-30; the primary been widely used to monitor the evolution and neutralizing epitope (PNE) at residues 37-45 molecular epidemiology of PRRSV. ORF5 is the most (Ostrowski et al., 2002); residues 32-34, 38-39, 57-59, suitable genome region for the identification of strains which significantly influence the susceptibility of that have circulated previously on farms. ORF5 has mutant viruses to viral neutralizing antibodies (Kim et also been used for diagnostic sequencing for many al., 2013); and residues 13 and 151, which are related to years in Canada and the US. Nucleotide sequence virulence (Allende et al., 2000), were selected for similarity of 97% or 98% is a useful for indicating comparison with the reference strains. relatedness of two virus isolates (Murtaugh, 2012). Results The first case of PRRS in Taiwan was recognized in 1991 and reported in 1993 (Chang et al., 1993). Two Phylogenetic analysis: In total, 30 ORF5 nucleotide prototypic strains identified in Taiwan, MD001 and sequences were obtained from 29 PRRSV-positive pigs WAV, have evolved separately, but the MD001 group in this study (Table 1). The phylogenetic tree is shown is predominant, and invasion by a possible exotic in Figure 1. All the isolates evolved separately. The strain suspected to be from the US is thought to have nucleotide sequences obtained from farm A occurred over the last 20 years (Deng et al., 2015). (TW1/A/02 and TW25/A/11), despite being isolated Despite the implementation of several commercial 10 years apart and sharing 95.5% identity, belonged to vaccines and other tools such as acclimation in Taiwan, the same cluster and were considered as the same the diversity and uncertain within-herd dynamics of strain endemic to the farm (Table 2). PRRSV still make its control difficult in the field. The objective of this study was to investigate the genetic variation of PRRSV based on ORF5 in 7 Taiwanese pig farms from 2002 to 2014 to analyze the disease spread

Yu C. et al. / Thai J Vet Med. 2019. 49(2): 167-174. 169 Table 1 Farms and ORF5 sequences obtained during 2002-2014 Yu C. et al. / Thai J Vet Med. 2019. 49(2): 167-174. Farma Size (head) Typeb Sampling period (years) Denomination (Serial Number/Farm/Year) A 12000 F-F 10 TW1/A/02, TW25/A/11 E 1000 Breeder 2 TW5/E/05, TW8/E/06, TW9/E/06, F 8000 F-F 7 TW6/F/06, TW7/F/06, TW11/F/07, TW13/F/07, TW36/F/12, TW37/F/12, TW39/F/12, TW46/F/12 H 5000 F-F 7 TW14/H/07, TW27/H/11, TW28/H11, TW75-1/H/13, TW75-2/H/13 L 7000 F-F 5 TW20/L/09, TW33/L/11, TW35/L/11, TW47/L/12, TW48/L/12, TW52/L/13 S 15000 G-F 3 TW32/S/11, TW70/S/13 U 1500 F-F 3 TW38/U/12, TW77/U/14, TW78/U/14, TW79/U/14 aAll of these farms have a history of vaccination with a modified live PRRSV vaccine (Ingelvac PRRS MLV, Boehringer Ingelheim Animal Health) during this period. bF-F: Farrow to finish; G-F: Grow to finish Table 2 Analysis of nucleotide sequence identity of ORF5 between different years in strains obtained from Taiwanese pig farms A, E, F, H, L, S and U Year- 2011-A 2005- 2006- 2006- F 2007- 2012- F 2012- 2007- 2011- 2013-H 2009- 2011- 2012- 2011- S 2012- U 2014-U Farm E E F F H H L L L 88.9 88.9 2002-A 95.5 88.2-88.7 88.4-99.5 2006-E 2006-F 90.4-90.9 99.5 2007-F 2012-F 99.2 91.7-96.0 92.0-92.2 89.6-91.0 2011-H 2013-H 91.9-98.8 93.0-94.6 89.6-95.7 2011-L 2012-L 91.7-94.0 91.9-99.8 2013-L 2013-S 94.4-94.5 99.5 2014-U 89.6-89.9 91.4-92.0 99.7 90.4-91.2 97.8 90.2 90.4-91.0 98.5 90.7 90.7-91.5 98.8-99.0 169

170 Yu C. et al. / Thai J Vet Med. 2019. 49(2): 167-174. ORF5 nucleotide sequences analysis: All the TW46/F/12 was alone and shared only 91.9% identity nucleotide sequences contained 603 nucleotides. The to its previous isolate so was considered to be new identities within the studied isolates were 86.9-100% invaded strain. The 5 nucleotide sequences from Farm (Table 2); those compared to VR-2332, Lelystad, and H were separated into two clusters: TW14/H/07 MD-001 were 84.9-88.4%, 62.1-65.3%, and 85.9-89.6%, together with TW27/H/11 and TW28/H/11; and respectively. All isolates included in the study TW75-1/H/13 with TW75-2/H/13. TW75-1/H/13 belonged to Type II PRRSV (Figure 1). was considered a new invaded strain. The 6 nucleotide sequences from Farm L were separated into 3 different ORF5 nucleotide sequences analysis during a 5-7 years groups: TW20/L/09 alone; TW33/L/11 with sampling period: The 8 nucleotide sequences from TW35/L/11; and TW47/L/12 with TW48/L/12, and Farm F were separated into 3 different clusters: TW52/L/13. TW33/L/11 and TW47/L/12 shared TW6/F/06 together with TW7/F/06, TW11/F/07, and 91.2% and 90.4% identity, respectively, with their TW13/F/07 (95.9-99.2% identity); TW36/F/12 with previous isolates and were considered new invaded TW37/F/12 and TW39/F/12 (99.8-100% identity); strains (Table 2). Figure 1 A phylogenetic tree was constructed on the basis of VR-2332, Lelystad, MD001 and 30 Taiwanese PRRSV ORF5 nucleotide sequences. ○, ●, ■, ▼, ▲, △, and ◆each represent sequences from the same farm. ORF5 nucleotide sequences analysis during a 2-3 years TW5/E/05 (90.4% identity) and was considered to be sampling period: TW8/E/06 was considered an exotic the same strain as TW9/E/06 from Farm E. There was invaded strain compared with the previous isolate only 88.9% similarity between the 2 nucleotide

Yu C. et al. / Thai J Vet Med. 2019. 49(2): 167-174. 171 sequences from Farm S (TW32/S/11 and TW70/S/13), VR2332 (Ingelvac PRRS MLV) has been common in and they were clustered in different groups, Taiwan since its introduction in 1994. Second, no TW70/S/13 could be considered a new invaded strain commercial type I PRRSV live vaccine was introduced on the farm. In Farm U: TW38/U/12, TW77/U/14, and in Taiwan until 2011. Third, the import of type II TW78/U/14 shared low identity (88.2-88.6%) and PRRSV-infected breeders from abroad plays an clustered into 3 different groups, while TW79/U/14 important role (Lin et al., 2019). clustered with TW77/U/14 and shared 99.5% similarity. TW77/U/14 and TW78/U/14 were Studies have shown that some field isolates may considered new invaded strains (Table 2). originate from vaccine viruses (Wang et al., 2008; Faisal et al., 2016). However, no vaccine-related strains were Amino acid variation in GP5: Amino acid variation in found in our study. Nilubol et al. (2014) indicated that GP5 of these Taiwanese isolates mainly occurs in the the MLV-related isolates lacked the ability to establish signal peptide and ectodomains. Analysis of the amino a persistent infection as they disappear within a month. acid sequences of the invasive and endemic isolates The detection of vaccine derivatives should be an showed that the DCE of most of the isolates was VLVN, occasional event related to the sampling time and the except for those of TW25/A/11 is VLVS, TW36/F/12, vaccination protocol of the farm. which were all VFVN, that of TW75-1/H/13, which was VIVN, and that of TW78/U/14, which was ALVN. Functional domains of GP5 such as its signal The primary neutralizing epitope (PNE) was generally peptides, ectodomains, transmembrane regions, and SYSQLIYLL, except for those of TW47/L/12 and endodomains were identified according to a previous TW78/U/14, which were SYSQSIYNL and report (Dea et al., 2000). Our results regarding the SYFQSIYNL, respectively. Most strains exhibited an R amino acid variation in GP5 from these Taiwanese at positions of 13 (except for TW36/F/12, isolates mainly indicated that such variation occurs in TW/70/S/13, and TW78/U/14, in which this position the signal peptide and ectodomains, which is in line was occupied by Q) and 151 (except for TW1/A/02, with a previous study (Li et al., 2009). Kim et al. (2013) TW25/A/11, and TW70/S/13, in which this position identified five common variable sites in susceptible was occupied by K). All of the isolates examined in this and resistant strains and found that changes in amino study exhibited three N-glycosylation sites at positions acid sequences at three sites (32-34, 38-39, and 57-59) 34, 44, 51 (Figure 2). located in the N-terminal ectodomain of ORF5 significantly influenced the susceptibility of the mutant Discussion viruses to neutralizing antibodies. We found heterogenic at position of 32-34 and 57-59, suggesting In this study, we collected clinical samples that that these two sites may be more sensitive as genetic were submitted to the ADDC of NPUST and were markers. positive for PRRSV from 2002 to 2014. Seven farms from which more than two ORF5 nucleotide sequences One of the objectives of this study was to analyze obtained in different years during this period were the genetic evolution of PRRSV within farms. The included to analyze the within-herd genetic variation ORF5 nucleotide sequences obtained from Farms A of PRRSV. ORF5 is a highly variable region of the viral belonged to the same cluster, suggesting that these genome. It encodes the major envelope protein (GP5) viruses may be a farm-specific strain and circulate for and is widely used for PRRSV diagnostic identification years. although 97% or 98% nucleotide sequence (Kapur et al., 1996). In addition, the clustering of the similarity has been suggested to indicate relatedness of viruses in phylogenetic trees based on the full genome two virus isolates, additional knowledge should be was as expected and resembled the clustering of the incorporated to avoid blind acceptance of such finding isolates in trees were based only on ORF5 (Kvisgaard (Murtaugh, 2012). In a PRRSV transmission study et al., 2013). According to these characteristics, ORF5 is carried out by sequentially infecting pigs over a one- an appropriate target for research on the genetic year period, the base nucleotide sequence differences variation of PRRSV. varied by 0.7% from the initial inoculum (Chang et al., 2002). Field experience and experimental study All 30 nucleotide sequences examined in this study suggest that PRRSV changes at a rate of approximately belonged to Type II PRRSV. This result was similar 0.5% to 1% per year in the field (Murtaugh, 2012). The with those of other studies on PRRSV epidemiology in two nucleotide sequences from Farm A collected over Taiwan (Shen et al., 2010; Wang et al., 2008; Deng et al., a period of 10 years showing 95.5% identity may be 2015). Some reports from other Asian countries considered to be the same strain and to be endemic to indicate that Type II PRRSV is dominant (Iseki et al., the farm. Developed their own gilts and less 2011; Xie et al., 2013; Thuy et al., 2013; Faisal et al., 2016), introduction of breeder from outside may be a reason while some studies show that both genotypes exist in for no exotic strain was detected. When the viruses these countries (Thanawongnuwech et al., 2004; King et evolve to cause less virulent but more persistent al., 2017). A report from Thailand indicated that two- infections, it may favor survival of the viruses. thirds of Thai isolates were Type I PRRSV and were Residues in GP5 of PRRSV related to virulence have considered result from the continuous import of swine been identified at positions 13 and 151 (Allende et al., breeders from both European and North American 2000). As shown in Figure. 2, we found that the 151 countries (Thanawongnuwech et al., 2004). Several residue was K in both amino acid sequences from Farm factors may contribute to the domination of Type II A, while it was R in the others (except for TW47/L/12, PRRSV. First, the use of the commercial modified live in which it was K). This change may support the vaccine derived from the prototypic American strain persistent infection by the virus.

172 Yu C. et al. / Thai J Vet Med. 2019. 49(2): 167-174. 172 Yu C. et al. / Thai J Vet Med. 2019. 49(2): 167-174. Figure 2 Amino acid sequences of ORF5(GP5) of 30 Taiwanese PRRSV isolates in this study in comparison with VR-2332, Lelystad, and MD001. The signal peptide sequence is underlined. The neutralizing epitope is indicated in a solid line box. Two hypervariable regions are indicated in dotted line boxes.

Yu C. et al. / Thai J Vet Med. 2019. 49(2): 167-174. 173 In contrast to Farm A, the isolates from the other 6 (PRRS) viruses and comparison to other Asian PRRS viruses. Vet Microbiol. 117(2-4): 248-257. farms showed lower identity and belonged to different Chang CC, Chung WB, Lin WM, Yang PC, Weng CN, Chiu YT, Chang WF and Chu RM 1993. Porcine clusters, indicating that these farms were invaded by reproductive and respiratory syndrome (PRRS) in Taiwan. 1: virus isolation. J Chin Soc Vet Sci. 19: the exotic PRRSV strain. Eight isolates (TW8/E/06, 268-276. Chang CC, Yoon KJ, Zimmerman JJ, Harmon KM, TW36/F/12, TW75-1/H/13, TW33/L/11, Dixon PM, Dvorak CMT and Murtaugh MP 2002. Evolution of porcine reproductive and respiratory TW47/L/12, TW70/S/13, TW77/U/14, TW78/U/14) syndrome (PRRS) virus during sequential passages in pigs. J Virol. 76(10): 4750-4763. were considered to be exotic strains on the farm based Dea S, Gagnon CA, Mardassi H, Pirzadeh B and Rogan D 2000. Current knowledge on the structure on two criteria: low identity to the previous isolate proteins of porcine reproductive and respiratory syndrome (PRRS) virus: comparison of the North from the same farm and clustering into different American and European isolates. Arch Virol. 145(4): 659-688. groups. TW11/F/07 and TW27/H/11 showed 95.9% Deng MC, Chang CY, Huang TS, Tsai HJ, Chang C, Wang FI and Huang YL 2015. Molecular and 92.5% identity to their preceding isolates epidemiology of porcine reproductive and respiratory syndrome viruses isolated from 1991 to TW7/F/06 and TW14/H/07, respectively, which were 2013 in Taiwan. Arch Virol. 160(11): 2709-2718. Faisal F, Saipulloh M, Widayanti R, Haryanto A and sampled 1 and 4 years apart. Their genetic similarities Tabbu CR 2016. Genetic characterization of open reading frame 5 (ORF5) of porcine reproductive were lower than 97%, but they clustered in the same and respiratory syndrome virus in Indonesia between 2008 and 2014. Asian J Anim Sci. 10(3): group. These 2 isolates were not considered to be exotic 189-195. Gonin P, Pirzadeh B, Gagnon CA and Dea S 1999. strains in this study since they did not fit both criteria. Seroneutralization of porcine reproductive and respiratory syndrome virus correlates with Further study is necessary to understand the antibody response to the GP5 major envelope glycoprotein. J Vet Diagn Invest. 11(1): 20-26. background of their genetic distance. There are several Holtkamp DJ, Kliebenstein JB, Neumann EJ, Zimmerman JJ, Rotto HF, Yoder TK, Wang C, ways for PRRSV to reach a farm, among which the Yeske PE, Mowrer CL and Haley CA 2013. Assessment of the economic impact of porcine entry of infected animals, particularly gilts and sows, reproductive and respiratory syndrome virus on United States pork producers. J Swine Health Prod. is considered the most common route for virus 21(2): 72-84. Iseki H, Takagi M, Miyazaki A, Katsuda K, Mikami O introduction (Thakur et al., 2015). The introduction of and Tsunemitsu H 2011. Genetic analysis of ORF5 in porcine reproductive and respiratory syndrome breeder pigs from outside the farm without virus in Japan. Microbiol Immunol. 55(3): 211-216. Johnson CR, Griggs TF, Gnanandarajah J and appropriate quarantine is common in Taiwan, which Murtaugh MP 2011. Novel structure protein in porcine reproductive and respiratory syndrome might have contributed to the introduction of new virus encoded by an alternative ORF5 present in all arteriviruses. J Gen Virol. 92(Pt 5): 1107-1116. exotic PRRSV strain to these 6 farms. In addition, Kapur V, Elam MR, Pawlovich TM and Murtaugh MP 1996. Genetic variation in porcine reproductive and despite the different sampling period, all the isolates respiratory syndrome virus isolates in the midwestern United States. J Gen Virol. 77(Pt 6): evolved locally based on phylogenetic analysis, 1271-1276. Kvisgaard LK, Hjulsager CK, Fahnøe U, Breum Sø, Ait- suggesting that the invaded viruses were from other Ali T and Larsen LE 2013. A fast and robust method for full genome sequencing of porcine reproductive areas in Taiwan. Taken together, our results provide and respiratory syndrome virus (PRRSV) type 1 and type 2. J Virol Methods. 193(2): 697-705. evidence supporting the notion that multi-invasion of Kim WI, Kim JJ, Cha SH, Wu WH, Cooper V, Evans R, Choi EJ and Yoon KJ 2013. Significance of genetic PRRSV involving other local strains at the farm level is variation of PRRSV ORF5 in virus neutralization and molecular determinants corresponding to a common event in Taiwan. Farmers should be pay more attention to the external biosecurity concerns such as appropriate quarantine for breeding pigs from domestic pig herds, restricted vehicles (slaughterhouse truck and dead-animal truck) moving around the farm etc. In conclusion, the 30 isolates examined in this study all belonged to Type II PRRSV and evolved independently. Invasion of an exotic PRRSV strain at the farm level is a common event in Taiwan. This information is provided for swine producers and veterinarians to allow them to adjust their PRRSV control programs and biosecurity protocols. References Allende R, Kutish GF, Laegreid W, Lu Z, Lewis TL, Rock DL, Friesen J, Galeota JA, Doster AR and Osorio FA 2000. Mutations in the genome of porcine reproductive and respiratory syndrome virus responsible for the attenuation phenotype. Arch Virol. 145(6): 1149-1161. Benfield DA, Nelson E, Collins JE, Harris L, Goyal SM, Robison D, Christianson WT, Morrison RB, Gorcyca D and Chladek D 1992. Characterization of swine infertility and respiratory syndrome (SIRS) virus (isolate ATCC VR-2332). J Vet Diagn Invest. 4(2): 127-133. Cha SH, Choi EJ, Park JH, Yoon SR and Song Y 2006. Molecular characterization of recent Korean porcine reproductive and respiratory syndrome

174 Yu C. et al. / Thai J Vet Med. 2019. 49(2): 167-174. cross neutralization among PRRS viruses. Vet syndrome virus isolated in Vietnam. Microbiol Microbiol. 162(1): 10-22. Immunol. 57(7): 518-526. Kimura M 1980. A simple method for estimating Wang C, Lee F, Huang TS, Pan CH, Jong MH and Chao evolutionary rates of base substitutions through PH 2008. Genetic variation in open reading frame 5 comparative studies of nucleotide sequences. J Mol gene of porcine reproductive and respiratory Evol. 16(2): 111-120. syndrome virus in Taiwan. Vet Microbiol. 131(3-4): King SJ, Ooi PT, Phang LY, Allaudin ZNB, Loh WH, 339-347. Tee CY, How SP, Yip LS, Choo PY and Lim BK Wensvoort G, Terpstra C, Pol JM, ter Laak EA, 2017. Phylogenetic characterization of genes Bloemraad M, de Kluyver EP, Kragten C, van encoding for viral envelope glycoprotein (ORF5) Buiten L, den Besten A and Wangenaar F 1991. and nucleocapsid protein (ORF7) of porcine Mystery swine disease in The Netherlands: the reproductive & respiratory syndrome virus found isolation of Lelystad virus. Vet Q. 13(3):121-130. in Malaysia in 2013 and 2014. BMC Vet Res. 13(1):3. Wu WH, Fang Y, Farwell R, Steffen-Bien M, Rowland Li B, Fang L, Xu Z, Liu S, Gao J, Jiang Y, Chen H and RR, Christopher-Hennings J and Nelson EA 2001. Xiao S 2009. Recombination in vaccine and A 10-kDa structural protein of porcine circulating strains of porcine reproductive and reproductive and respiratory syndrome virus respiratory syndrome viruses. Emerg Infect Dis. encoded by ORF2b. Virology. 287(1): 183-191. 15(12): 2032-2035. Xie J, Zhu W, Chen Y, Wei C, Zhou P, Zhang M, Huang Lin CN, Lin WH, Hung LN, Wang SY and Chiou MT Z, Sun L, Su S and Zhang G 2013. Molecular 2013. Comparison of viremia of type II porcine epidemiology of PRRSV in South China from 2007 reproductive and respiratory syndrome virus in to 2011 based on the genetic analysis of ORF5. naturally infected pigs by zip nucleic acid probe- Microb Pathogenesis. 63: 30-36. based real-time PCR. BMC Vet Res. 9: 181. Zimmerman JJ 2012. Porcine Reproductive and Lin WH, Shih HC, Wang SY, Lin CF, Yang CY, Chiou Respiratory Syndrome Virus (Porcine Arterivirus). MT and Lin CN 2019. Emergence of a virulent In: Diseases of swine 10th ed. Chichester, West porcine reproductive and respiratory syndrome Sussex: Wiley‐ Blackwell 1675-1777. virus in Taiwan in 2018. Transbound Emerg Dis. 66:1138-1141. Murtaugh MP 2012. Use and interpretation of sequencing in PRRSV control program. Allen D Leman Swine Conf Proc 39:49-55. Nelsen CJ, Murtaugh MP and Faaberg KS 1999. Porcine reproductive and respiratory syndrome virus comparison: divergent evolution on to continents. J Virol. 73(1):270-280. Nilubol D, Tripipat T, Hoonsuwan T, Tipsombatboon P and Piriyapongsa J 2014. Dynamics and evolution of porcine reproductive and respiratory syndrome virus (PRRSV) ORF5 following modified live PRRSV vaccination in a PRRSV-infected herd. Arch Virol. 159(1): 17-27. Ostrowski M, Galeota JA, Jar AM, Platt KB, Osorio FA and Lopez OJ 2002. Identification of neutralizing and nonneutralizing epitopes in the porcine reproductive and respiratory syndrome virus GP5 ectodomain. J Virol. 76(9): 4241-4250. Shen SY, Ma WJ, Yu CY and Chang CC 2010. Genetic variation of porcine reproductive and respiratory syndrome viruses in Taiwan. Taiwan Vet J. 36: 305- 314. Thakur KK, Revie CW, Hurnik D, Poljak Z and Sanchez J 2015. Simulation of between-farm transmission of porcine reproductive and respiratory syndrome virus in Ontario, Canada using North American animal disease spread model. Prev Vet Med. 118(4): 413-426. Thanawongnuwech R, Amonsin A, Tatsanakit A and Damrongwatanapokin S 2004. Genetics and geographical variation of porcine reproductive and respiratory syndrome virus (PRRSV) in Thailand. Vet Microbiol. 101(1): 9-21. Thuy NT, Thu NT, Son NG, Ha le TT, Hung VK, Nguyen NT and Khoa do VA 2013. Genetic analysis of ORF5 porcine reproductive and respiratory

Original Article Fetal Head Diameter in Dogs and Cats Measured by Radiography and Ultrasonography Chunsumon Limmanont1,2 Suppawiwat Ponglowhapan3 Phanwimol Tanhan4 Theerapol Sirinarumitr1,5 Kaitkanoke Sirinarumitr1,2* Abstract In abdominal radiography, the measurement of fetal biparietal diameter or head diameter (HD) and maternal pelvic diameter are commonly used to predict risk of dystocia due to relatively oversized fetus. Besides fetal viability, fetal head measurement is also easy to perform with ultrasound. However, fetal HD measured from both techniques has never been compared. The objectives of the study were to compare and to find the correlations of fetal HD measured by both techniques at the last trimester of pregnancy in dogs and cats. Twenty four dogs and sixteen cats diagnosed for near-term parturition at Emergency Surgery Unit, Kasetsart University Veterinary Teaching Hospital during the period 2017-2018 were included in the study. Fetal HD was measured by both techniques on the same day. The correlations between the two techniques and linear regressions of HD were statistically analyzed. Radiographic measurements of fetal HD were larger than those measured by ultrasonography in both dogs (p<0.0001) and cats (p<0.0001). The correlations between the results of skull heads from abdominal radiographs and ultrasonogram were significantly correlated (r = 0.73 in dogs and r = 0.94 in cats, p<0.0001). Linear regression formulas were y = 1.08x+0.13 (R² = 0.73) in dogs and y = 0.96x+0.30 (R² = 0.88) in cats (y = HD by radiography and x = HD by ultrasonography). In conclusion, the formulas above can be used to estimate fetal HD between radiography and ultrasonography. Keywords: cat, dog, fetal head diameter, radiography, ultrasonography 1Center for Advanced Studies for Agriculture and Food, Kasetsart University Institute for Advanced Studies, Kasetsart University, Bangkok 10900, Thailand (CASAF, NRU-KU, Thailand) 2Department of Companion Animal Clinical Sciences, Faculty of Veterinary Medicine, Kasetsart University, Bangkok, 10900, Thailand 3Department of Obstetrics, Gynaecology and Reproduction, Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand 4Department of Pharmacology, Faculty of Veterinary Medicine, Kasetsart University, Bangkok 10900, Thailand 5Department of Pathology, Faculty of Veterinary Medicine, Kasetsart University, Bangkok, 10900, Thailand *Correspondence: [email protected], [email protected] (K. Sirinarumitr) Thai J Vet Med. 2019. 49(2): 175-182.

176 Limmanont C. et al. / Thai J Vet Med. 2019. 49(2): 175-182. Introduction radiography and ultrasonography in the last trimester of pregnancy in dogs and cats. Radiography is a routine diagnostic technique in small animal practice. Radiographic diagnosis of Materials and Methods pregnancy is possible after fetal mineralization, which occurs after approximately 43 days of pregnancy in The study was conducted as a retrospective study. dogs (Rendano et al., 1984), and 38 days in cats (Haney The data was collected from the Emergency Surgery et al., 2003). This technique is limited, but can be used Unit, Kasetsart University Veterinary Teaching accurately in late pregnancy to detect the fetal skeleton. Hospital during the period 2017-2018 including cases Radiography is not only for fetal skeletal detection in diagnosed with dystocia and receiving surgical normal pregnancy, but it is also for dystocia treatment. In most cases the dogs and cats were evaluation. Dystocia can occur through maternal or diagnosed by radiography and ultrasonography fetal causes, such as fetal malposition, monstrosity, or within 24 hours before parturition. Breed, body weight anatomic abnormalities of the maternal pelvic canal. (BW), litter size were recorded. From radiography, However, several causes of dystocia are not detected each fetal HD was measured at the widest portion of by imaging such as primary or secondary uterine the parietal bone with both orbits visible to ensure that inertias, fetal viability and early fetal death (Kinns and the image was symmetric either from the maternal Nelson, 2018). It is also unable to detect fetal viability ventro-dorsal (VD) or lateral views (Fig 1). The pelvic signs such as a heart beat or fetal movement unless inlet is pointed at horizontal distance between the two long term fetal death has occurred, causing an medial tubera ischiadica on VD view (Eneroth et al., abnormal or overlapped head (Spalding’s sign), gas accumulation, or fetal skeleton deterioration. 1999) (Fig 2). Fetal HD and pelvic inlet diameters were radiographed with a 100-cm (40-inches) focal film Ultrasonography is another useful diagnostic tool distance (FFD) and 1.2 focal spot by digital available in small animal practice, including for use in radiographic machine (KXO_80S/EBT100A/DST obstetric cases. It is not only a valuable tool for 1000A, Toshiba™), and the scales were measured from pregnancy diagnosis, but it is also for monitoring the diagnostic radiology imaging software Infinite™ fetal development (Yeager et al., 1992; Zambelli et al., program. Data was averaged from two measurements, 2002) and assessing fetal viability. This is a reliable and the percentage of fetal HD measured from each method for early pregnancy detection. Early view was reported. pregnancy can be detected at 20-24 days after the last breeding day in dogs (Yeager et al., 1992), and at 15-20 Transabdominal ultrasonography with a 9-13 MHz days in cats by embryonic sac presentation (Hecht, linear transducer (LOQIC E9, GE™) was performed on 2008). Moreover, ultrasonography is used to determine the dogs and cats in dorsal recumbency for fetal HD time of parturition based on inner chorionic cavity and measurement. Preparation of the abdomen involved head diameter (HD), which provide accurate clipping the hair and applying acoustic coupling gel on gestational timing in the first (between 19-37 days after the skin. The markers were placed at the widest portion LH peak) and second half (after 37 days) of pregnancy, of each fetal parietal bone with both orbits visible to respectively (Luvoni and Grioni, 2000; Beccaglia et al., ensure that the image was symmetric (Lopate, 2008) 2016). Fetal HD was measured at biparietal diameter, and biparietal diameter was measured as fetal HD. and there have been some studies which predicted Both radiography and ultrasonography of each dog gestation day (GA) using fetal HD. The formulas used and cat were performed on the same day (Fig 3). for small breed (up to 10 kg) and medium breed dogs (11-25 kg) are GA = [HD (mm)−25.11]/0.61 day before Fetal HD from dogs and cats were presented as birth (Mattoon and Nyland 1995; Luvoni and Grioni, mean±SD and compared with Wilcoxon signed rank 2000; Lopate, 2008; Beccaglia et al., 2016), and GA = test. The correlations and linear regression of fetal HD [15×HD (cm)] + 20 or GA = 21.08 + [14.88×HD (cm) – in dogs and cats between the two techniques were (0.11×HD2)] (Mattoon and Nyland 1995; Luvoni and analyzed by RStudio Version 1.0153-©2009-2017. The Grioni, 2000; Lopate, 2018), respectively. In fact, the significant difference was considered when p-value ultrasonographic technique can be used to count the was less than 0.05. numbers of fetuses, but it may not be as accurate as radiography in the last trimester of pregnancy. Results Moreover, pelvic canal diameter cannot be measured by ultrasonography. Twenty four dogs were included in the study. The breeds were Chihuahua (8), Pomeranian (4), French At the present time, there is no data available to bulldog (3), Crossbreed (3), Shih Tzu (2), English compare fetal HD measured by radiography and bulldog (1), Poodle (1), Shiba (1) and Yorkshire (1). ultrasonography. If there is a correlation of fetal HD There were sixteen cats in the study, which were measurement between both techniques, fetal HD domestic shorthair (10), Maincoon (3), Persian (2) and measured from ultrasonography might help to Scottish Fold (1). Eighty four puppies from twenty estimate fetal head size when it is compared to pelvic three dogs, and fifty four kittens from fifteen cats were inlet diameter measured from radiography, especially born. The data of total fetal numbers in one dog and when fetal HD cannot be visualized, or proper HD one cat were missing. The mean±SD of BW, litter size, cannot be measured from radiography. pelvic inlet diameter, fetal HD from two techniques, and percentage of fetal HD measured from VD and The purposes of the study were to compare and lateral views of abdominal radiograph were presented find the correlation of fetal HD measured by (Table 1). Data of BW in two dogs and one cat were missing.

Limmanont C. et al. / Thai J Vet Med. 2019. 49(2): 175-182. 177 Fetal HD measured from radiography were larger (r = 0.73 in dogs and r = 0.94 in cats, p<0.0001). Linear than those measured by ultrasonography in both dogs regression graphs and formulas from both techniques and cats (p<0.0001). The correlations were significance in dogs and cats were presented (Fig 4). Figure 1 Fetal head diameters were measured at the widest portion of the parietal bone with both orbits visible in the last trimester of pregnancy from abdominal radiograph. Abdominal ventro-dorsal view in a dog (A), and lateral view in a cat (B) were demonstrated fetal HD measurements.

178 Limmanont C. et al. / Thai J Vet Med. 2019. 49(2): 175-182. Figure 2 Pelvic inlet diameter measurement from a French bulldog (A) and a domestic shorthair cat (B) were pointed at horizontal distance between the two medial tubera ischiadica at pelvic on ventro-dorsal view of abdominal radiograph.

Limmanont C. et al. / Thai J Vet Med. 2019. 49(2): 175-182. 179 Figure 3 Fetal head diameters from a dog (A) and a cat (B) were measured on ultrasonogram at the widest portion of the parietal bone with both orbits visible in the last trimester of pregnancy. Table 1 Mean±SD of body weight (BW), litter size, pelvic inlet diameter measured from radiography (XR), fetal HD from XR and ultrasonography (US) and percentage of fetal HD measured from VD and lateral views of XR from the last trimester of pregnant in dogs and cats were presented. Numbers of sample (n) from each parameter were shown in parenthesis. Species BW (kg) Litter size Pelvic inlet Fetal HD (cm) Percentage of fetal HD measured Dog diameter (cm) 6.63±5.80 from VD and lateral views of XR (n=22) XR US VD view Lateral view 3.62±1.25 3.81±0.57 2.83±0.37 2.50±0.29 82.61% 62.50% (n=23) (n=23) (fetal n=43) (fetal n=47) (19/23) (15/24) Cat 4.34±1.27 3.60±1.20 2.92±0.23 2.31±0.29 2.09±0.28 50.00% 66.70% (fetal n=20) (fetal n=31) (8/16) (10/15) (n=15) (n=15) (n=16)

17880 Limmanont C. et al. / Thai J Vet Med. 2019. 49(2): 175-182. Figure 4 Linear regression graphs and formulas in dogs (bold line) and cats (dot line); y = fetal HD measured by radiography and x = fetal HD measured by ultrasonography were presented. Discussion and five cats which were diagnosed over 24 hours before parturition. So, fetal HD measurements were The data of this study mostly represents small mostly collected from full term fetuses. Mean±SD of breed dogs (16/24) and brachycephalic breed (4/24), fetal HD by ultrasound in dogs (2.50±0.29 cm) was dog types which are commonly predisposed to dystocia (Johnston et al., 2001). This study shows that closer to the small breed formula [HD (mm) − an oversized-fetal head is not the main cause in 25.11]/0.61 days before birth (Mattoon and Nyland emergency cesarean section in both dogs and cats 1995; Luvoni and Grioni, 2000; Lopate, 2008; Beccaglia (Table 1). This result relates to one retrospective study et al., 2016) than the prediction of the parturition of 182 cases of canine dystocia. The cause of dystocia formula [15×HD (cm)] + 20 = GA (Mattoon and Nyland was from maternal origin in 75.3% of the cases, mainly due to uterine inertia. An oversized fetus causing 1995; Luvoni and Grioni, 2000; Lopate, 2018). This dystocia only occurred in 6.6% of cases for dogs might be because most data from the study was (Ekstrand and Linde-Forsberg, 1994). In a retrospective collected from small breed dogs. When the data is study of 155 dystocia-feline cases, 67.1 % of dystocia focused on 14 toy breed dogs (BW <5 kg), mean±SD of cases were also due to uterine inertia, and only 1.9% of fetal HD obtained from abdominal radiograph and cases were due to an oversized fetus (Darvelid and Linde-Forsberg, 1994). from ultrasonogram changed from 2.83±0.37 to 2.64±0.26 cm, and from 2.50±0.29 to 2.39±0.27 cm, The percentage of fetal heads that could be respectively. The prediction for fetal HD from detected, counted and measured from VD and lateral ultrasonography transferred to fetal HD from radiographic images from the maternal pelvic were radiography following linear regression y = 1.08x+0.13 82.61% and 62.50% in dogs, and 50.00%, and 66.70% in cats, respectively (Table 1). From radiographic images, (R² = 0.73) was relatively accurate. The correlation and some fetal heads could not be measured due to fetal linear regression formula in dogs from this study was postures, not due to the quality of the radiographic suitable to apply to toy breed dogs (BW <5 kg). picture because the radiographic setting was set according to species, part of body, distance, and BW by Fetal HD measurement from abdominal standard digital radiographic machine. In some cases, radiographs was larger than fetal HD measured from VD and lateral radiographs may not be suitable to visualize the fetal head for the proper HD transabdominal ultrasonogram in both dogs and cats measurement. The oblique view can be added in those because of the difference of imaging between the two cases if needed. On the other hand, ultrasonography techniques. Radiographs were imaged from x-rays was more reliable to access fetal head measurement through the object and transferred into a detector. because the ultrasound probe was flexible for Fetus position in the maternal abdomen may cause searching for a good fetal posture. However, ultrasonography is limited on high echogenic objects, increasing distance between each fetal head and especially bone (Kealy et al., 2011), so this technique cassette, which could possibly effect the head size in could not scan for the details if the fetus was under the the image (Kealy et al., 2011). pelvic. A way around the problem, in case HD could not be detected by both VD and lateral radiographic, There are many factors that cause the magnification the correlation HD from the ultrasonographic may be effect in radiography such as object-film distance used to compare with the pelvic inlet diameter from the radiographic, using the formulas from the study. (OFD), focal-film distance (FFD), and focal spot size (Thrall and Widmer, 2013). Object-film distance is the From this study, fetal HD from 82.61% (19/23) of distance from object to the film radiograph. Focal film dogs and 68.75% (11/16) of cats were measured within distance (source-to-image detector or focal-receptor 24 hours of the day of surgery. There were four dogs distance) is the distance from the focal spot to the film radiograph. Focal spot is the area on the anode target of an x-ray tube that is struck by electrons and from which x-rays are emitted (Muhlbauer and Kneller, 2013). Object-film distance of fetal HD is the main factor affecting magnification because FFD and focal spot size were standard set with 100-cm (40-inches)

Limmanont C. et al. / Thai J Vet Med. 2019. 49(2): 175-182. 181 and 1.2, respectively in both dogs and cats. However, Kasetsart Veterinary Imaging and Radiotherapy the fetal HD measurement by radiography was Center, especially, and Dr. Wutthiwong Theerapun for measured compared to the pelvic inlet diameter imaging consultant. without regard to the magnification effect because the distance of the fetus in the abdomen and the pelvic References bone to the film (OFD) are more or less similar to each other. In contrast, ultrasonography was generated Beccaglia M, Alonge S, Trovo' C and Luvoni GC 2016. from echogenicity, the hyperechoic line from head Determination of gestational time and prediction of border was presented. parturition in dogs and cats: an update. Reprod Domest Anim. 51 Suppl 1: 12-17. doi: The parameters tested by two techniques were 10.1111/rda.12782. correlated. Regression squared (R-squared) for cats (R2 = 0.88) was higher than for dogs (R2 = 0.73), although Conn KS, Clarhe MT and Hellett JP 2002. A simple the number of cats (n=16) was less than dogs (n=24). guide to determine the magnification of The variable of breed and BW of dogs might have had radiographs and to improve the accuracy of an effect on R-squared because the higher BW and preoperative templating. JBJS. 84-B, No.2: 269-272. higher body condition score may have led to greater OFD. Therefore, the regression equation of this study Darvelid AW and Linde-Forsberg C 1994. Dystocia in can be used, but it should be used with caution. the bitch: A retrospective study of 182 cases. J Small Anim Pract. 35(8): 402-407. Since the information was obtained within 24 hours before surgical cesarean section, the fetal head was Ekstrand C and Linde-Forsberg C 1994. Dystocia in the nearly full-term. The radiograph of dogs and cats were cat: A retrospective study of 155 cases. J Small also obtained within 24 hours which the dog or cat may Anim Pract. 35(9): 459-464. have been classified in dystocia. Therefore, radiographic pelvic canal diameter measurements Eneroth A, Linde-Forsberg C, Uhlhorn M, and Hall M derived on the day of parturition may have been 1999. Radiographic pelvimetry for assessment of affected by relaxin. Relaxin is known to remodel pelvic dystocia in dogs: a clinical study in two terrier connective tissue and increase the elasticity of the breeds. J Small Anim Pract. 40(6): 257-264. symphysis pubis joint and pelvic ligaments and allowing expansion of the pelvic outlet, subsequently Haney DR, Levy JK and Newell SM 2003. Use of affecting pelvic canal diameter in several species skeletal mineralization for prediction of parturition during pregnancy (Kristiansson et al., 1996). Further date in cats. J Am Vet Med Assoc. 223(11): 1614- study should be conducted to compare significant 1616. increase in pelvic inlet between non-pregnant stage and parturition phase, due to the relaxin effect. Hecht S 2008. Female reproductive tract. In: Atlas of Small Animal Ultrasonography. D Penninck and A larger sample size with various dog breeds and MA d'Anjou (eds). Australia: Blackwell Publishing. adjusted magnification factors of digital x-ray should 401-408. be considered which may provide more accurate information (Conn et al., 2002; Heep et al., 2012). This Heep H, Xu J, Lochteken C and Wedemeyer C 2012. A correlation might be useful in case of using simple and convenient method guide to determine ultrasonography to monitor fetal viability and fetal HD the magnification of digital X-ray for preoperative in order to predict parturition date. Fetal HD measured planning in total hip arthroplasty. Orthopedic from ultrasonography might be able to compare to Reviews. 4:e12: 55-58. pelvic inlet from the previous films of dogs and cats in case radiography is not taken during near term. Johnston SD, Olson PN and Root-Kustritz MV 2001. Pregnancy canine and feline. In: Theriogenology. Fetal HD from both techniques should be Philadelphia: W.B. Saunders. 66-104. compared to actual fetal HD after birth in order to find the best method to evaluate fetal HD in dogs and cats. Kealy JK, McAllister H and Graham JP 2011. The Furthermore magnetic effect including FFD, focal spot radiography. In: Diagnostic Radiology and size and OFD are also important concerns in the Ultrasonography of the Dog and Cat. 5th ed. St different radiographic protocols (Heep et al., 2012). Louis: Elsevier. 1-22. In conclusion, monitoring parturition date and Kinns J and Nelson N 2018. Uterus, ovaries, and testes. dystocia in dogs and cats should combine both In: Text book of Veterinary Diagnosis Radiology 7th techniques for parturition prediction and dystocia ed. DE Thrall (ed). Missouri: Elsevier. 880-882. diagnosis. For good quality images in both techniques, animals should be prepared before examination, such Kristiansson P, Svärdsudd K and von Schoultz B 1996. as by fasting and defecation in order to prevent gastric Back pain during pregnancy: a prospective study. and intestinal contents effecting fetal observation. Spine (Phila Pa 1976). 21(6): 702-9. Acknowledgements Lopate C 2008. Estimation of gestational age and assessment of canine fetal maturation using The financial supports by Research Assistant Funds radiology and ultrasonography: A review. and Kasetsart Veterinary Development Funds, the Theriogenology. 70(3): 397-402. Faculty of Veterinary Medicine, Kasetsart University. Authors would like to thanks Dr. Putinee Sangmanee, Lopate C 2018. Gestational aging and determination of Dr. Hataikarn Seetong for the data collections and parturition date in the bitch and queen using ultrasonography and radiography. Vet Clin Small Anim. 48(4): 617-638. Luvoni GC and Grioni A 2000. Determination of gestation age in medium and small size bitches using ultrasonographic fetal measurements. J Small Anim Pract. 41(7): 292-294. Mattoon JS and Nyland TG 1995. Ovaries and uterus. In: Small Animal Diagnostic Ultrasound. TG

182 Limmanont C. et al. / Thai J Vet Med. 2019. 49(2): 175-182. Nyland and JS Mattoon (eds). Philadelphia: W.B. Saunders. 231-249. Muhlbauer MC and Kneller SK 2013. Radiography of the Dog and Cat: Guide to Making and Interpreting Radiographs. Iowa: Wiley-Blackwell. 463 pp. Rendano VT, Lein DH and Concannon PW 1984. Radiographic evaluation of prenatal development in the beagle: correlation with time of breeding, LH release, and parturition. Vet Radiol. 25(3): 132-141. Thrall DE and Widmer WR 2013. Radiation protection and physics of diagnostic radiology. In: Text book of Veterinary Diagnosis Radiology. 6th ed. DE Thrall (ed). Missouri: Elsevier. 14-17. Yeager AE, Mohammed HO, Mayer-Wallen V, Vannerson L and Concannon PW 1992. Ultrasonographic appearance of the uterus, placenta, fetus, and fetal membranes throughout accurately timed pregnancy in beagles. Am J Vet Res. 53(3): 342-351. Zambelli D, Canepele B, Bassi S and Paladini C 2002. Ultrasound aspects of fetal and exterfetal structures in pregnant cats. J Feline Med Surg. 4(2): 95-106.

Original Article Effects of activin A on the pluripotency of induced pluripotent stem cells derived from porcine Sertoli cells Piyathip Setthawong1 Theerawat Tharasanit1 Mongkol Techakumphu1* Abstract The Activin/Nodal signaling pathway is necessary for promoting the self-renewal and pluripotency in several species. However, these effects in porcine stem cells have yet to be examined. We hypothesized that Activin/Nodal signaling could be an important factor for maintenance of porcine induced pluripotent stem cells (iPSCs). The effects of activin A on pluripotency of porcine iPSCs derived from Sertoli cells were examined. Two iPS cell lines were cultured with different culture conditions (control, activin A, TGF-β1 inhibitor and activin A combined with TGF-β1 inhibitor). The Sertoli iPSCs treated with different conditions were compared for morphology, alkaline phosphatase (AP) activity, OCT4 protein expression and quantitative expression of genes (endogenous pluripotency genes and cell differentiated genes). This study revealed that the activin A treated iPSCs increased intensity of OCT4 protein expression. Furthermore, expressions of the pluripotent genes including OCT4 and NANOG were significantly upregulated in the activin A treated group (P < 0.05). In contrast, the selective TGF-β1 inhibitor adversely affected to iPSCs morphology and patterns of the AP and OCT4 protein expression. The TGF-β1 inhibitor also resulted in significant upregulation and downregulation for DES (mesoderm differentiation) and GATA6 (endoderm differentiation), respectively (P < 0.05) when compared with other groups. In conclusion, activin A significantly upregulated the endogenous expression of OCT4 and NANOG pluripotent genes, thereby improving networks of the pluripotency in porcine iPSCs. Keywords: activin A, induced pluripotent stem cells, pluripotency, porcine, Sertoli cells, TGF-β1 inhibitor 1Department of Obstetrics, Gynaecology and Reproduction, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailand 10330 *Correspondence: [email protected] (M. Techakumphu) Thai J Vet Med. 2019. 49(2): 183-191.

184 Setthawong P. et al. / Thai J Vet Med. 2019. 49(2): 183-191. Introduction pluripotency genes. Of the key pluripotency factors including OCT4, NANOG and SOX2 genes (Vallier et Pigs have become an effective large animal model al., 2009), the OCT4 is one of the most important for regenerative medicine as their organ size, transcription factors required for maintaining an physiology and functions are comparable to human undifferentiated state and pluripotency (Niwa et al., (Ye et al., 2014; Shiue et al., 2016). They have been 2000; Pesce and Scholer, 2001; Kellner and Kikyo, widely used for research in cardiovascular diseases, 2010). SOX2 acts synergistically with OCT4 to activate wound healing, diabetes, spinal cord injuries and OCT-SOX enhancers, which regulate expression of xenotransplantation (Cibelli et al., 2013). Pluripotent specific genes in the pluripotent stem cells (Masui et al., stem cells including embryonic stem (ES) cells and 2007). Moreover, expression of NANOG has been induced pluripotent stem cells (iPSCs) essentially recognized to be upregulated in iPSCs and is necessary require two important properties of self-renewal and to block endoderm differentiation (Vallier et al., 2009; pluripotency (Romito and Cobellis, 2016). Although Hackett and Fortier, 2011). Alberio et al. (2010) first the ES cells, isolated from the inner cell mass of demonstrated that porcine epiblast stem cells (EpiSC), blastocyst stage embryos, have been described as derived from days 10.5-12 embryos required pluripotent stem cells, the isolation and culture of Activin/Nodal signaling for the expression of the core porcine ES cells remain difficult (Plusa and pluripotent genes and self-renewal maintenance. Hadjantonakis, 2014). In addition, none of authentic Porcine EpiSC cultured with ALK5 inhibitor porcine ES cells have been established (Hou et al., differentiated into neuronal lineage (Alberio et al., 2016). More recently, the iPSCs are initially generated 2010). However, knowledge on the importance of by introduction of ectopic transcription factors: OCT4, Activin/Nodal pathways for maintaining SOX2, KLF4 and c-MYC (OSKM or Yamanaka factors) pluripotency of porcine iPSCs is fairly limited. into adult somatic cells (Takahashi and Yamanaka, 2006). The advantages of iPSCs are lesser ethical issues In the current study, we used porcine Sertoli iPSCs (King and Perrin, 2014), and the generation of pig (Setthawong et al., 2019) for investigating the effects of iPSCs has been more successful compared to the ES activin A on pluripotency of porcine iPSCs cultured cells (Esteban et al., 2009; Wu et al., 2009; Montserrat et either with or without TGF-β1inhibitor. We al., 2011; Fujishiro et al., 2013; Gao et al., 2014; Du et al., hypothesized that supplementation of activin A into 2015; Ma et al., 2018). However, the signaling pathway porcine iPSCs culture would improve the maintenance for maintenance of porcine iPSCs is still obscure properties and also increase the expression levels of (Fujishiro et al., 2013). The pluripotent states of the pluripotency genes in a defined culture condition. porcine iPS-cell lines were derived from cell culture with additions of leukemia inhibitory factor (LIF) Materials and Methods (Cheng et al., 2012; Rodriguez et al., 2012; Fujishiro et al., 2013; Ma et al., 2018), basic fibroblast growth factor Animal ethics and biosafety:Animal maintenance, care (bFGF) (Ezashi et al., 2009; West et al., 2010; Hall et al., and use protocol were performed according to the 2012) or both LIF and bFGF (Montserrat et al., 2011; Animal Ethics Approval of Chulalongkorn University Zhang et al., 2015; Setthawong et al., 2019). (No. 1673028). The biosafety was performed following Optimization of cell culture conditions for porcine the guidelines of the Institutional Biosafety Committee iPSCs is therefore necessary to improve the consensus of the Faculty of Veterinary Science, Chulalongkorn generation and maintenance of porcine pluripotent University (IBC1631022). stem cells (Gao et al., 2014). Previous study demonstrated that mouse ES cells required LIF for the Generation and characterization of porcine Sertoli maintenance of the naïve state of pluripotency induced pluripotent stem cells: Porcine Sertoli iPSCs (Saunders et al., 2013; Onishi and Zandstra, 2015). were generated and characterized as previously However, mouse epiblast stem cells and human ES reported (Setthawong et al., 2019). Two Sertoli iPSC- cells required bFGF and Activin/Nodal signaling for like cell lines (PS-R8 and PS-R29) were used in this self-renewal and maintaining the pluripotency (Vallier study. Prior to use, the Sertoli iPSCs were characterized et al., 2005; Vallier et al., 2009). The importance of these by alkaline phosphatase staining (AP), OCT4 signals for maintaining the porcine iPSCs remained to immunofluorescent staining and in vitro be entirely elucidated. differentiation. Activin/Nodal growth factors are important to Activin A and TGF-β1 inhibitor treatments during control biological activities, including cell cycle iPSCs cultivation: The Sertoli iPSCs (PS-R8 and PS- progression, progenitor proliferation, differentiation R29, passage 15) were divided into 4 groups (control, during organogenesis (Gritsman et al., 2000; Brennan et activin A, TGF-β1 inhibitor and activin A combined al., 2001) and adult tissue homeostasis (Strizzi et al., with TGF-β1 inhibitor). The Sertoli iPSCs were 2012). Activins bind to serine/threonine kinase cultured in a defined medium containing DMEM F-12 receptors, type I and type II activin receptors, leading (Gibco) supplemented with 20% (v/v) of knockout to the phosphorylation and activation of the Smad2 serum replacement (Gibco), 1% (v/v) of a non-essential and Smad3 downstream pathway. The Smad2 and amino acid solution (Sigma), L-glutamine and an Smad3 subsequently form a complex with the Smad4 antibiotic (1 mM, Gibco), β-mercaptoethanol (0.1 mM, and translocate to the nucleus (Pauklin and Vallier, Gibco), 10 ng/ml human leukaemia inhibitory factor 2015). This complex activates the target genes which (hLIF, Millipore) and 10 ng/ml basic fibroblast growth are bound with the transcriptional networks of OCT4 factor (bFGF, BioVision). For activin A and TGF-β1 and NANOG proteins for the maintenance of inhibitor treated groups, the Sertoli iPSCs were treated

Setthawong P. et al. / Thai J Vet Med. 2019. 49(2): 183-191. 185 with 10 ng/ml activin A (338-AC, R&D Systems) and of treatment. Quantitative analysis of gene expression 1µM TGF-β1 inhibitor (A83-01, Biovision), was analyzed by using relative real-time polymerase respectively. Sertoli iPSCs were cultured in the chain reaction (qPCR) in control group, activin A treatment conditions for 48 h (Tojo et al., 2005; treated group, TGF-β1 inhibitor treated group and Tomizawa et al., 2011; Yang et al., 2017). The Sertoli activin A combined with TGF-β1 inhibitor treated iPSCs cultured in iPS medium without activin A and group. Total RNA was extracted from PS-R29 passage TGF-β1 inhibitor served as a control group. The Sertoli 15 treated cells using RNeasy mini kit (Qiagen, Hilden, iPSCs with different treatments were compared for Germany) according to the manufacturer’s morphology, AP activity, OCT protein expression and instructions. The amount of RNA was measured by quantitative expression of genes (endogenous Nanodrop 2000 spectrophotometer (ThermoFisher pluripotency and differentiation of three germ layers). Scientific, USA) and immediately stored at -80°C until used. The DNA contamination was treated by using Alkaline phosphatase staining and DNase I (Promega, WI, USA). The cDNA was immunofluorescent microscopy: Activity of AP in the synthesized by ImProm-II™ Reverse Transcription System (Promega, WI, USA). Nuclease-free water was Sertoli iPSCs was performed using the AP kit (Sigma- used in qPCR reaction as no template control. The qPCR was performed on ABI 7300 Real-time cycler Aldrich). For immunofluorescent staining, the Sertoli (Applied Biosystems, Foster City, CA, USA). The qPCR iPSCs were fixed in 4% (w/v) paraformaldehyde in a reactions (15 μl) were amplified with KAPA SYBR® FAST qPCR Kits (KK4600). Target forward and reverse phosphate-buffered saline (Gibco) and permeabilized primers (200 nM) were added into master mix reaction. The relative expression levels of OCT4, SOX2, with 0.1% Triton X-100 and 2% bovine serum albumin NANOG, NES, DES and GATA6 genes were for 15 min. The cells were then incubated with a normalized to an endogenous control gene (β-ACTIN). The qPCR condition was performed as the following: polyclonal antibody goat against OCT4 protein (IgG; stage 1 of 50°C for 2 min and stage 2 of 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 15 s 1:150) at 37°C for 1 h. The samples were then incubated and 60°C for 30 s and annealing/extension 72°C for 1 with a secondary antibody labelled with Fit-C min. Data were reported as the relative expression difference in relation to the control group. The specific fluorescence at 37°C for 1 h. The DAPI was used to primers are listed in Table 1. label DNA/nucleus. Determination of pluripotency and differentiation of three germ layers: The levels of expression of pluripotency markers (OCT4, SOX2 and NANOG) and three germ layer markers (ectoderm: NES, mesoderm: DES, endoderm: GATA6) were investigated after 48 h Table 1 Porcine specific primer sequences used for quantitative polymerase chain reaction Primer name Sequence Accession Amplicon size β-ACTIN Number (bp) OCT4 F: TCCCTGGAGAAGAGCTACGA AJ312193 159 SOX2 R: CGCACTTCATGATCGAGTTG NANOG F: GGAAGAGAAAGCGGACAAGT NM001113060.1 216 NESTIN R: CAGCAGCCTCAAAATCCTCT DESMIN F: CTACAGCATGTCCTACTCGC EU503117 274 GATA6 R: GGGCAGTGTACCGTTGATG F: CGAATGAAATGTAAGAGGT DQ447201.1 162 R: CCAGCTCTGATTACCCCAC F: GGCTTCTCTCAGCATCTTGG XM_013996960.1 150 R: AAGGCTGGCATAGGTGTGTC F: CCTCAACTTCCGAGAAACAAGC NM_001001535.1 108 R: TCACTGACGACCTCCCCATC F: CTCCATTCAGACGCCGCTAT NM_214328.2 109 R: CTGAGGCCGTTCATCTTGCT Statistical analysis: The experiments were replicated cytoplasm ratio with prominent nucleoli (Fig. 1A). three times and performed using two iPSC cell lines These colonies were positive for AP staining (Fig. 2A) (PS-R8 and PS-R29). All data is expressed as mean ± and OCT4 protein (green) observed in the cell nuclei SD. Normal distribution was tested by Shapiro test. (Fig. 2B and 2C). Differentiation property of the Sertoli One-way ANOVA and Tukey's Multiple Comparison iPSCs was examined by in vitro embryoid body Test analysis were used to test the differences in gene expression between treatment groups. All statistical formation (Fig. 1B). Two iPS cell lines (PS-R8 and 29) analyses were performed with SPSS version 22.0.0 were cultured in control and treatment groups (activin (IBM, Armonk, NY, USA). P values less than 0.05 were A, TGF-β1 inhibitor, and activin A combined with TGF- considered statistically significant. β1 inhibitor). In control group, Sertoli iPSC colonies showed round morphology, clear border and positive Results to AP and OCT4 staining (Fig. 3A-D). The porcine Sertoli iPSCs were generated by retrovirus iPSCs treated with 10 ng/ml activin A had transduction with OSKM. The iPSC colonies had a morphology and were positive to AP staining similar clear border, flattened cells and high nucleus-to- to that of the control group. However, activin A treated iPSCs increased intensity of OCT4 expression when compared with the control (Fig. 3E-H). Furthermore,

186 Setthawong P. et al. / Thai J Vet Med. 2019. 49(2): 183-191. addition of TGF-β1 inhibitor adversely affected to in the porcine iPSCs were significantly upregulated in iPSCs morphology. These iPSC colonies had loose activin A treated group (Fig. 4A and 4C). There was no morphology, increased intercellular spaces and tended significant difference in level expressions of SOX2 in to differentiation. In addition, the intensity of AP and activin A, TGF-β1 inhibitor and activin A combined OCT4 staining were subjectively decreased, especially with TGF-β1 inhibitor groups (Fig. 4B). For expression for OCT4 protein (Fig. 3I-L). It was noticeable for of differentiation of the three germ layer genes, the activin A combined with TGF-β1 inhibitor group that expression of DES (mesoderm gene) was significantly the iPSCs demonstrated morphology similar to the upregulated in TGF-β1 inhibitor treated group (Fig. control group but the mixture patterns of AP and 4E), while GATA6 (endoderm gene) was significantly OCT4 positive staining was found (Fig. 3M-P). To downregulated in this group (Fig. 4F). However, there further investigate the effects of activin A and TGF-β1 was no difference in the expression levels of NES inhibitor on gene expression, qPCR revealed that the (ectoderm gene) in each group (Fig. 4D). expression of pluripotency genes (OCT4 and NANOG) Figure 1 The morphology of porcine iPSCs derived from Sertoli cells at passage 15 (A). In vitro differentiation of Sertoli iPSCs showed EB formation on day 3 (B). Scale bar represents 100 µm. Figure 2 The iPSC colonies strongly expressed AP (A, scale bar =50 μm). The pluripotency marker of OCT4 protein was indicated using immunofluorescent staining (B). DAPI was used as a counterstaining (C). The scale bars (B and C) represent 20 µm.

Setthawong P. et al. / Thai J Vet Med. 2019. 49(2): 183-191. 187 Figure 3 Characterization of Sertoli iPSC-like cells derived from different treatment condition (PS-R29, passage 15). The morphologies, AP (Scale bar represents 50 µm) and immunofluorescent staining (pluripotency markers OCT4, Scale bar represents 20 µm) were demonstrated after treated with activin A, TGF-β1 inhibitor or activin A combined with TGF-β1 inhibitor for 48 h.

188 Setthawong P. et al. / Thai J Vet Med. 2019. 49(2): 183-191. Pluripotency markers Differentiation markers A OCT4 D Ectoderm: NESTIN 2.5 a 1.5 2 Relative expression bb Relative expression 1 aa 1.5 a 1 0.5 0.5 2 TGF-β 13inhibitor 4 A5ctivin + 0 2 TGF-β 13inhibitor 4 A5ctivin + Acti1vin 0 TGF-β 1 inhibitor Activ1in TGF-β 1 inhibitor B SOX2 E Mesoderm: DESMIN 2 a a 1.5 Relative expression 1.5 Relative expression a a 1 1 b b 0.5 0.5 0 2 TGF-β 13inhibitor 4 A5ctivin + 0 2 TGF-β 13inhibitor 4 Ac5tivin + Activ1in Acti1vin TGF-β 1 inhibitor TGF-β 1 inhibitor C NANOG F Endoderm: GATA6 a 4 2 3 Relative expression 2 Relative expression 1.5 b 1 b 0 b 1a Activ1in b 0.5 2 TGF-β 13inhibitor 4 A5ctivin + 0 2 TGF-β 13inhibitor 4 A5ctivin + Activ1in TGF-β 1 inhibitor TGF-β 1 inhibitor Figure 4 Quantitative RT-PCR analysis of mRNA expression levels of pluripotency markers (OCT4, SOX2 and NANOG) and differentiation markers (ectoderm: NES, mesoderm: DES, endoderm: GATA6). a,b Different letters on bars indicate values that are significantly different (P < 0.05) when compared among treatment groups. Discussion (Fujishiro et al., 2013; Park et al., 2013). The Sertoli cells are indeed specialized cells of the testis. These cells Porcine iPSCs have become an alternative choice of have been demonstrated to efficiently reprogram in porcine ES cells in terms of its similarity in pluripotent properties (Ezashi et al., 2012) while they have less several species such as mouse and pig (Sun et al., 2014; ethical concerns. These cells have been proposed as a Wang et al., 2014; Setthawong et al., 2019). In the model for cell therapy in human (Koh and Piedrahita, present study, we examined the effects of activin A on 2014). However, the different culture conditions porcine iPSCs on certain gene expressions induced non-uniformity of porcine iPS-cell lines that (pluripotency and differentiation genes) following were maintained in either naïve or primed stage activin or its inhibitor treatments. According to previous study, Activin/Nodal signaling is important

Setthawong P. et al. / Thai J Vet Med. 2019. 49(2): 183-191. 189 for porcine EpiSC self-renewal and maintains NANOG genes. We suggested that addition of activin pluripotency (Alberio et al., 2010). We considered that A would be beneficial for maintenance of self-renewal porcine iPSCs might also rely on Activin/Nodal in porcine iPSCs. Further research is still needed to prove the long-term effects of the activin A on cell pathway. This study used a defined serum-free pluripotency. replacement (KSR) instead of FBS as we aimed at examining the effects of activin A on porcine iPSCs. Conflict of interest: The authors declare that they have Animal proteins such as fetal bovine serum have been no conflicts of interest. demonstrated to interact and induce differentiation of Acknowledgements pluripotent state (Vackova et al., 2007). This defined condition is ideal for examining the cellular responses This study was financially supported by the in actvin A and its inhibitor treatments. The optimal Thailand Research Fund (RSA6180053), the Special doses of 10 ng/ml activin A and 1µM TGF-β1 inhibitor Task Force for Activating research (STAR 59-007-31- (A83-01) used in this study were chosen according to 005), MSCA Rise (EU H2020 Drynet), GA 734434, and Chulalongkorn University. Piyathip Setthawong is previous publications (Telugu et al., 2010; Tomizawa et granted by the Royal Golden Jubilee Ph.D. Program al., 2011; Klincumhom et al., 2014; Hou et al., 2016; Yang (grant No. PHD/0143/2556) and 90th Anniversary et al., 2017). As expected, activin A improved Ratchadaphiseksomphot Endowment Fund. pluripotency of porcine iPSCs in terms of AP activity and OCT4 protein expression. This coincided with the References findings that activin A significantly upregulated the Alberio R, Croxall N and Allegrucci C 2010. Pig endogenous pluripotent genes such as OCT4 and epiblast stem cells depend on activin/nodal NANOG. Indeed, Activin/Nodal pathway plays an signaling for pluripotency and self-renewal. Stem active role to maintain the expression of core Cells Dev. 19(10): 1627-1636. pluripotency factors including OCT4 and NANOG Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, (Vallier et al., 2009). These two genes are co-regulatory Zucker JP, Guenther MG, Kumar RM, Murray HL, of maintenance of pluripotency and inhibition of Jenner RG, Gifford DK, Melton DA, Jaenisch R and differentiation (Boyer et al., 2005). In porcine Young RA 2005. Core transcriptional regulatory pluripotent stem cells, activin A signaling could circuitry in human embryonic stem cells. Cell. promote OCT4 and NANOG expression via Smad2 and 122(6): 947-956. 3 cascades, thereby increasing the pluripotency and Brennan J, Lu CC, Norris DP, Rodriguez TA, inhibition of differentiation (Brevini et al., 2012). This Beddington RS and Robertson EJ 2001. Nodal transduction pathway appeared to conserve among signalling in the epiblast patterns the early mouse species (Vallier et al., 2009; Alberio et al., 2010). embryo. Nature. 411(6840): 965-969. However, there was no significant difference in the Brevini T, Pennarossa G, Maffei S and Gandolfi F 2012. level expression of SOX2 between treatment groups. Pluripotency network in porcine embryos and The possible reason for this may link to the fact that the derived cell lines. Reprod Domest Anim. 47 Suppl upstream SOX2 expression is not directly controlled by 4: 86-91. the activin signaling (Dabdoub et al., 2008). When the activin A is inhibited using a selective TGF-β1inhibitor Cheng D, Guo Y, Li Z, Liu Y, Gao X, Gao Y, Cheng X, Hu J and Wang H 2012. Porcine induced with small molecule A83-01, the porcine iPSCs pluripotent stem cells require LIF and maintain changed in colony morphology, pattern of AP activity, their developmental potential in early stage of and OCT4 protein expression. Moreover, the TGF- embryos. PLoS One. 7(12): e51778. β1inhibitor treated group significantly downregulated the OCT4 and NANOG genes, while a gene associated Cibelli J, Emborg ME, Prockop DJ, Roberts M, Schatten G, Rao M, Harding J and Mirochnitchenko O 2013. with differentiation (DES) were upregulated. These Strategies for improving animal models for findings are contradictory with other studies that the regenerative medicine. Cell Stem Cell. 12(3): 271- inhibition of activin signaling led the pluripotent stem 274. cells to differentiate toward the ectoderm lineage (Alberio et al., 2010; Gafni et al., 2013). However, TGF- Dabdoub A, Puligilla C, Jones JM, Fritzsch B, Cheah KS, Pevny LH and Kelley MW 2008. Sox2 signaling β1inhibitor treated group significantly downregulated in prosensory domain specification and subsequent the endoderm GATA 6 gene similar to a previous hair cell differentiation in the developing cochlea. report indicating that the TGF-β1inhibitor blocked the Proc Natl Acad Sci U S A. 105(47): 18396-18401. expression of endoderm markers and promoted the expression of mesoderm markers in the presence of Du X, Feng T, Yu D, Wu Y, Zou H, Ma S, Feng C, Huang Y, Ouyang H, Hu X, Pan D, Li N and Wu S BMP4 in vitro (Pauklin and Vallier, 2015). This adverse 2015. Barriers for Deriving Transgene-Free Pig iPS effect of the inhibitor on pluripotency could be Cells with Episomal Vectors. Stem Cells. 33(11): partially reversed if the TGF-β1 inhibitor was 3228-3238. simultaneously added into the medium with activin A. It is therefore suggested that the TGF-β1inhibitor used Esteban MA, Xu J, Yang J, Peng M, Qin D, Li W, Jiang Z, Chen J, Deng K, Zhong M, Cai J, Lai L and Pei D in the current study could not completely inhibit the 2009. Generation of induced pluripotent stem cell actions of activin A or full effect of the inhibition may lines from Tibetan miniature pig. J Biol Chem. require a longer time of exposure. 284(26): 17634-17640. In conclusion, Activin/Nodal signaling is important for self-renewal and maintenance of pluripotency in porcine iPSCs. The activin A promoted the expression of endogenous pluripotent genes including OCT4 and

190 Setthawong P. et al. / Thai J Vet Med. 2019. 49(2): 183-191. Ezashi T, Telugu BP, Alexenko AP, Sachdev S, Sinha S Masui S, Nakatake Y, Toyooka Y, Shimosato D, Yagi R, and Roberts RM 2009. Derivation of induced Takahashi K, Okochi H, Okuda A, Matoba R, pluripotent stem cells from pig somatic cells. Proc Sharov AA, Ko MS and Niwa H 2007. Pluripotency Natl Acad Sci U S A. 106(27): 10993-10998. governed by Sox2 via regulation of Oct3/4 Ezashi T, Telugu BP and Roberts RM 2012. Induced expression in mouse embryonic stem cells. Nat Cell Biol. 9(6): 625-635. pluripotent stem cells from pigs and other ungulate Montserrat N, Bahima EG, Batlle L, Hafner S, species: an alternative to embryonic stem cells? Rodrigues AM, Gonzalez F and Izpisua Belmonte Reprod Domest Anim. 47 Suppl 4: 92-97. JC 2011. Generation of pig iPS cells: a model for cell Fujishiro SH, Nakano K, Mizukami Y, Azami T, Arai Y, therapy. J Cardiovasc Transl Res. 4(2): 121-130. Matsunari H, Ishino R, Nishimura T, Watanabe M, Niwa H, Miyazaki J and Smith AG 2000. Quantitative Abe T, Furukawa Y, Umeyama K, Yamanaka S, expression of Oct-3/4 defines differentiation, Ema M, Nagashima H and Hanazono Y 2013. dedifferentiation or self-renewal of ES cells. Nat Generation of naive-like porcine-induced Genet. 24(4): 372-376. pluripotent stem cells capable of contributing to Onishi K and Zandstra PW 2015. LIF signaling in stem embryonic and fetal development. Stem Cells Dev. 22(3): 473-482. cells and development. Development. 142(13): Gafni O, Weinberger L, Mansour AA, Manor YS, 2230-2236. Chomsky E, Ben-Yosef D, Kalma Y, Viukov S, Maza Park JK, Kim HS, Uh KJ, Choi KH, Kim HM, Lee T, I, Zviran A, Rais Y, Shipony Z, Mukamel Z, Yang BC, Kim HJ, Ka HH, Kim H and Lee CK 2013. Krupalnik V, Zerbib M, Geula S, Caspi I, Schneir D, Primed pluripotent cell lines derived from various Shwartz T, Gilad S, Amann-Zalcenstein D, embryonic origins and somatic cells in pig. PLoS Benjamin S, Amit I, Tanay A, Massarwa R, One. 8(1): e52481. Novershtern N and Hanna JH 2013. Derivation of Pauklin S and Vallier L 2015. Activin/Nodal signalling novel human ground state naive pluripotent stem in stem cells. Development. 142(4): 607-619. cells. Nature. 504(7479): 282-286. Pesce M and Scholer HR 2001. Oct-4: gatekeeper in the Gao Y, Guo Y, Duan A, Cheng D, Zhang S and Wang H 2014. Optimization of culture conditions for beginnings of mammalian development. Stem maintaining porcine induced pluripotent stem Cells. 19(4): 271-278. Plusa B and Hadjantonakis AK 2014. Embryonic stem cells. DNA Cell Biol. 33(1): 1-11. Gritsman K, Talbot WS and Schier AF 2000. Nodal cell identity grounded in the embryo. Nat Cell Biol. 16(6): 502-504. signaling patterns the organizer. Development. Rodriguez A, Allegrucci C and Alberio R 2012. 127(5): 921-932. Modulation of pluripotency in the porcine embryo Hackett CH and Fortier LA 2011. Embryonic stem cells and iPS cells. PLoS One. 7(11): e49079. and iPS cells: sources and characteristics. Vet Clin Romito A and Cobellis G 2016. Pluripotent Stem Cells: North Am Equine Pract. 27(2): 233-242. Current Understanding and Future Directions. Hall VJ, Kristensen M, Rasmussen MA, Ujhelly O, Stem Cells Int. 2016: 9451492. Dinnyes A and Hyttel P 2012. Temporal repression of endogenous pluripotency genes during Saunders A, Faiola F and Wang J 2013. Concise review: pursuing self-renewal and pluripotency with the reprogramming of porcine induced pluripotent stem cells. Cell Reprogram. 14(3): 204-216. stem cell factor Nanog. Stem Cells. 31(7): 1227-1236. Hou DR, Jin Y, Nie XW, Zhang ML, Ta N, Zhao LH, Setthawong P, Phakdeedindan P, Tiptanavattana N, Yang N, Chen Y, Wu ZQ, Jiang HB, Li YR, Sun QY, Dai YF and Li RF 2016. Derivation of Porcine Rungarunlert S, Techakumphu M and Tharasanit T 2019. Generation of porcine induced-pluripotent Embryonic Stem-Like Cells from In Vitro-Produced stem cells from Sertoli cells. Theriogenology. 127: Blastocyst-Stage Embryos. Sci Rep. 6: 25838. Kellner S and Kikyo N 2010. Transcriptional regulation 32-40. of the Oct4 gene, a master gene for pluripotency. Shiue YL, Yang JR, Liao YJ, Kuo TY, Liao CH, Kang Histol Histopathol. 25(3): 405-412. CH, Tai C, Anderson GB and Chen LR 2016. King NM and Perrin J 2014. Ethical issues in stem cell Derivation of porcine pluripotent stem cells for research and therapy. Stem Cell Res Ther. 5(4): 85. biomedical research. Theriogenology. 86(1): 176- Klincumhom N, Tharasanit T, Thongkittidilok C, 181. Tiptanavattana N, Rungarunlert S, Dinnyes A and Strizzi L, Hardy KM, Kirschmann DA, Ahrlund- Techakumphu M 2014. Selective TGF-beta1/ALK Richter L and Hendrix MJ 2012. Nodal expression inhibitor improves neuronal differentiation of and detection in cancer: experience and challenges. mouse embryonic stem cells. Neurosci Lett. 578: 1- Cancer Res. 72(8): 1915-1920. 6. Koh S and Piedrahita JA 2014. From \"ES-like\" cells to Sun H, Zhang G, Dong F, Wang F and Cao W 2014. induced pluripotent stem cells: a historical Reprogramming sertoli cells into pluripotent stem cells. Cell Reprogram. 16(3): 196-205. perspective in domestic animals. Theriogenology. 81(1): 103-111. Takahashi K and Yamanaka S 2006. Induction of Ma Y, Yu T, Cai Y and Wang H 2018. Preserving self- pluripotent stem cells from mouse embryonic and renewal of porcine pluripotent stem cells in serum- free 3i culture condition and independent of LIF adult fibroblast cultures by defined factors. Cell. 126(4): 663-676. and b-FGF cytokines. Cell Death Discov. 4: 21. Telugu BP, Ezashi T and Roberts RM 2010. Porcine induced pluripotent stem cells analogous to naive and primed embryonic stem cells of the mouse. Int J Dev Biol. 54(11-12): 1703-1711.

Setthawong P. et al. / Thai J Vet Med. 2019. 49(2): 183-191. 19819 Tojo M, Hamashima Y, Hanyu A, Kajimoto T, Saitoh M, Miyazono K, Node M and Imamura T 2005. The ALK-5 inhibitor A-83-01 inhibits Smad signaling and epithelial-to-mesenchymal transition by transforming growth factor-beta. Cancer Sci. 96(11): 791-800. Tomizawa M, Shinozaki F, Sugiyama T, Yamamoto S, Sueishi M and Yoshida T 2011. Activin A maintains pluripotency markers and proliferative potential of human induced pluripotent stem cells. Exp Ther Med. 2(3): 405-408. Vackova I, Ungrova A and Lopes F 2007. Putative embryonic stem cell lines from pig embryos. J Reprod Dev. 53(6): 1137-1149. Vallier L, Alexander M and Pedersen RA 2005. Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells. J Cell Sci. 118(Pt 19): 4495-4509. Vallier L, Mendjan S, Brown S, Chng Z, Teo A, Smithers LE, Trotter MW, Cho CH, Martinez A, Rugg-Gunn P, Brons G and Pedersen RA 2009. Activin/Nodal signalling maintains pluripotency by controlling Nanog expression. Development. 136(8): 1339-1349. Wang X, Qin J, Zhao RC and Zenke M 2014. Reduced immunogenicity of induced pluripotent stem cells derived from Sertoli cells. PLoS One. 9(8): e106110. West FD, Terlouw SL, Kwon DJ, Mumaw JL, Dhara SK, Hasneen K, Dobrinsky JR and Stice SL 2010. Porcine induced pluripotent stem cells produce chimeric offspring. Stem Cells Dev. 19(8): 1211- 1220. Wu Z, Chen J, Ren J, Bao L, Liao J, Cui C, Rao L, Li H, Gu Y, Dai H, Zhu H, Teng X, Cheng L and Xiao L 2009. Generation of pig induced pluripotent stem cells with a drug-inducible system. J Mol Cell Biol. 1(1): 46-54. Yang F, Wang N, Wang Y, Yu T and Wang H 2017. Activin-SMAD signaling is required for maintenance of porcine iPS cell self-renewal through upregulation of NANOG and OCT4 expression. J Cell Physiol. 232(8): 2253-2262. Ye L, Chang YH, Xiong Q, Zhang P, Zhang L, Somasundaram P, Lepley M, Swingen C, Su L, Wendel JS, Guo J, Jang A, Rosenbush D, Greder L, Dutton JR, Zhang J, Kamp TJ, Kaufman DS, Ge Y and Zhang J 2014. Cardiac repair in a porcine model of acute myocardial infarction with human induced pluripotent stem cell-derived cardiovascular cells. Cell Stem Cell. 15(6): 750-761. Zhang W, Pei Y, Zhong L, Wen B, Cao S and Han J 2015. Pluripotent and Metabolic Features of Two Types of Porcine iPSCs Derived from Defined Mouse and Human ES Cell Culture Conditions. PLoS One. 10(4): e0124562.



Short Communication Bacteremia and Multidrug Resistance in Naturally Parvovirus Infection Dogs Jutapoln Sunghan1 Duangporn Pichpol2 Phongsakorn Chuammitri2,3 Areerath Akatvipat4* Abstract Antimicrobials are not indicated for treating viral infections; however, secondary bacteremia is an important complication of canine parvovirus infection. The present study aimed to identify the bacteremia and multidrug- resistant bacteria in naturally parvovirus-infected dogs. A total of 50 dogs with canine parvovirus infection were enrolled in the present study. Blood samples were serially collected from the jugular vein with a sterile technique on days 0, 3, 5 and 7 of hospitalization, until the dog died or was discharged, to perform aerobic bacterial hemoculture. The disk diffusion method was used for the antimicrobial susceptibility test. Overall, 13 of 83 blood samples (15.7%) tested positive for bacterial culture [11 of 50 parvovirus-infected dogs (22.0%)]. Bacteremia and multidrug-resistant bacteria were found on each of the days during the period of parvovirus infection and more than one kind of bacteria was present in individual dogs. The isolated bacteria were Escherichia coli, Enterobacter species, Pseudomonas aeruginosa, Klebsiella pneumonia, Coagulase-negative staphylococci, and non-hemolytic streptococci group D (enterococci). In conclusion, bacteremia and multidrug-resistant pathogens were present on each day during canine parvovirus infection. Performing hemoculture in each case of canine parvovirus infection must be encouraged to enhance the therapeutic outcome. Keywords: Bacteremia, Dog, Hemoculture, Multidrug resistance (MDR), Parvovirus infection 1Faculty of Veterinary Science, Prince of Songkla University, Songkhla, Thailand 90110 2Department of Veterinary Biosciences and Public Health, Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai, Thailand 50100 3Excellent Center in Veterinary Biosciences (ECVB), Chiang Mai University, Chiang Mai, Thailand 50100 4Department of Companion Animals and Wildlife Clinic, Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai, Thailand 50100 .*Correspondence: [email protected], [email protected] (A Akatvipat) Thai J Vet Med. 2019. 49(2): 193-196.

194 Sunghan J. et al. / Thai J Vet Med. 2019. 49(2): 193-196. Introduction antimicrobials that are commonly used in small-animal practice. The intrinsic antimicrobials resistance of each Canine parvovirus (CPV) is the main cause of bacterium (Giguere et al., 2013; Mackie, 2017) was gastrointestinal infection in unvaccinated or indicated (Table 2). incompletely vaccinated dogs (Pollock and Coyne, 1993). Supportive therapy and preventing secondary Results and Discussion infections are the recommended treatment (Nandi and Kumar, 2010). The frequently used antimicrobials are Overall, 13 out of 83 blood samples (15.7%), which amoxicillin-clavulanic acid, ampicillin, cephalosporin, were from 11 out of 50 parvovirus-infected dogs and enrofloxacin (Lobetti et al., 2002; Judge, 2015; (22.0%), tested positive for bacterial isolation. The Mylonakis et al., 2016). Escherichia coli, Serratia spp., bacteria isolated from blood samples were found on Acinobacter anitratus, Citrobacter freundii, Klebsiella each of the days during the period of infection and pneumoniae, Klebsiella oxytoca, Enterobacter spp., more than one kind of bacteria was present in Staphylococcus intermedius and Streptococcus spp. individual dogs (Table 1). The results regarding can be found with CPV infection as the result of antimicrobial resistance and MDR for bacteria isolated bacteria in gastrointestinal tract penetrated into the from cases of CPV infection are presented in Table 2 blood stream or nosocomial infection (Isogai et al., (intermediate isolates were included in the resistant 1989; Lobetti et al., 2002; Prittie, 2004). In veterinary isolate group). practice, there is an increased abundance of pathogenic multidrug-resistant (MDR) bacteria, the same as in The gram-negative bacteria found in the blood humans (van den Bogaard and Stobberingh, 2000). samples were Escherichia coli, Pseudomonas aeruginosa, This causes increased severity and a prolonged and Klebsiella pneumonia, which is similar to the hospitalization period (Trott et al., 2004; Iris et al., 2010). findings in previous studies (Prittie, 2004; Sykes, 2012). The present study aimed to identify the bacteria that Most Escherichia coli, Pseudomonas spp., Klebsiella spp., cause bacteremia and determine the MDR bacteria and Proteus spp. have been reported to be opportunistic among naturally-infecting canine parvoviruses. pathogens causing animal infection when host defenses or immune systems are impaired in most Materials and Methods animal species (Sykes, 2012). CPV damages the intestinal crypts, which results in small-intestinal Study dogs: A total of 50 dogs infected with CPV were epithelial villous collapse and bloody diarrhea, which enrolled between September 1st, 2016 and March 31st, increases the risk of bacteria entering the body and 2017. The inclusion criteria were the presence of clinical causing widespread infection (Nandi and Kumar, signs of CPV infection, no history of parvovirus 2010). Therefore, those gram-negative bacteria need a vaccination or the use of antimicrobials in the previous short period of time before entering the bloodstream month, and a positive result in the polymerase chain (from day 3 onwards in the present study). Coagulase- reaction test for CPV. The study protocol was negative staphylococci (CoNS) were the gram-positive approved by the Animal Care and Use Committee of bacteria most commonly isolated here. CoNS and the Faculty of Veterinary Medicine, Chiang Mai enterococci were reported as the major nosocomial University (Ref. no. S34/2559). pathogens that have a high impact on the mortality rate and dramatically increase the treatment cost (Moses et Sample collection: BCS Serial blood collection was al., 2012; Becker, 2014). Therefore, the presence of performed for 50 dogs with CPV on days 0, 3, 5 and 7 CoNS and enterococci in the parvovirus-infected dogs of hospitalization. In total, 12 and 5 dogs died during was suspected to reflect the contamination of bacteria days 1–3 and 4–5 of hospitalization, respectively. In from the medical personnel/procedure, such as addition, 12, 12 and 11 dogs were discharged during intravenous catheter placement (Lobetti et al., 2002; days 1–3, 4–5 and 6–7 of hospitalization, respectively. Moses et al., 2012; Becker, 2014). These were found in Overall, 83 blood samples were collected from the the bloodstream from day 0 in the present study. jugular vein using a sterile technique. Bacteremia was not the factor that was significantly associated with death in parvovirus infected dogs but Hemoculture: BCS One milliliter of blood was hemoculture and a drug sensitivity test had to be transferred into a bottle of brain, heart infusion broth performed in every patient which made veterinarians (blood to broth ratio 1:9) (Lanna Lab. Co., Thailand). able to choose the right antimicrobial (Sunghan, 2019). The sample bottle was immediately transferred to the laboratory and incubated at 35°C for 24 h; then, it was MDR was identified here, the same as in previous withdrawn and inoculated on to a blood agar medium studies, especially in Escherichia coli (Habib et al., for aerobic culture. Bacterial identification was based 2016) and enterobacteriaceae (Trott et al., 2004; on colony type and morphology, gram staining Gronvold et al., 2010). The possible reasons for the characteristics and standard biochemical tests (Carter, presence of MDR in the parvovirus-infected dogs 1990). include the following: firstly, they received previously normal flora from their mother when in the uterus, Antimicrobial susceptibility testing and the selected which is the reservoir for resistance genes (Newman Antimicrobials: All isolated bacteria were tested for and Seidu, 2002; De Graef et al., 2004); secondly, the antimicrobial susceptibility using the disk diffusion transmission of MDR could have occurred from method on Muller–Hinton agar. The antibiotic disks medical personnel/procedures during hospitalization were not selected on the basis of the identified (Lobetti et al., 2002; Becker, 2014). Thirdly, the direct microbial agents but based on 10 kinds of transmission of MDR between the owner and the dog could have occurred through direct contact or from the

Sanghan J. et. al. / Thai J Vet Med. 2019. 49(2): 193-196. 195 environment (Guardabassi et al., 2004). Fourthly, the gram-positive organisms isolated from the transmission of MDR from farm animals to humans bloodstream were CoNS and enterococci and the and pets could have occurred through the food gram-negative organisms were Escherichia coli, network (Ramos et al., 2013). Therefore, to control MDR Enterobactor spp., Pseudomonas aeruginosa, and Klebsiella needs multiple compliance e.g., awareness of rational pneumonia. Awareness of bacteremia and MDR drug use, prudent infection control practices, through performing blood culture in each case of CPV antimicrobial stewardship and the development of infection must be promoted to enhance therapeutic new medication. outcomes. In conclusion, MDR pathogens were present in the bloodstream on each day during CPV infection. The Table 1 Thirteen cases of bacterial identification from 83 blood samples in 50 canine parvovirus-infected dogs Bacterial species Day of Hospitalization Escherichia coli Enterobacter species Day 0 Day 3 Day 5 Day 7 Klebsiella pneumonia 0 1 Pseudomonas aeruginosa 10 (dog no.7) Coagulase-negative staphylococci 0 0 Non-hemolytic streptococci group D (enterococci) (dog no.2) 0 0 10 0 1 (dog no.3) (dog no.4) 3 0 (dog no.33,41,46) 02 1 0 (dog no.50) (dog no.3,32) 10 (dog no.28) 11 (dog no.31) (dog no.31) 00 Table 2 Antimicrobial resistance patterns isolated from blood in all groups (n = 13). Red means resistant to that kind of antimicrobial. Orange means intrinsic resistant. (AMC-Amoxicillin-clavulanate, AMK-Amikacin, CFS-Cefoperazone- Sulbactam, CEF-Ceftriaxone, CIP-Ciprofloxacin, CLI-Clindamycin, GEN-Gentamicin, IMI-Imipenem, SXT-Trimethoprim- sulfamethoxazole, TET-Tetracycline) Isolated bacteria AMC AMK CFS CEF CIP CLI GEN IMI SXT TET E. coli1 E. coli2 Enterobacter P. aeruginosa1 P. aeruginosa2 K. pneumoniae1 K. pneumoniae2 CoNS1 CoNS2 CoNS3 CoNS4 CoNS5 Enterococci E. coli = Escherichia coli, P. aeruginosa = Pseudomonas aeruginosa, K. pneumoniae = Klebsiella pneumonia, CoNS = Coagulase-negative staphylococci References De Graef EM, Decostere A, Devriese LA and Haesebrouck F 2004. Antibiotic resistance among Becker K, Heilmann C and Peters G 2014. Coagulase- fecal indicator bacteria from healthy individually negative staphylococci. Clin Microbiol Rev., 27(4): owned and kennel dogs. Microb Drug Resist. 10(1): 870–926. 65-69. Carter GR and Cole JRJr 1990. Diagnostic Procedures Giguere S, Prescott JF, Dowling PM. 2013. in Veterinary bacteriology and Mycology. 5th ed. Academic Press London/Sandieg. 620pp. Antimicrobial Therapy in Veterinary Medicine 4th

196 Sunghan J. et al. / Thai J Vet Med. 2019. 49(2): 193-196. ed. Wiley-Blackwell, Ames, Iowa, USA, Oxford. Sykes J, Greene CE 2012. Gram-negative bacterial infections. In: Infectious disease of the dog and cat: 704pp. 4th ed ELSEVIER SAUDERS, St. Louis, Missouri: 349-359. Gronvold AM, L'Abee-Lund TM, Sorum H, Skancke E, Trott DJ, Filippich LJ, Bensink JC, Downs MT, Yannarell AC and Mackie RI 2010. Changes in fecal McKenzie SE, Townsend KM, Moss SM and Chin JJ 2004. Canine model for investigating the impact of microbiota of healthy dogs administered with oral enrofloxacin on commensal coliforms and colonization with multidrug-resistant Escherichia amoxicillin. FEMS Microbiol Ecol. 71(2): 313-326. coli. J Med Microbiol. 53(Pt 5): 439-443. Guardabassi L, Schwarz S and Lloyd DH 2004. Pet van den Bogaard AE and Stobberingh EE 2000. Epidemiology of resistance to antibiotics. Links animals as reservoirs of antimicrobial-resistant between animals and humans. Int J Antimicrob Agents. 14(4): 327-335. bacteria. J Antimicrob Chemother. 54(2): 321-332. Habib I, Anjum AA, Rabbani M, Ahmad MUD, Ali MA, Nawaz M, Kamran M and Khan HM 2016. Occurrence of Antimicrobial Resistant Bacteria in Dogs Suffering from Enteritis. J Anim Plant Sci. 26(1): 13-16. Iris K, Leontides LS, Mylonakis ME, Adamama- Moraitou K, Rallis T and Koutinas AF 2010. Factors affecting the occurrence, duration of hospitalization and final outcome in canine parvovirus infection. Res Vet Sci. 89(2): 174-178. Isogai E, Isogai H, Onuma M, Mizukoshi N, Hayashi M and Namioka S 1989. Escherichia coli associated endotoxemia in dogs with parvovirus infection. Nihon Juigaku Zasshi. 51(3): 597-606. Judge PR 2015. Management of the patient with canine parvovirus enteritis. Proceedings of the New Zealand veterinary nursing association annual conference. [Online]. Available: https://www.nzvna.org.nz/site/nzvna/files/Qui zzes/Parvo.pdf Accessed Jan, 2015. Lobetti RG, Joubert KE, Picard J, Carstens J and Pretorius E 2002. Bacterial colonization of intravenous catheters in young dogs suspected to have parvoviral enteritis. J Am Vet Med Assoc. 220(9): 1321-1324. Mackie J 2017 Intrinsic antibiotic resistance. [Online]. Available: http://www.vetqml.com.au/Portals/0 /PDF/Publications/1465_VQ_IntrinAntibioResist _Sep17.pdf. Accessed September 2017. Moses V, Jerobin J, Nair A, Sathyendara S, Balaji V, George IA, Peter JV 2012 Enterococcal Bacteremia is Associated with Prolonged Stay in the Medical Intensive Care Unit. J Glob Infect Dis. 4(1):26–30. Mylonakis ME, Kalli I, Rallis TS 2016 Canine parvoviral enteritis: an update on the clinical diagnosis, treatment, and prevention. Veterinary Medicine: Research and Reports. 2106(7): 91—100. Nandi S and Kumar M 2010. Canine parvovirus: current perspective. Indian J Virol. 21(1): 31-44. Newman MJ and Seidu A 2002. Carriage of antimicrobial resistant Escherichia coli in adult intestinal flora. West Afr J Med. 21(1): 48-50. Pollock RV and Coyne MJ 1993. Canine parvovirus. Vet Clin North Am Small Anim Pract. 23(3): 555-568. Prittie J 2004. Canine parvoviral enteritis: a review of diagnosis, management, and prevention. J Vet Emerg Crit Car. 14(3): 167-176. Ramos S, Silva N, Canica M, Capelo-Martinez JL, Brito F, Igrejas G and Poeta P 2013. High prevalence of antimicrobial-resistant Escherichia coli from animals at slaughter: a food safety risk. J Sci Food Agric. 93(3): 517-526. Sunghan J, Akatvipat A, Granick JL, Chuammitri P and Boonyayatra S. 2019. Clinical factors associated with death during hospitalization in parvovirus infection dogs. Vet Integ Sci. \"in press\"

Kalayanakoul K. et al. / Thai J Vet Med. 2019. 49(2): 197-201. 199 Case Report A Case report: Phenobarbital - responsive sialadenosis in a dog Kitipatra Kalayanakoul1* Supattra Yongsiri1 Pornphan Sukanan1 Piyarat Chansiripornchai2 Narudee Kashemsant3 Abstract A 5-year old, 1.2 kilogram, spayed female, mixed breed dog presented with vomiting, gulping, retching, excessive salivation and weight loss for 6 months. The dog had both mandibular salivary gland enlargement but was cytologically normal. Hematology blood chemistry and urinalysis were unremarkable except for neutrophilic leukocytosis and hypokalemia. Contrast study radiography found gas in the gastrointestinal (GI) tract and contrast medium left in the esophagus while abdominal ultrasonography was unremarkable. Oropharyngeal and upper GI endoscopy confirmed cervical esophageal dilatation. The dog did not respond to symptomatic treatment. Sialadenosis was diagnosed based on the clinical signs and the ruling out of other diseases with a similar presentation. Medical treatment with phenobarbital was initiated at a dosage of 1.5 mg/kg orally twice daily for 3 months. The clinical signs diminished in a few days and were completely absent within 2 weeks. The mandibular salivary glands were smaller and softened after 2 weeks of treatment. After 3 months, phenobarbital dosage was tapered (reduced) every month and withdrawn at 6 months. Seven months after treatment, the mandibular salivary gland could not be palpated and the dog gained weight and had no clinical signs. This is the first case of phenobarbital - responsive sialadenosis reported in Thailand. Keywords: Dog, Phenobarbital, Salivary gland, Sialadenosis, Vomiting 1Suvarnachad Animal Hospital, Saphan Sung, Bangkok, Thailand 2Department of Veterinary Pharmacology, Faculty of Veterinary Sciences, Chulalongkorn University, Bangkok, Thailand 3Department of Physiology, Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand *Correspondence: [email protected] (K. Kalayanakoul) Thai J Vet Med. 2019. 49(2): 197-201.