TJVM Vol. 49 No. 2 June 2019

THE THAI JOURNAL OF VETERINARY MEDICINE Office: Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330 Thailand Tel. 66(2) - 218 9556-7 Fax. 66(2) - 255 3910 Advisory Committee: Asst. Prof. Dr. Thawatchai Sakphuaram President of the Veterinary Council of Thailand Prof. Dr. Roongroje Thanawongnuwech Dean Dr. Somchuan Ratanamungklanon President of the Thai Veterinary Medical Association Prof. Dr. Alongkorn Amonsin under the Royal Patronage Associate Dean of Academic International and Student Affairs Dr. Boonlert Preechatangkij President of Chulalongkorn University Veterinary Prof. Dr. Kaywalee Chatdarong Alumni Association Associate Dean of Research and Innovation Editorial Board: Andrew Ponter (France) Andrej Madej (Sweden) Annop Kunavongkrit (Thailand) Eileen L. Thacker (USA) Atichat Bramasa (Thailand) Elisabeth Persson (Sweden) Chollada Buranakarl (Thailand) Han-Soo Joo (USA) Jiroj Sasipreeyajan (Thailand) Karen L. Keller (USA) Marissak Kalpravidh (Thailand) Oliver Sparagano (UK) Mongkol Techakumphu (Thailand) Stanley H. Done (UK) Narongsak Chaiyabutr (Thailand) Stig Einarsson (Sweden) Peerasak Chanprateep (Thailand) Takashi Aoki (Japan) Pranee Tuntivanich (Thailand) Teresa Y. Morishita (USA) Roongroje Thanawongnuwech (Thailand) Masashi Maita (Japan) Somchai Chanpongsang (Thailand) Eric Lombardini (USA) - Padet Tummaruk (Thailand, Editor-in-Chief) Anudep Rangsipipat (Thailand) Boonrit Thongsong (Thailand) Theerayuth Kaewamatawong (Thailand) Piyarat Chansiripornchai (Thailand) Anusak Kijtawornrat (Thailand) Chenphop Sawangmake (Thailand) Nutthee Am-in (Thailand) Morakot Nuntapaitoon (Thailand) Sirawit Pagdepanichkit (Thailand) Orapun Jaturakan (Thailand) Sirinun Pisamai (Thailand) Chutimon Thanaboonnipat (Thailand) Journal Management and Membership: Mr. Kritsana Phanchinda and Mrs. Junya Petchkongthong The Veterinary Library and Information Center Faculty of Veterinary Science, Chulalongkorn University, Bangkok, 10330 Thailand Tel. 66(2)- 218 9556-7 Email: [email protected] https://www.tci-thaijo.org/index.php/tjvm This publication will be indexed and abstracted in Science Citation Index Expanded (SciSearch®), SCOPUS, CABI, ProQuest and EBSCO Publisher: Chulalongkorn University Printing House (5305-128/600) Phayathai Road, Pathumwan, Bangkok, 10330 Thailand Tel. 66(2) - 218 3557-63, Fax. 66(2) - 218 3551

Board of Reviewing Editors TJVM would like to thank the followings for their expertise contribution to the Journal in 2017-2019 Animal Husbandry: Somchai Chanpongsang, Duangsmorn Suwattana, Nalinee Imboonta, Chackrit Nuengjamnong, Praopilas Phakdeedindan Animal Nutrition: Bas Kemp, Peter Kapple Theil, Boonrit Thongsong, Uttra Jamikorn, Chaiyapoom Bunchasak, Suriya Sawanon, Anongnart Assavacheep, Thita Taecholarn Aquatic Animal Medicine: Nantarika Chansue, Janenuj Wongtavatchai, Aranya Ponpornpisit, Channarong Rodkhum, Nopadon Pirarat, Win Surachetpong, Pattanapon Kayansamruaj, Patharapol Piamsomboon, Thanida Hetrakul Biochemistry: Sirakarnt Dhitavat, Gunnaporn Suriyaphol, Prapruddee Piyawiriyakul, Sariya Asawakarn, Phongsakorn Chuammitri, Teerapong Yata Companion Animal Medicine: Rosama Pusoonthornthum, Meena Sarikaputi, Walasinee Sakcamduang, Niyada Thitaram, Thawat Lekdumrongsak, Sukullaya Ritthikulprasert, Sirilak Disatian Surachetpong, Chaowaphan Yinharnmingmongkol, Tassanee Jaroensong, Vachira Hunprasit Livestock Animal Medicine: Kittisak Ajariyakhajorn, Somsak Pakpinyo, Witaya Suriyasathaporn, Niwat Chansiripornchai, Worapol Aengwanich, Chaidate Inchaisri, Pornchalit Assavacheep, Thanasak Boonserm, Nataya Charoenvisal, Kwankate Kanistanon Physiology: Chollada Buranakarl, Kris Angkanaporn, Suwanakiet Sawangkoon, Sutthasinee Poonyachoti, Sumpun Thammacharoen, Yukie Ueyama, Sarinee Kalandakanond-Thongsong, Anusak kijtawornrat, Kittipong Tachampa, Prapawadee Pirintr, Soontaree Petchdee, Saikaew Sutayatram Theriogenology: Roy Kirkwood, Nicoline Soede, Rangsan Parnpai, Suneerat Aiumlamai, Wichai Tantasuparuk, Sudson Sirivaidyapong, Kaywalee Chatdarong, Siriwat Suadsong, Sudsaijai Kornmatitsuk, Kulnasan Saikhun, Kampon Kaeoket, Padet Tummaruk, Suppawiwat Ponglowhapan, Nawapen Phutikanit, Theerawat Tharasanit, Theerawat Swangchan-Uthai, Anucha Sathanawongs, Morakot Nuntapaitoon, Nutthee Am-In, Kakanang Buranaamnuay, Sroisuda Chotimanukul, Nitira Anakkul, Chanyuth Tretipskul, Panida Chanapiwat, Panisara Kunkitti, Sarawanee Khunmanee, Saritvich Panyaboriban Veterinary Anatomy: Weerapong Koykul, Wuthichai Klomkleaw, Kriengyot Sajjarengpong, Paisan Tienthai, Damri Darawiroj, Sayamon Srisuwatanasagul, Pawana Chuesiri, Peerapol Sukon Veterinary Microbiology: Sanipa Suradhat, Nuvee Prapasarakul, Naraid Suanyuk, Kannika Na Lampang, Nitaya Indrawattana, Nuanjan Paraksa, Patamabhorn Amavisit, Sarawut Kumphune, Sunpetch Angkititrakul, Pattrarat Chanchaithong, Teerawut Nedumpun Veterinary Parasitology: Padet Siriyasatien, Piyanan Taweethavonsawat, Sontaya Tiewsirisup, Morakot Kaewthamasorn, Woraporn Sukhumavasi, Tanasak Changbunjong Veterinary Pathology: Achariya Sailasuta, Roongroje Thanawongnuwech, Anudep Rungsipipat, Wijit Banlunara, Rachod Tantilertcharoen, Somporn Techangamsuwan, Theerayuth Kaewamatawong, Atigan Thongtharb, Patharakrit Teewasutrakul, Sawang Kesdangsakonwut, Yaowalak Panyasing, Kasem Rattanapinyopituk Veterinary Pharmacology: Kazuyoshi Taya, Amnart Poapolathep, Piyarat Chansiripornchai, Rariya Udomkusonsri, Chenphop Sawangmake, Chavalit Boonyapakorn, Sukonthar Ngampramuan, Vudhiporn Limprasutr, Gülcan Avci Veterinary Public Health: Alongkorn Amonsin, Rungtip Chuanchuen, Suphachai Nuanualsuwan, Taradon Luangtongkum, Saruda Tiwananthagorn, Nuananong Sinwat, Saharuetai Jeamsripong, Sirawit Pagdepanichkit Veterinary Surgery: Marissak Kalpravidh, Chanin Kalpravidh, Monchanok Vijarnsorn, Sumit Durongphongtorn, Preenun Jitasombuti, Naruepon Kampa, Cholawat Pacharinsak, Kumpanart Soontornvipart, Nalinee Tantivanich, Korakot Nganvongpanit, Pasakorn Brikshavana, Chalika Wangdee, Nan Choisunirachon, Panrawee Phoomvuthisarn, Krishaporn Kradangnag, Nicole Sirisophit Mehl, Krittee Dejyong, Orapun Jaturakan, Sirinun Pisamai Veterinary Virology: Kanisak Oraveerakul, Thaweesak Songserm, Porntippa Lekcharoensuk, Pravina Kitikoon, Dunruethai Sreta, Aunyaratana Thontiravong, Nawapon Techakriengkrai

The Thai Journal of Veterinary Medicine Vol. 49 No. 2 June 2019 Contents 107 113 Original Article 121 Epidemiology of characteristics and risk factors for overweight in cats visiting an animal hospital in 131 Bangkok, Thailand 137 147 Vachira Hunprasit, Chaiyot Tanrattana, Siwaporn Pengpis 155 Efficacy of ultrasonic dissection device in staphylectomy surgery in brachycephalic airway obstructive syndrome (BAOS) dogs 161 167 Sunisa Thunyodom, Marissak Kalpravidh, Chanin Kalpravidh, Wijit Banlunara, Pasakorn Brikshavana 175 Production and characterization of polyclonal antibody against major capsid protein of Salmonella 183 bacteriophage SE-W109 193 Anucha Sangwiman, Preeda Phothaworn, Veerachat Muangsombut, Chutima Chanprasert, Chartchai Chaichana, Watip Tangjittipokin, Sunee Korbsrisate 197 Restoration of tiger (Panthera tigris) follicles from frozen-thawed ovarian tissues Ajjima Chansaenroj, Nucharin Songsasen, Ampika Thongphakdee, Kaywalee Chatdarong Mycobacterium marinum and Mycobacterium fortuitum infections in Siamese fighting fish, Betta splendens (Regan), in Thailand Sompoth Weerakhun, Peerapol Sukon, Kishio Hatai Association of LOC101800257 gene with eggshell color in Leizhou black duck Kun Zou, Jun-teng Huang, Aamir Nawab, Li-li Lu, Hong-yan Cui, Shao-wei Zhang, Yuan Xue, Ying Su Identification of blood meal from field collected filarial vector mosquitoes, Armigeres subalbatus by multiplex PCR Rungfar Boonserm, Ratchadaporn Jantorn, Atchara Phumee, Sriwatapron Sor-suwan, Narissara Jariyapan, Sonthaya Tiawsirisup, Padet Siriyasatien A monitoring report for Salmonella spp. in an HACCP standard pig slaughterhouse Xin Wu, Sunpetch Angkititrakul, Teerarat Prasertsee, Nalita Adsanychan, Fanan Suksawat Genetic evolution of porcine reproductive and respiratory syndrome virus based on ORF5 on 7 Taiwanese pig farms Chien-Ho Yu, Kraijak Kaewprom, Chih-Cheng Chang, Ming-Tang Chiou, Chao-Nan Lin Fetal Head Diameter in Dogs and Cats Measured by Radiography and Ultrasonography Chunsumon Limmanont, Suppawiwat Ponglowhapan, Phanwimol Tanhan, Theerapol Sirinarumitr, Kaitkanoke Sirinarumitr Effects of activin A on the pluripotency of induced pluripotent stem cells derived from porcine Sertoli cells Piyathip Setthawong, Theerawat Tharasanit, Mongkol Techakumphu Short Communication Bacteremia and Multidrug Resistance in Naturally Parvovirus Infection Dogs Jutapoln Sunghan, Duangporn Pichpol, Phongsakorn Chuammitri, Areerath Akatvipat Case Report A Case report: Phenobarbital - responsive sialadenosis in a dog Kitipatra Kalayanakoul, Supattra Yongsiri, Pornphan Sukanan, Piyarat Chansiripornchai, Narudee Kashemsant



INSTRUCTIONS TO AUTHORS and no published material may be reproduced or published elsewhere without written consent from the The Thai Journal of Veterinary Medicine (TJVM) Journal. If excerpts from other copyrighted works are publishes articles reporting interdisciplinary included, the Author(s) must obtain written permission investigations concerning veterinary and animal from the copyright owners and credit the source(s) in sciences, at all levels of resolution, from basic to clinical, the manuscript. The Journal will not be responsible for molecular to behavioral, and opinions that are of the loss of manuscripts at any time. All statements in general interest to the broad community of published manuscripts are the responsibility of the veterinarians and biological scientists. Clinical Authors, who will assist the editors by reviewing proofs investigations, protocols and reviews will also be before publication. considered for publication if they provide significant insight into the structure or function, the SUBMISSION PROCEDURE pathophysiology of a disease, or its treatment. Authors are requested to submit their manuscripts In the Journal’s Table of Contents, published articles in English in a concise and understandable style. will be shown under one of the appropriate Section Technical jargon or “laboratory slang” should not be titles listed below used. Please note that the electronic files supplied will always be used to produce the illustrations, including SECTIONS those for the print version of the article; it is the Authors’ responsibility to ensure that the manuscript is written in Editorials A limited amount of space will be available a style that is grammatically correct and free of spelling for comments about important scientific points or or other typographical errors and that these files are of subjects of topical interest and will be by invitation suitable quality. All manuscripts must be typewritten only. using Times New Roman font at 12 point, with double- spacing throughout and with margins at least 2.5 cm Reviews The article can be submitted either by wide. Pages should be numbered in succession, the title invitation or submission. The latter will be reviewed by page being number 1 and all lines should be numbered experts in the same manner as other submitted consecutively in the left margin. Text files should be manuscripts. supplied in Microsoft Word formats. Original Articles The manuscript should be novel Each manuscript should be accompanied by a research findings and provide strong evidence for the signed cover letter in which the corresponding Author conclusions. The manuscripts suitable for publication in states: “The work described has not been submitted TJVM should be of extreme importance to scientists in elsewhere for publication, in whole or in part”. All the field as well as interesting to researchers in other submissions to TJVM must contain experiments that disciplines. conform to the ethical standards issued by the National Research Council. If the studies deal with Short Communications These are short manuscript animal experiments, the authors certify in the that describe outstanding new discoveries. The decision Materials and Methods section, that the procedures will be based on whether the paper reports particularly have been approved by the Authors’ Institution’s important findings that have a high impact in the field Ethic Committee, and care was taken to minimize the of work. number of animals used. If the ethical standard governing the reported research is different from those Case Reports These are short reports of original clinical guidelines indicated above, the authors must provide or pathological findings whose importance mean that information in the submission cover letter about which they will be of interest to veterinarians. guidelines and oversight procedures were followed. SUBMISSION POLICY Authors should only use abbreviations sparingly and should always define the abbreviation when first Submission of a paper to TJVM is understood to used in the text by placing it in parentheses after the full imply that it deals with original material not previously term. The abbreviations should then be used published and that it is not being considered for consistently thereafter and appear at least twice in the publication elsewhere. Please write your text in good text. Drug names should be the official or approved English (American or British usage is accepted, but not names; trade names or common names may be given a mixture of these). The manuscript must be approved where the drug is first mentioned. Trade names should by a native English speaker before submission. The be capitalized, and the manufacturer’s name and layout and style should adhere strictly to the country given in parenthesis thereafter. The doses of the instructions given under “Organization of the Article”. drugs should be given as unit weight/unit body weight, No revisions or updates will be incorporated after the e.g. mmol/kg or mg/kg. Symbols for physical units article has been accepted and sent to the Publisher should be restricted to the Systems International (S.I.) (unless approved by the Editorial Board). The Editorial Units. Units and abbreviations should conform to the Board reserves the right to reject any manuscript following examples: M, mM, μM, N, %, m, cm, mm, μm, deemed unsuitable for publication in TJVM. nm, pm, cm2, l, ml, kg, g, mg, μg, ng, pg, h, min, sec, msec, rpm, Hz, ppm, °C, J, KJ and lux. Upon acceptance, a letter will be sent to the corresponding Author confirming receipt of the Where possible, Authors should also include a manuscript. Accepted manuscripts become the list of three or more potential reviewers for their property of TJVM. The Journal reserves the copyright, manuscript, with contact information.

ORGANIZATION OF THE ARTICLE followed by several information presentation sections and end with a conclusion section. Section headings The manuscript should have a uniform style and be should be used to organize the presentation of submitted exactly as the author wishes it to appear in information. print. It should consist of subdivisions in the following sequence. Acknowledgements. It is the corresponding Author’s responsibility to ensure that individuals who are 1) Title page acknowledged for assistance or for providing 2) Abstract comments on the manuscript are agreeable to be 3) Text acknowledged in this way. 4) Acknowledgments 5) References References 6) Tables 7) Figures legends (a) In the text, references should be quoted as the name 8) Figures of the first author and year in chronological order. Start each subdivision on a new page. Multiple authors are indicated by “et al.,” except when there are only two authors, in which case both names Title Page The first page of the manuscript should are written. include Title of paper, Full name of author(s), Institutional affiliations and complete mailing address, Examples number of pages and number of figures and tables. E- mail address of the corresponding author should be …(Garthwaite and Garthwaite, 1995; Morris et al., presented. 2000). …by Nagy et al. (1999a,b). Clarkson et al. (2004) stated…… Abstract The manuscript should contain an abstract of around 250 words. The abstract must be written in (b) The reference list should be on a separate page at the complete sentences and succinctly state the objectives, end of the manuscript, in alphabetical order and experimental design of the paper, principal arranged as follows: authors’ names and initials, year, observations, and conclusions; it should be intelligible title of the article, abbreviated title of the journal, without reference to the rest of the paper. volume, first and last page numbers. Keywords Four to six key words should be included. Examples Text Article Nagy ZA, Esiri MM and Cato A-M 1999a. Cell cycle Original articles: The text should be presented in the markers in the hippocampus in Alzheimer’s disease. following order Acta Neuropath. 94: 6-15. Herpin P, Le Dividich J, Hulin JC, Fillaut M, De Marco i.) Introduction This should provide the scientific F and Bertin R 1996. Effect of the level of asphyxia rationale for the research that is reported. No results during delivery on viability at birth and early postnatal should be presented. vitality of newborn pigs. J Anim Sci. 74: 2067-2075. ii.) Materials and Methods Procedures used in the Chapter in a book research should be described in sufficient detail to Mize RR 1994. Conservation of……visual system. In: permit the replication of the work by others. Previously Neuroscience. From the Molecular to the Cognitive. published procedures should be referenced and briefly Progress in Brain Research. 3rd ed. FE Bloom (ed). summarized. The source of all materials, including Amsterdam: Elsevier. 123-132. animals and human tissue, must be provided. An entire book iii.) Results This section presents findings without Sodikoff CH 1995. Laboratory Profiles of Small Animal discussion of their significance. Subsections should be Diseases. A Guide to Laboratory Diagnosis. 2nd ed. St. used in order to present results in an organized fashion. Louis: Mosby. 178 pp. The findings may be assisted by high quality illustrations, as necessary, to adequately document the Electronic information work. Figures should be referred to in the text as Fig. 1, Dumble LJ 1996. “The third world and infertile Figs. 1, 3-4, etc., and tables as Table 1, Tables 1, 3-4, etc. women.” [Online]. Available: http://www.maff.gov. Probability format style should be used as “P < 0.05”. uk. Accessed July 12, 1997. iv.) Discussion This section presents the Authors’ (c) A paper which has been accepted for publication but interpretations of their findings and an assessment of has not yet appeared may be cited in the reference list their significance in relation to previous work. with the abbreviated name of the journal followed by Repetition of material presented in the Results section the words “in press”. should be avoided. (d) Unpublished data may be mentioned only in the Short Communication and Case Reports: These should text, not in the References. Initials, as well as surnames, not exceed 4 pages (approximately 2,000 words in total, including spaces). Follow the instructions for Original Articles with the exception that Results and Discussion are combined. Reviews: Reviews should have an introductory section,

must be given for authors whose unpublished experiments are quoted: (ML King, unpublished observations) Tables or figures These should be included on separate pages placed at the end of the manuscript. Their desired approximate locations should be indicated in the text. Each figure must be accompanied by an explanatory legend in a separate section entitled Figure Legends. In general, tables and figures should be constructed so that they, together with their captions and legends, will be intelligible with minimal reference to the main text. Table and figure legends should be written as in the following examples. Figure 1 Typical lesions of... Table 1 Statistical analysis showing.... All graphic files must be submitted, as JPEG in sufficiently high resolution (300 dpi for grayscale or color images and 600-1000 dpi for line art) to allow for printing. Keep text and graphics (and any other items) as separate files. Name your files using the correct extension, e.g. Text.doc, Fig1.jpg, etc. Publication fee After the paper is accepted, the authors will be required to pay a publication fee for 5,000 THB or 150 USD.



Original Article Epidemiology of characteristics and risk factors for overweight in cats visiting an animal hospital in Bangkok, Thailand Vachira Hunprasit1* Chaiyot Tanrattana1 Siwaporn Pengpis2 Abstract A cross-sectional study aimed to estimate the prevalence and to investigate the characteristics of overweight/obese cats visiting an animal hospital in Bangkok, Thailand. Electronic medical records of feline patient visiting the Small Animal Teaching Hospital, Chulalongkorn University between January 1, 2017 and December 31, 2017 were reviewed. The cat’s information included age, breed, sex, neutering status and body condition score. Associated demographic factors and overweight/obesity using idealweight as a reference was performed by logistic regression. The prevalence of feline overweight/obesity was 8.1% (95%CI: 7.4% - 8.9%). From the multivariable logistic regression, age, sex, neutering status, breed and interaction of age and neutering status were significantly associated with being overweight/obese. Male (OR = 2.18, 95%CI: 1.72, 2.78), neutered cats had higher odds of being overweight. Among neutered cats, the odds of being over-weight increased with advancing age. The result of the study indicated that the overweight/obesity problem in cat is not uncommon. The risk factors identified from the study can help veterinarians in managing and preventing the risk of overweight/obesity in cats and educating owners of high-risk cat to aware of overweight/obesity-related disease. Keywords: characteristics, epidemiology, feline, obesity, overweight 1Department of Veterinary Medicine, Chulalongkorn University, Bangkok, Thailand 10330 2Chulalongkorn University Feline Center, Small Animal Teaching Hospital, Chulalongkorn University, Bangkok, Thailand 10330 *Correspondence: [email protected] (V. Hunprasit) Thai J Vet Med. 2019. 49(2): 107-111.

108 Hunprasit V. et al. / Thai J Vet Med. 2019. 49(2): 107-111. Introduction Domestic short hair (DSH), ii) mixed breed, iii) Persian, iv) Scottish fold, and v) other pure breeds Obesity is a condition of positive energy balance and excessive adipose tissue formation with adverse Statistical analyses: Descriptive statistics were effects on morbidity and mortality (Crane, 1991). Like performed on all variables to describe the distribution humans, obesity in cats is associated with developing of demographic variables. The prevalence of lameness (Scarlett and Donoghue, 1998), non-allergic overweight was calculated from number of cats in the skin disease (Scarlett and Donoghue, 1998), diabetes overweight group being divided by total number of mellitus (Panciera et al., 1990; Lund et al., 2005) and cats. The correlation between body weight and BCS lower urinary tract disease (Öhlund et al., 2018). was evaluated by Spearman’s rank correlation analysis. For identification of demographic risk factors, Overweight/obesity, which is classified by body only overweight and ideal weight groups were condition score (BCS) greater than 3 (5-scoring system) analyzed. The data was analyzed in 2 stages using SPSS or 5 (9-scoring system), in cats is not uncommon. version 22.0 (SPSS Inc., Chicago). In the first stage, Previous studies have reported the prevalences of univariate logistic regression was performed to screen overweight and obesity are between 7 to 63% in all explanatory variables and expressed in odds ratio different populations (Colliard et al., 2009; Courcier et (OR) and 95% confidence interval (95%CI). Evaluation al., 2010). The prevalence of feline obesity is increasing of multicollinearity among explanatory variables was together with the obesity problem in human (Cave et assessed using Chi-square test for categorical variables al., 2012). Therefore, the trend change of obesity in pets (p < 0.05). In cases of multicollinearity, the variable can be a model for obesity in humans (German, 2006). with higher biological plausibility was retained for However, information on the prevalence of feline multivariable analysis. Age was introduced into the overweight/obesity in Thailand is not available. The analysis as a categorical variable based on quartile knowledge of the prevalence of feline frequency since this categorizing obtained high overweight/obesity cannot only alert veterinarians but likelihood in the analysis. also cat owners of the importance of the obesity problem in cat population. In the second stage, variables from the univariate analysis with P≤0.2 and without marked Feline obesity has been reported to be related to multicollinearity among variables were included in the sex, breed, age, neutering status, and other contextual full multivariable logistic regression for model factors including diet, environment and owner selection. A backward stepwise variable selection characteristics (Colliard et al., 2009; Courcier et al., 2010; procedure was performed. All possible 2-way Bermingham et al., 2014). The study of risk factors can interactions were further tested. The Goodness-of-fit be applied to disease prevention. In addition, knowing test for final multivariable model was assessed by of risk factors can uncover the underlying causes and Hosmer-Lemeshow Goodness-of-fit test. The ability of be used for further study. However, using risk factors the model to discriminate over-weight cats and ideal- from other studies conducted elsewhere in the world weight cats was tested using a Receiver Operating may under-, or over-estimate the true risk factors for Characteristic (ROC) and area under the curve (AUC). overweight/obese cats in Thailand. The objectives of Models with an AUC value greater than 0.8 or between the present study were to estimate the prevalence of 0.7 and 0.8 were considered to have good, moderate feline overweight /obesity, to examine the discriminative capacities, respectively. Accuracy of the characteristics and risk factors associated with final model prediction was evaluated using cross- overweight/obesity in cats visiting an animal hospital validation method with random sampling of observed in Bangkok, Thailand. data for model prediction. The results from the model prediction were compared to observed data and the Materials and Methods outcome was shown based on percentage of accuracy. Study population: Electronic medical records of all cats Results visiting the Small Animal Teaching Hospital, Chulalongkorn University, Bangkok, Thailand During the study period, the records of 5,439 cats between January 1, 2017 and December 31, 2017 were with recorded BCS were included and analyzed. Sixty reviewed. For repeated records from the same cats, percent of cats (n = 3,428) were ideal weight, 7 % (n = only the first visit of cats during the study period were 381) were overweight (BCS = 4), and 1.1% (n = 60) were collected. In each record, information of BCS, breed, obese (BCS = 5), 26.5% (n=1,444) had a BCS of 2, and age, sex, neutering status and body weight were 2.3% (n = 126) had a BCS of 1 (Fig. 1). The overall obtained. Cats in which BCS was not assessed were prevalence of feline overweight/obesity in the present excluded from the study. study was 8.1% (95%CI: 7.4% to 8.9%). Spearman’s rank correlation between body weight and BCS was Demographic variables: BCS was evaluated by 0.45 (P<0.001). attending veterinarian using a 5-point scale which was 1 = very underweight, 2 = underweight, 3 = ideal, 4 = Demographics: The demographics of the cats in the overweight, and 5 = obese (Laflamme, 1997). Cats were study are presented in Table 1. More than half of the further divided into three groups based on BSC. The cats was DSH (70.7%). Among pure breed cats, Persian overweight group was defined as cats with BCS of 4 (9.1%) and Scottish Fold (3.7%) were the most and 5, the ideal-weight group was classified in all cats frequently seen. There were slightly more males (52%) with a BCS of 3 and underweight group was all cats than females (48%) and 41% of males and 38% of with a BCS of 1 and 2. Age was recorded in years. Breed was grouped based on frequency distribution as i)

Hunprasit V. et al. / Thai J Vet Med. 2019. 49(2): 107-111. 109 females were neutered. The median age of cat was 2.0 pairwise interaction between age and neutering status years (Q1: 1.0 years, Q3: 4.0 years) and mostly ≤ 1 year was significant and included in the final multivariable (33.8%). logistic regression model (Table 2). The final model fitted well to the data when tested with Hosmer- Univariate analysis: All the variables had P≤0.2 in Lemeshow goodness-of-fit test (P>0.05). The area univariate analysis (Table 1). No multicollinearity under the ROC curve (AUC) calculated for this model among variables was observed, so these variables were was 0.75 (95%CI:0.72, 0.77, P<0.05); therefore, the final included in the multivariable logistic regression model model had moderate discrimination capacity. The process. accuracy of the model prediction was 84% when calculated with cross-validation. Multivariable analysis: All variables were significant in the multivariable logistic regression model. The Figure 1 Bar chart of feline body condition scores Table 1 Distribution of demographic factors and results of univariate logistic regression Variables Category Over-weight Ideal-weight OR (95%CI) P-value Sex Neutering status Female 145 1,520 1.00 - Age Male 283 1,638 1.81 (1.46, 2.24) <0.001 No 114 1,748 Breed Yes 284 1,082 1.00 - ≤ 1 year 63 1,245 4.02 (3.19, 5.06) <0.001 1 - 2 years 81 923 2 - 4 years 124 628 1.00 - > 4 years 170 621 1.73 (1.23, 2.44) 0.002 DSH 337 2,351 3.90 (2.84, 5.36) <0.001 Mixed 20 148 5.41 (3.98, 7.34) <0.001 Persian 16 329 Scottish Fold 14 145 1.00 - Pure breeds 19 181 0.94 (0.58, 1.52) 0.810 0.34 (0.20, 0.57) <0.001 0.67 (0.38, 1.18) 0.167 0.73 (0.45, 1.19) 0.209

110 Hunprasit V. et al. / Thai J Vet Med. 2019. 49(2): 107-111. Table 2 Results of multivariable logistic regression Variables Category OR (95%CI) P-value Sex Neutering status Female 1.00 - Age Male 2.18 (1.72, 2.78) <0.001 No Breed Yes 1.00 - ≤ 1 year 7.25 (3.89, 13.48) <0.001 Neutering status x age 1 - 2 years 2 - 4 years 1.00 - > 4 years 0.81 (0.46, 1.43) 0.469 DSH 1.34 (0.81, 2.21) 0.253 Mixed 1.38 (0.86, 2.22) 0.187 Persian Scottish Fold 1.00 - Pure breeds 0.82 (0.49, 1.38) 0.164 Neutered at age 1-2 years 0.32 (0.19, 0.55) <0.001 Neutered at age 2-4 years 0.88 (0.48, 1.61) 0.679 Neutered at age > 4 years 0.56 (0.32, 0.97) 0.042 Intact at age 1-2 years 2.08 (0.92, 4.71) 0.080 Intact at age 2-4 years 2.96 (1.35, 6.46) 0.007 Intact at age > 4 years 7.02 (3.27, 6.46) <0.001 0.48 (0.21, 1.09) 0.080 0.34 (0.15, 0.74) 0.007 0.14 (0.06, 0.31) <0.001 Discussion cats have a higher maintenance energy requirement per kilogram in body weight than males (Bermingham The prevalence of overweight/obesity (BCS = 4 and et al., 2010). Therefore, males are consuming excess 5) in the present study was 8.1% which is similar to energy and thus becoming more overweight more previous studies (Courcier et al., 2012; Rowe et al., easily than female cats. In addition, this may be 2015). In other epidemiologic studies, the prevalence explained by the perception of veterinarians. Male cats was higher than that of in this study (Lund et al., 2005; are generally larger in body size and higher in body Colliard et al., 2009; Cave et al., 2012). The difference in weight then knowing the weight of the cats may the prevalence can be explained by the different influence the assessment of their BCS (Hendriks et al., sample populations. In the present study and the study of Courcier and co-workers (Courcier et al., 2012), the 1997; Kienzle and Moik, 2011). sample population was cats visiting animal hospital Neutered cats had 2.5 times higher odds of being regardless of health status where many of the cats had health problems driving them to emaciation or weight overweight. Most of the previous studies have loss condition. Unfortunately, we did not obtain the consistently shown that neutering increases the odds diagnostic history in the study population. Even of overweight in cats (Lund et al., 2005; Colliard et al., though the estimate prevalence was lower than other 2009; Courcier et al., 2010). The increase in weight after studies, it is indicated that overweight /obesity was not uncommon in cat population. neutering can be caused by increased daily food intake as suggested by several experimental studies, a The correlation between bodyweight and BCS in decrease in metabolic rate, and decreased activity level the present study was lower (r = 0.45) compared to a predisposing neutered cats to be overweight (Fettman previous study (Teng et al., 2017). The poor correlation et al., 1997; Donoghue and Scarlett, 1998; Hoenig and suggests that the interobserver variation of assessment the BCS was high. We did not perform the agreement Ferguson, 2002). among veterinarians in the hospital. Even though this Age appeared to be an important factor for was poor correlation, the positive correlation direction indicated that body weight was in agreement with overweight and obesity, which seemed to be increasing BCS. with advancing age, similar to other studies (Courcier et al., 2010; Courcier et al., 2012; Teng et al., 2017). In the In the logistic regression analysis, we used the ideal weight cats as a reference group which has been used multivariable model, we found an interaction between in one previous study (Teng et al., 2017) but not in other neutering status and age of cat. Among neutered cats, studies (Colliard et al., 2009; Laurence et al., 2009; the odds of being overweight increased with Öhlund et al., 2018). The reason for using ideal weight advancing age whereas in intact cat the odds of being cats to be a reference is that cats with BCS 1 or 2 may overweight decreased. This observation has not been be interfered with by health-related diseases rather previously reported. This can be explained by the than overweight cats. Furthermore, evaluation of the distribution of cats in the study population in which, risk of being overweight compared to the risk of ideal- with advancing age, the proportion of neutered cats is weight and under-weight combined may bias the higher. The increase in the proportion of neutered cats estimates (Teng et al., 2017). Therefore, including these in advancing age results in increased risk of overweight. cats in the comparison group may bias the association. Male cats have higher odds of being overweight Dealing with breed introducing into the model was difficult because of the low numbers of certain breeds compared to female cats and this has been found in of cats. However, the result of the present study was previous studies (Lund et al., 2005; Teng et al., 2017; similar to previous studies in which DSH cats tend to Öhlund et al., 2018). It has been proposed that female have higher BCS (Colliard et al., 2009; Öhlund et al., 2018). This was not surprising because DSH was the majority breed cat in this study (70.7%).

Hunprasit V. et al. / Thai J Vet Med. 2019. 49(2): 107-111. 111 The present study had several limitations. First, the Crane SW 1991. Occurrence and management of study population was only from a single animal obesity in companion animals. J Small Anim Pract. hospital in Bangkok area which may not be 32(6): 275-282. representative of cats in Bangkok or in Thailand. Second, the present study analyzed all cats visiting the Donoghue S and Scarlett JM 1998. Diet and feline hospital where, in general, both diseased and healthy obesity. J Nutr. 128(12): 2776s-2778s. cats were enrolled resulting in a low prevalence of feline obesity. Lastly, we did not include contextual Fettman M, Stanton C, Banks L, Hamar D, Johnson D, factor including owner’s information and diet which in Hegstad R and Johnston S 1997. Effects of neutering a previous study were associated with being on bodyweight, metabolic rate and glucose overweight or obesity in cat. Therefore, the association tolerance of domestic cats. Res Vet of owner characteristics and contextual factor and Sci. 62(2): 131-136. over-weight cats should be further analyzed. German AJ 2006. The growing problem of obesity in Conclusion dogs and cats. J Nutr. 136, 1940s-1946s. The prevalence of overweight and obesity in cats in Hendriks W, Moughan P and Tarttelin M 1997. Body Thailand is marked. This should alert Thai composition of the adult domestic cat (Felis catus). veterinarians as well as the owners of the importance J Anim Physiol Anim Nutr. 77(1-5): 16-23. of being overweight/obese in cat. As neutering and males are associated with increased risk of overweight, Hoenig M and Ferguson DC 2002. Effects of neutering veterinarian should educate the owners of overweight on hormonal concentrations and energy cats to be aware of obesity -related conditions. requirements in male and female cats. Am J Vet Res. 63(5): 634-639. Acknowledgements Kienzle E and Moik K 2011. A pilot study of the body The authors thank all the veterinarian who assessed weight of pure-bred client-owned adult cats. Br J body condition scores in cat visiting the animal Nutr. 106: S113-S115. hospital. Laflamme D 1997. Development and validation of a Funding: This study was funded by the Faculty of body condition score system for cats: a clinical tool. Veterinary Science, Chulalongkorn University (RG Feline Prac. 25(5): 13-17. 12/2561). Laurence C, Bernard-Marie P, Béatrice L, Jean-Jacques Conflict of interest: The authors declare no conflict of B and Géraldine B 2009. Prevalence and risk factors interest in the study. of obesity in an urban population of healthy cats. J Feline Med Surg. 11(2): 135-140. References Lund EM, Armstrong P, Kirk CA and Klausner J 2005. Bermingham EN, Thomas DG, Cave NJ, Morris PJ, Prevalence and risk factors for obesity in adult cats Butterwick RF and German AJ 2014. Energy from private US veterinary practices. Intern J Appl requirements of adult dogs: a meta-analysis. PloS Res Vet Med. 3(2): 88-96. one 9, e109681. Öhlund M, Palmgren M and Holst BS 2018. Bermingham EN, Thomas DG, Morris PJ and Overweight in adult cats: a cross-sectional study. Hawthorne AJ 2010. Energy requirements of adult Acta Vet Scand. 60(1): 5. cats. Br J Nutr. 103(8): 1083-1093. Panciera D, Thomas C, Eicker S and Atkins C 1990. Cave NJ, Allan FJ, Schokkenbroek SL, Metekohy CA Epizootiologic patterns of diabetes mellitus in cats: and Pfeiffer DU 2012. A cross-sectional study to 333 cases (1980-1986). J Am Vet Med Assoc. 197(11): compare changes in the prevalence and risk factors 1504-1508. for feline obesity between 1993 and 2007 in New Zealand. Prev Vet Med. 107(1-2): 121-133. Rowe E, Browne W, Casey R, Gruffydd-Jones T and Murray J 2015. Risk factors identified for owner- Colliard L, Paragon BM, Lemuet B, Bénet JJ and reported feline obesity at around one year of age: Blanchard G 2009. Prevalence and risk factors of Dry diet and indoor lifestyle. Prev Vet Med. 121(3- obesity in an urban population of healthy cats. J 4): 273-281. Feline Med Surg. 11(2): 135.140. Scarlett J and Donoghue S 1998. Associations between Courcier EA, Mellor DJ, Pendlebury E, Evans C and body condition and disease in cats. J Am Vet Med Yam PS 2012. An investigation into the Assoc. 212(11): 1725-1731. epidemiology of feline obesity in Great Britain: results of a cross-sectional study of 47 companion Teng KT, McGreevy PD, Toribio J, Raubenheimer D, animal practises. Vet Rec. 171(22): 560. Kendall K and Dhand NK 2017. Risk factors for underweight and overweight in cats in Courcier EA, O'Higgins R, Mellor DJ and Yam PS 2010. metropolitan Sydney, Australia. Prev Vet Med. 144: Prevalence and risk factors for feline obesity in a 102-111. first opinion practice in Glasgow, Scotland. J Feline Med Surg. 12(10): 746-753.



Original Article Efficacy of ultrasonic dissection device in staphylectomy surgery in brachycephalic airway obstructive syndrome (BAOS) dogs Sunisa Thunyodom1 Marissak Kalpravidh1 Chanin Kalpravidh1 Wijit Banlunara2 Pasakorn Brikshavana1* Abstract The ultrasonic scalpel instrument was compared with the conventional staphylectomy technique in elongated soft palate surgery in twenty brachycephalic airway obstructive syndrome (BAOS) canines. Patients were randomly divided into the conventional incisional and ultrasonic scalpel group. Operation time (minute), bleeding volume (ml), respiratory distress score, postoperative complications score, pain scores, epithelialization score and inflammatory score were assessed. Two weeks after surgery, soft palates tissues were biopsied from 7 conventional surgery dogs and 8 ultrasonic dissection device applied dogs. The operation time and bleeding volume in the conventional surgery group were significantly higher than that in conventional group (P<0.01 and P<0.001, respectively). In addition, the respiratory distress score was significantly higher in the conventional surgery group compared with the ultrasonic dissection device group on day 3 and day 28 post-operation (P<0.05). There were no significantly different postoperative complication scores, pain scores or inflammatory scores between two groups. The epithelialization score of the UD was significantly higher than that of the conventional group (P<0.05). The ultrasonic dissection device is user friendly, has decreased surgical time, complete hemostasis and provides fewer postoperative complications. The ultrasonic dissection device is recommended in high-risk patients such as those displaying senility, chronic inflammation, or bleeding disorders. Keywords: BAOS, Dog, Staphylectomy, Ultrasonic 1Department of Veterinary Surgery, Faculty of Veterinary Science, Chulalongkorn University, Pathumwan, Bangkok 10330 Thailand 2Department of Veterinary Pathology, Faculty of Veterinary Science, Chulalongkorn University, Pathumwan, Bangkok 10330 Thailand *Correspondence: [email protected] (P. Brikshavana) Thai J Vet Med. 2019. 49(2): 113-120.

114 Thunyodom S. et al. / Thai J Vet Med. 2019. 49(2): 113-120. Introduction 2002; Kamal et al., 2006; Peng et al., 2013), minimal inflammation, good healing and minimal An elongated soft palate is the primary congenital postoperative pain (Wiatrak and Willging, 2002). malformation of brachycephalic bred dogs, which are Moreover, other benefits are user friendliness and less found in 86-100% of brachycephalic airway obstructive obscuring of vision compared with thermal dissection syndrome ( BAOS) affected dogs (Barnes et al., 2006; devices. The objective of this study is to compare the Pratschke, 2014). The overextended soft palate covers efficacy of the ultrasonic dissection device with the the laryngeal orifice which result in a decreasing of conventional surgical technique of elongated soft airway diameter leading to respiratory obstructive palate resection surgery in the upper airway disorders. Early treatment of the primary defects such obstructive syndrome dogs. as stenotic nares and the elongated soft palate results in long-term health advantages. Nowadays, two of the Materials and Methods common techniques used in soft palate resection (staphylectomy) are conventional (dissection and This study was approved by the Animal Care and suturing) and carbon dioxide laser resection. However, Use Committee of Chulalongkorn University, Bangkok there are disadvantages to conventional Thailand (IACUC protocol number 1731028). Twenty staphylectomy, for example bleeding and delayed BAOS dogs were enrolled in this study. Breed, gender, surgical time (Davidson et al., 2001). Whereas, the high age, weight, respiratory scores and anatomical defects temperature of carbon dioxide lasers causes such as stenotic nares, elongated soft palate, tracheal surrounding tissue burning which may cause harmful hypoplasia, laryngeal collapse grade and everted effects to user. tonsils were individually noted. Laryngeal collapse grading was classified into 3 levels (Leonard, 1960). An ultrasonic energy device is commonly used in The respiratory scores were graded as shown in Table tissue dissection and vessel sealing. The mechanical 1. Dogs with a respiratory score of 2, 3, or 4 without a energy from the ultrasonic blade causes denaturation history of respiratory diseases other than BAOS were and the formation of a sticky protein coagulum, which included in the study and were randomly divided into is capable of sealing vessels (Molnar et al., 2004). The the conventional surgery group (n=10) and the advantages of using ultrasonic scalpel resection are a ultrasonic dissection device application group (n=10). decrease surgical time, decreased intraoperative hemorrhage (Inaba et al., 2000; Wiatrak and Willging, Table 1 Respiratory scoring scale Score Respiration 0 Absence of clinical signs related to brachycephalic airway obstructive syndrome 1 Non-permanent snoring, snoring is not particularly loud 2 Non-permanent loud snoring, stetor when exciting 3 Permanent loudly snoring, permanent stetor and sleep apnea 4 Permanent tachypnea, open mouth breathing 5 Cyanosis, agonal breathing Physical condition and hematology such as of the tonsillar crypt. The overextended soft palate was complete blood count (CBC) and blood chemistry alternately excised using Metzenbaum scissors and panels were evaluated before anesthesia. Food and then these was a simple continuous pattern sutured water were withheld for 12 hours before anesthesia. using 4- 0 synthetic absorbable monofilament suture Patients were pre-medicated with acepromazine (taper needle, BiosynTM, Medtronic) in a simple maleate (0.03 mg/kg) intramuscularly (IM) and continuous pattern. morphine sulfate (0.5 mg/kg) IM. Anesthesia was induced by propofol (1-4 mg/kg) intravenously (IV) Ultrasonic dissection device group (UD): Patients and, then maintained by the inhalation of isoflurane (n=10) were placed in sternal recumbency on a surgical with 100% oxygen through endotracheal tube. table. The 13 cm cordless ultrasonic dissection device Intravenous cefazolin (25 mg/kg) and dexamethasone ( Sonicision™ , Medtronic) gripped the overextended (0.5 mg/kg) were administered at the operation time. soft palate tissue and transected laterally from the Laryngoscopy and cervical and thoracic radiography caudal aspect of the tonsillar crypt with maximum were performed immediately after anesthesia power. induction. Rhinoplasty was performed in dogs that had stenotic nares. All surgical procedures, including Operation time, postoperative complication score stenotic nares reconstruction (rhinoplasty) and and intraoperative blood loss were estimated by staphylectomy, were done by the same surgeon. weighing used gauzes and were recorded. Staphylectomy Postoperative care and evaluation: Firocoxib (5 Conventional surgery group (CS): Patients (n=10) were mg/kg) was given orally at 8 hours after surgery, then placed in sternal recumbency on a surgical table. Left it was given every 24 hours until day 4 after surgery. and right stay sutures were placed at the free edges of Water and food were provided at 8 hours after surgery. the soft palate, which was lateral to the caudal aspect Respiratory scores, postoperative complication scores

Thunyodom S. et al. / Thai J Vet Med. 2019. 49(2): 113-120. 115 (Table 2) and pain scores were evaluated at days 1, 3, fixed in 10% neutral-buffered formalin and then 7, 14 and 28 after surgery. The pain score was assessed stained with hematoxylin and eosin and examined by according to the Colorado State University (CSU) acute the same pathologist. All tissue samples were pain scale for dogs (Hellyer and Robinson, 2006). evaluated for the inflammatory scores and the re- Anatomical healing was reinvestigated using epithelialization scores adapted from Sinha and laryngoscopy on day 14 after surgery. Gallagher (2003). Grading began from no acute inflammation and re-epithelialization covering the Histopathological evaluation: The excised soft palate entire wound, normal thickness (score = 1) to tissues from all dogs were kept for histopathological submucosal diffuse inflammatory cells infiltration, evaluation. Two weeks after the surgery, the soft palate more than 1⁄ 2 of one low power field with tissue was biopsied from 7 dogs in the CS and 8 dogs of the necrosis and re-epithelialization at the edge of the UD, with the owner’s permission. Tissue samples were wound (score = 5). Table 2 Postoperative complication scoring scale Score Postoperative complications 0 No complication 1 Coughing, choking 2 Coughing, postoperative bleeding 3 Coughing, postoperative bleeding, aspiration pneumonia 4 Coughing, postoperative bleeding, aspiration pneumonia, dyspnea Statistically significance at P- value <0. 05 was P<0.01. The bleeding volume (median [interquartile calculated using SPSS software ( SPSS for windows Version 22; SPSS: An IBM Company, USA). The range (IQR)]) in the CS (1.95 ml. [1.19 to 3.06 ml.]) was surgical times (minute)(mean±SD) were compared significantly higher than that of the UD (0 ml. [0 to 0 between groups with independent t-test. Internal ml.]), P<0.001. variations in respiratory scores were compared between, before and after staphylectomy using A significant increase in postoperative Wilcoxon signed-rank test. The bleeding volume (ml) respiratory scores compared with preoperative (median, IQR), respiratory scores, postoperative respiratory scores was found in both the CS and UD complication scores, pain scores, inflammatory scores (P<0.05) (Table 5). However, the respiratory score of and the re- epithelialization scores were compared between groups with the Mann–Whitney U test. the UD was significantly lower than those of the CS at day 3 and day 28 post-operation, P<0.05. Results None of patients was not affected by pain as Breed, age and sex of dogs in the CS and UD are zero scores of pain were noted after surgery. The shown in Table 3. The number of dogs having complication scores (median [range]) in both groups preoperative and postoperative elongated soft palate, were (0 [0-1]), P<0.05. stenotic nares, hypoplastic trachea, everted tonsils or laryngeal collapse is shown in Table 4. Inflammatory scores ( median) of the soft palate resected on surgery day and biopsied on day 14 The surgical time of the UD (5.74±1.98 min, range were not significantly different between groups (Table 3.54 to 9.50 min) was significantly shorter than that of 6). The re-epithelialization score (median) on day 14 of the CS (27.08±10.57 min, range 12.26 to 43.57 min), the UD was significantly higher ( P<0. 05) than that of the CS ( Table 6) . Laryngoscopic examination of the wound of the CS and UD are shown in Figure 1a and 2a, respectively. Table 3 Breed, age, and sex of dogs in the conventional and ultrasonic groups Number (%) of dogs P-value Conventional group Ultrasonic group 0.43† Breed 7 (70) 9 (90) 0.85* French bulldog 1 (10) 0 (0) 0.26† Boston Terrier 2 (20) 1 (10) Pug 4.6±2.59 4.4±2.27 Age (years) (mean±SD) 3.5 [1-9] 4.5 [1-8] (median [range]) 7 (70) 9 (90) Sex 3 (30) 1 (10) Male Female † Chi-squared test * Independent t-test

116 Thunyodom S. et al. / Thai J Vet Med. 2019. 49(2): 113-120. Table 4 Number (%) of dogs with preoperative and postoperative elongated soft palate, stenotic nares, hypoplastic trachea, everted tonsils and laryngeal collapse in the conventional and ultrasonic groups. Conventional group Ultrasonic group Pre-op Post-op Pre-op Post-op Elongated soft palate 10 (100) 0 (0) 10 (100) 0 (0) Stenotic nares 9 (90) 0 (0) 9 (90) 0 (0) Hypoplastic trachea 0 (0) 0 (0) 0 (0) 0 (0) Everted tonsil 5 (50) 9 (90) 3 (30) 3 (30) None 2 (20) 0 (0) 1 (10) 4 (40) One site Two sites 3 (30) 1 (10) 6 (60) 3 (30) Laryngeal collapse 6 (60) 8 (80) 4 (40) 4 (40) None Stage 1 3 (30) 1 (10) 2 (20) 3 (30) Stage 2 1 (10) 1 (10) 4 (40) 3 (30) Stage 3 0 (0) 0 (0) 0 (0) 0 (0) Table 5 Respiratory scores (median [IQR]) of the conventional and ultrasonic groups Day Conventional Ultrasonic P-value 0 (preoperative) 3 [3-3] 3 [1.75-3] 0.149 1 1 [0-2.25] 0.5 [0-1.25] 0.377 3 1 [0-2] 0 [0-1] 0.042 7 1 [0-1.25] 0.5 [0-1] 0.208 14 1 [0-1.25] 0 [0-1] 0.126 28 1 [0-1.25] 0 [0-0.25] 0.022 Table 6 Preoperative inflammatory, postoperative inflammatory, and epithelialization scores (median [IQR]) of dogs in the conventional and ultrasonic groups. Score Day Conventional Ultrasonic P-value Inflammatory surgery day 0 [0-1.25] 0 [0-0.25] 0.551 Epithelialization 14 (postoperation) 3 [2-4] 3.5 [2-5] 0.515 14 (postoperation) 2 [2-2] 3 [2-4] 0.049 Discussion surgical time of the UD was significantly less than that of the CS because there was no need for suturing the The French bulldog is the breed of dogs mostly incised soft palate margins which were cauterized and found in this study ( 17/ 20) similar to other reports sealed while cutting. By other techniques of (Findji, 2009; Dunie-Merigot et al., 2010). The primary staphylectomy, surgical times were 5. 15 (Davidson et abnormalities of BAOS found in the present study were al., 2001) and 8. 5 ± 2. 9 (Dunie-Merigot et al., 2010) for elongated soft palate (100%) and stenotic nares (90%), CO2 laser, 11. 8 ± 2. 5 (Dunie-Merigot et al., 2010) for which is similar to findings in the previous study diode laser and 18 ± 4.6 (Dunie-Merigot et al., 2010) for (Meola, 2013). Although tracheal hypoplasia has been found in many BAOS patients (Poncet et al., 2006; electrosurgery. Riecks et al., 2007; De Lorenzi et al., 2009; Bernaerts et The median bleeding volume in the CS was 1.95 ml. al., 2010; Planellas et al., 2012), it was not found in this study because the predominate breed for tracheal (IQR 1.19 to 3.06 ml.), while bleeding was not found in hypoplasia is English bulldog. the UD. The ultrasonic device work by converting electrical energy into mechanical vibration of the blade According to Poiseuille's law, if the airway in the range of 55,000 cycles/s and 50 to 85 µm in peak- decreases to 50%, the resistance to respiration will be to- peak amplitude that generates friction between increased up to 16 times, which can lead to secondary tissues, releasing thermal energy which leads to disease ( Meola 2013) . There was a 60% incidence of protein denaturation and tissue coagulation. Vasanjee everted tonsils in this study, which was slightly over et al. (2006) found that the ultrasonic device was very the study report at 9- 56% ( Meola 2013) . According to Leonard’ s laryngeal collapse grading system, which effective at controlling hemorrhage, better than reported laryngeal collapse grades I, II and III at 30. 7, ligature technique in the hepatic biopsy. Another study 48. 7 and 20. 5% , respectively, in 39 dogs but this study found that ultrasonic energy caused less hemorrhage found laryngeal collapse grade I at 25% and grade II at than laser, monopolar and bipolar cautery (Lantis et al., 25% (De Lorenzi et al., 2009). 1998). The ultrasonic device can seal 5 mm blood The mean surgical time of the CS was 27.08 ± 10.57 vessels and can be used to cut small bowel mesentery min ( range 12. 26 to 43. 57 min) , longer than the time containing multiple blood vessels (Tsirline et al., 2013). reported by Davidson et al. (mean 12.4 min, range 8.58 to 17 min). The mean surgical time of the UD was 5.74 In case of old age and chronic inflammation which are ± 1. 98 min ( range 3. 54 to 9. 50 min) , similar to that more likely to develop hemorrhage, the ultrasonic reported by Michelsen ( 2011) ( range 5 to 8 min) . The device should be used. Michelsen (2011) used the ultrasonic device for soft palate resection in 3 dogs and found postoperative bleeding in 1 of 3 and suggested inexperience of the surgeon might have been the cause.

Thunyodom S. et al. / Thai J Vet Med. 2019. 49(2): 113-120. 117 Figure 1 Postoperative day 14 in the conventional surgery group. (A) Endoscopic picture of the soft palate, (B) Reepithelialization covering the entire wound, irregular thickness (bar = 100 µm.), (C) Submucosal band-like inflammatory cells infiltrate, less than 1/4 of one low power field (bar = 100 µm.). Haematoxylin and Eosin (H&E) stained.

118 Thunyodom S. et al. / Thai J Vet Med. 2019. 49(2): 113-120. Figure 2 Postoperative day 14 in ultrasonic dissection device group. (A) Endoscopic picture of the soft palate, (B) Reepithelialization covering more than half of the wound ( bar = 100 µm.) , (C) Submucosal band- like inflammatory cells infiltrate, between 1/4 and 1/2 of one low power field without tissue necrosis ( bar = 100 µm.) . Haematoxylin and Eosin (H&E) stained.

Thunyodom S. et al. / Thai J Vet Med. 2019. 49(2): 113-120. 111197 All dogs in this study had clinical signs of BAOS 150°C of thermal energy damage during resection which may have caused tissue coagulative necrosis. In without other respiratory problems. The respiratory addition, the tissue samples from the CS was collected from the middle of the wound instead of at the surgery score improved after surgery in all patients, which was knotting area, where the inflammation most likely occurred. However, there was no significant difference the same as Brdecka et al. (2008) and Dunie-Merigot et between groups. al. (2010) studies. In this study, the ultrasonic group The median [ IQR] re- epithelialization score of the CS ( 2 [ 2- 2] ) was significantly less than that of the UD had a better the respiratory score than that of the ( 3 [ 2- 4] ) . This was consistent with the inflammatory score. A high inflammatory score could cause delay in conventional group on all postoperative evaluation wound healing (Barnes et al., 2006). Sinha and Gallagher (2003) reported that epithelialization of the days. The respiratory score ( median [ IQR] ) of the tissue incised by a sharp instrument was faster than that by the ultrasonic device. However, wound healing ultrasonic group on day 3 post-operation (0 [0-1]) was and the respiratory scores on day 14 of both groups were similar. The wounds healed completely significantly lower than that of the conventional group approximately 2 weeks after surgery. A short- term absorbable suture with 50 % tensile strength 6- 7 days (1 [0-2]). This might be due to less tissue edema in the may appropriate for the conventional technique and the stitches can be removed on 14 days after surgery. UD from minimal tissue handling, less hemorrhage Acknowledgements and operation time which were consistent with the I would like to express deep gratitude to the 90th study by Michelsen (2011). wh o a l s o r e p o r t e d that Anniversary of Chulalongkorn University Fund (Ratchadaphiseksomphot Endowment Fund) and staphylectomy using an ultrasonic device did not cause Chulalongkorn University Graduate Scholarship to commemorate the 72nd Anniversary of His Majesty postoperative respiratory complications despite the King Bhumibol Adulydej for financial support. lack of preoperative corticosteroid drugs to prevent References postoperative swelling. The significantly lower Barnes RF, Greenfield CL, Schaeffer DJ, Landolfi J and Andrews J 2006. Comparison of biopsy samples respiratory score (median [IQR]) in the UD compared obtained using standard endoscopic instruments and the harmonic scalpel during laparoscopic and with CS on day 28 after surgery may have been due to laparoscopic-assisted surgery in normal dogs. Vet Surg. 35(3): 243-251. the remaining of a suture as a foreign body reaction. Bernaerts F, Talavera J, Leemans J, Hamaide A, Claeys Second intention healing in ultrasonic dissection group S and Kirschvink N 2010. Description of original endoscopic findings and respiratory functional resulted in a prolonged inflammatory phase. The assessment using barometric whole-body plethysmography in dogs suffering from respiratory score of the ultrasonic group on day 7 after brachycephalic airway obstruction syndrome. Vet J. 183. surgery was higher than the score on day 3 after Brdecka DJ, Rawlings CA, Perry AC and Anderson JR surgery because firocoxib was withdrawn on day 4 2008. Use of an electrothermal, feedback- controlled, bipolar sealing device for the resection after surgery. Non-steroidal anti-inflammatory of the elongated portion of the soft palate in dogs with obstructive upper airway disease. J Am Vet (NSAID) drugs were recommend given until day 7th Med Assoc. 233(8): 1265-1269. after surgery in elongated soft palate resection with the Cook DA, Moses PA and Mackie JT 2015. Clinical effects of the use of a bipolar vessel sealing device ultrasonic device. for soft palate resection and tonsillectomy in dogs, with histological assessment of resected tonsillar In this study, laryngeal saccule and everted tonsils tissue. Aust Vet J. 93(12): 445-451. spontaneously resolved in some dogs 14 days after Crosse KR, Bray JP, Orbell GMB and Preston CA 2015. Histological evaluation of the soft palate in dogs staphylectomy and alarplasty which reduced the affected by brachycephalic obstructive airway syndrome. N Z Vet J. 63(6): 319-325. pressure in the larynx resulting in decreased Davidson EB, Davis MS, Campbell GA, Williamson inflammation. This was consistent with the findings of KK, Payton ME, Healey TS and Bartels KE 2001. Cook et al. (2015) and Riecks et al. (2007). Both reported Evaluation of carbon dioxide laser and conventional incisional techniques for resection of that the correction of everted laryngeal saccules and tonsils was not necessarily in all cases because some dogs spontaneously improved without surgery. Moreover, Poncet et al. (2006) found that the respiratory signs of some dogs without ventriculectomy were better than those with ventriculectomy. There were no significant differences in postoperative complications between the UD and CS. 100% of patients survived without temporary tracheostomy being requested. Cook et al. (2015) reported 0-6.8% major complication after staphylectomy. Postoperative complications in the present study were coughing and gagging which might be due to inflammation from endotracheal intubation or surgery. The histopathology of the soft palate tissues that were resected intraoperatively found severe mucosal hyperplasia, hydropic degeneration of keratinocytes, edema of lamina propria, mucous gland hyperplasia and hyaline degeneration similar to previous reports (Pichetto et al., 2011; Crosse et al., 2015). The inflammatory score (median [IQR]) was not significantly different between groups, but the score on day 14 of the UD (3.5 [2-5]) was higher than that of the CS (3 [ 2- 4] ). This might be due to the ultrasonic dissection device causing more tissue damage than sharp scissors cutting. The ultrasonic device produced

120 Thunyodom S. et al. / Thai J Vet Med. 2019. 49(2): 113-120. soft palates in brachycephalic dogs. J Am Vet Med Pratschke K 2014. Current thinking about Assoc. 219(6): 776-781. brachycephalic syndrome: more than just airways. De Lorenzi D, Bertoncello D and Drigo M 2009. Companion Animal. 19(2): 70-78. Bronchial abnormalities found in a consecutive series of 40 brachycephalic dogs. J Am Vet Med Riecks TW, Birchard SJ and Stephens JA 2007. Surgical Assoc. 235(7): 835-840. correction of brachycephalic syndrome in dogs: 62 Dunie-Merigot A, Bouvy B and Poncet C 2010. cases (1991-2004). J Am Vet Med Assoc. 230(9): Comparative use of CO(2) laser, diode laser and 1324-1328. monopolar electrocautery for resection of the soft palate in dogs with brachycephalic airway Sinha UK and Gallagher LA 2003. Effects of steel obstructive syndrome. Vet Rec. 167(18): 700-704. scalpel, ultrasonic scalpel, CO2 laser, and Findji LaD, G. 2009. Folded flap palatoplasty for monopolar and bipolar electrosurgery on wound treatment of elongated soft palates in 55 dogs. Eur healing in guinea pig oral mucosa. Laryngoscope. J Companion Anim Pract. 19(2): unpaginated. 113(2): 228-236. Hellyer SU and Robinson NG 2006. \"Subject: Canine Acute Pain Scale\" (online). Available: Tsirline VB, Lau KN, Swan RZ, Montero PN, Sindram https://www. researchgate.net/figure/Colorado- D, Martinie JB and Iannitti DA 2013. Evaluation of State-University-Canine-Acute-Pain-Assessment an innovative, cordless ultrasonic dissector. Surg. teaching-tool_fig1_49661913 (2006). Innov. 20(5): 524-529. Inaba H, Kaneko Y, Ohtsuka T, Ezure M, Tanaka K, Ueno K and Takamoto S 2000. Minimal damage Vasanjee SC, Bubenik LJ, Hosgood G and Bauer R 2006. during endoscopic latissimus dorsi muscle Evaluation of hemorrhage, sample size, and mobilization with the harmonic scalpel. Ann collateral damage for five hepatic biopsy methods Thorac Surg. 69(5): 1399-1401. in dogs. Vet Surg. 35(1): 86-93. Kamal SA, Basu S, Kapoor L, Kulandaivelu G, Talpalikar S and Papasthatis D 2006. Harmonic Wiatrak BJ and Willging JP 2002. Harmonic scalpel for scalpel tonsillectomy: a prospective study. Eur tonsillectomy. Laryngoscope. 112(8 Pt 2 Suppl 100): Arch Otorhinolaryngol. 263(5): 449-454. 14-16. Lantis JC, II, Durville FM, Connolly R and Schwaitzberg SD 1998. Comparison of coagulation modalities in surgery. J Laparoendosc Adv Surg Tech A. 8(6): 381-394. Leonard HC 1960. Collapse of the larynx and adjacent structures in the dog. J Am Vet Med 137: 360-363. Meola SD 2013. Brachycephalic airway syndrome. Top Companion Anim Med. 28(3): 91-96. Michelsen J 2011. Use of the harmonic scalpel for soft palate resection in dogs: a series of three cases. Aust Vet J. 89(12): 511-514. Molnar TF, Szanto Z, Laszlo T, Lukacs L and Horvath OP 2004. Cutting lung parenchyma using the harmonic scalpel--an animal experiment. Eur J Cardiothorac Surg. 26(6): 1192-1195. Peng M, Meng Z, Yang Z-H and Wang X-H 2013. The ultrasonic harmonic scalpel for circumcision: experimental evaluation using dogs. Asian J Androl. 15(1): 93-96. Pichetto M, Arrighi S, Roccabianca P and Romussi S 2011. The anatomy of the dog soft palate. II. Histological evaluation of the caudal soft palate in brachycephalic breeds with grade I brachycephalic airway obstructive syndrome. Anat Rec. 294(7): 1267-1272. Planellas M, Cuenca R, Tabar M-D, Bertolani C, Poncet C, Closa JM, Lorente J, Cerón JJ and Pastor J 2012. Evaluation of C-reactive protein, Haptoglobin and cardiac troponin 1 levels in brachycephalic dogs with upper airway obstructive syndrome. BMC Vet Res. 8(1): 152. Poncet CM, Dupre GP, Freiche VG and Bouvy BM 2006. Long-term results of upper respiratory syndrome surgery and gastrointestinal tract medical treatment in 51 brachycephalic dogs. J Small Anim Pract. 47(3): 137-142.

Original Article Production and characterization of polyclonal antibody against major capsid protein of Salmonella bacteriophage SE-W109 Anucha Sangwiman1 Preeda Phothaworn1 Veerachat Muangsombut1 Chutima Chanprasert1,2 Chartchai Chaichana3 Watip Tangjittipokin1 Sunee Korbsrisate1* Abstract Salmonella spp., are important foodborne pathogens that are predominantly found in poultry, swine, eggs and dairy products. Rapid detection of Salmonella contamination in animals and food is urgently needed to reduce the risk of infection. Bacteriophages or phages are viruses that specifically infect and kill bacteria. Our research team at the Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand isolated Salmonella phage SE-W109 that demonstrated a broad host range of infection to various serovars of Salmonella spp., but that did not cross-react with other Gram-negative bacteria. We then set forth to develop this phage for the rapid detection of Salmonella spp. contamination in food samples. However, to achieve this objective, a polyclonal antibody against Salmonella phage SE- W109 is required. In the present study, an optimization condition for rabbit immunization to generate an anti- phage antibody was successfully developed. Western blot analysis revealed that the generated antibody recognized the 45 kDa antigen of Salmonella phage SE-W109 and that it had no cross-reaction with other Salmonella phages or with Salmonella spp. Mass spectrometry analysis and PCR sequencing revealed the 45 kDa antigen to be a major capsid protein of Salmonella phage SE-W109. In conclusion, we report the protocol for generating a polyclonal antibody against a Salmonella phage and that the main antigen recognized by antiserum is a major capsid protein. The identified antibody will be used for further development of a phage-based method for detection of Salmonella contamination in food samples. Keywords: Anti-phage antibody, Bacteriophage, Major capsid protein, Salmonella spp. 1Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand 2Division of Endocrinology and Metabolism, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand 3Siriraj Center Research of Excellence for Diabetes and Obesity, Research Department, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand *Correspondence: [email protected] (S. Korbsrisate) Thai J Vet Med. 2019. 49(2): 121-129.

122 Sangwiman A. et al. / Thai J Vet Med. 2019. 49(2): 121-129. Introduction which suggests that this phage has a broad host range of Salmonella infection that is suitable for the Salmonella spp., which is a Gram-negative development of phage-based rapid detection of Salmonella contamination in food. Therefore, the bacterium, is a leading cause of food poisoning objective of this study was to generate and characterize worldwide that is heavily associated with the a polyclonal antibody against Salmonella phage SE- consumption of chicken and pork meat that is W109 for use in the further development of a rapid and contaminated with the bacteria. There are over 2,500 sensitive assay to detect Salmonella spp. contamination. serovars of Salmonella that have been identified, and Materials and Methods more than 50% of those serovars belong to the S. enterica Ethical approval: Rabbit immunization to facilitate subspecies enterica (Eng et al., 2014). Food poisoning in polyclonal antibody production was approved by the Kasetsart University Institutional Animal Care and infants, elderly people and immunocompromised Use Committee (License number: Ul-01434-2558). patients can produce severe symptoms (Coburn et al., Bacterial strains and phages: A list of the bacterial 2007). Previous studies in Bangkok and other parts of strains and phages is shown in Table 1. Bacteriophage SE-W109 (phage SE-W109), which is specific to Central Thailand have revealed a prevalence of Salmonella spp., was previously isolated by our Salmonella contamination in pork and chicken of 82% research group (Phothaworn et al., unpublished data). All bacterial strains were cultured at 37ºC in Trypticase (33/40 samples) and 62% (25/40 samples), respectively soy agar (TSA) (Titan Biotech Ltd, Delhi, India). Phage were maintained in SM buffer (50 mM Tris-HCL pH (Niyomdecha et al., 2016). Therefore, an urgent need to 7.5, 100 mM NaCl, 8 mM MgSO4, and 0.01% gelatin). Unless otherwise indicated, all reagents were develop a rapid and specific method for detecting purchased from Sigma-Aldrich Corporation, St. Louis, Salmonella contamination in food samples in order to MO, USA. reduce the risk of infection. Preparation of high-titer phages for immunization: Conventional culture methods have traditionally High-titer Salmonella phage SE-W109 for rabbit been considered the gold standard for the isolation and immunization was propagated according to a identification of foodborne pathogens (Zee, 1994). previously described protocol (Kropinski et al., 2009). Briefly, 10 confluent Salmonella phage SE-W109 lysis However, these methods are labor-intensive and time plates (diameter: 150 mm) were covered with 15 ml of consuming because they require at least three days to SM buffer for 5 h at room temperature (RT). Crude produce a result. As a result, alternative rapid methods phage lysates from each plate were pooled and have been developed and reported (Malorny et al., centrifuged at 6,000xg at 4ºC for 45 min. Supernatants were filtered through a 0.45 µm membrane filter 2004; Valadez et al., 2009). However, these methods (Whatman; Sigma-Aldrich Corporation) and then centrifuged again at 18,000xg at 4ºC for 30 min. The require sophisticated equipment that is expensive, that supernatants were gently removed and 2 ml of SM requires specially trained technicians, and that is not buffer was added to cover the pellet before leaving at widely available. Recently, new approaches using 4ºC overnight. The next day, the bacteriophage bacteriophages for the rapid and sensitive detection of suspension was centrifuged at 1,800xg at 4ºC for 15 bacteria have been developed (Hagens and Loessner, min. Finally, the numbers of bacteriophages (Plaque- 2007). forming units; PFU) in the supernatant was quantitated by double-layer plaque assay (Kropinski et Bacteriophages or phages are viruses that al., 2009). specifically infect and kill bacteria, and they are found in almost all environments on Earth (Salmond et al., Double-layer plaque assay: Double-layer plaque assay was performed as previously described (Kropinski et 2015). Examples of phage-based detection methods al., 2009). Briefly, 100 µl of phage suspension was mixed with 100 µl of mid-log phase of Salmonella host strain include the development of anti-γ phage polyclonal before incubation at 37ºC for 20 min to facilitate phage adsorption on bacterial cells. After incubation, phage- antibodies for the rapid detection of Bacillus anthracis adsorbed bacteria were mixed with 3-5 ml of 0.35% (Cox et al., 2015), and the generation of anti-phage A511 melted TSA (Titan Biotech Ltd). The mixture was uniformly poured on to the surface of a 1% TSA plate. polyclonal antibodies for the rapid detection of Listeria The dried plate was incubated overnight at 37ºC and monocytogenes (Stambach et al., 2015). These techniques the number of plaques (PFUs), which represents the number of phages, was counted the next day. require antibodies against bacteriophages for assay development. Although there are reports on the development of phage-based detection assays, the protocol regarding how to generate those anti-phage antibodies have not been described in detail. Our research team previously isolated Salmonella phage SE-W109, which belongs to the Siphoviridae family and we revealed Salmonella phage SE-W109 to be a virulent phage which has only a lytic cycle and does not integrate its genome on the bacterial chromosome (Phothaworn et al., unpublished data). Some phages have both lytic and lysogenic cycles (temperate phage). Lysogenic lifestyle is a major disadvantage, as virulence-associated genes can easily be spread among bacterial pathogens by phage genome integration (Nilsson, 2014). In addition, Salmonella phage SE-W109 can infect and lyse all of 121 isolates of Salmonella spp., including serovars Enteritidis, Typhimurium, Virchow, Hadar, and Choleraesuis (Phothaworn et al., unpublished data),

Sangwiman A. et al. / Thai J Vet Med. 2019. 49(2): 121-129. 123 Rabbit immunization and antibody detection: Blotted proteins were detected by blocking the Salmonella phage SE-W109 (1×1012 PFU/injection) in membrane with 5% skimmed milk (HiMedia Complete Freund's Adjuvant (Sigma-Aldrich Laboratories Pvt. Ltd., India) suspended in 1x Tris- Buffered Saline (TBS; Vivantis Technologies, Selangor, Corporation) was used to subcutaneously inject one Malaysia) with 0.1% Tween 20 (TBST; Sigma-Aldrich adult female white rabbit (age: 2 months, weight: ~2 Corporation) for 2 h, followed by incubation with anti- kg) at 2 to 4 different body sites. Primary immunization was performed with Complete Freund's Adjuvant phage SE-W109 antiserum (1:30,000) diluted in 5% followed by subsequent boosts with Incomplete Freund's Adjuvant (Bio Basic, Inc., Markham, Ontario, skimmed milk for 2 h. After washing with 0.1% TBST, Canada) for a total of 3 boosts (days 7, 15 and 30). The the membrane was incubated with secondary rabbit immunization step was a service performed by antibodies (Goat anti-rabbit antibody, 1:1,000 in 5% the Serology and Diagnostic Laboratory Service, skimmed milk) conjugated with horseradish Faculty of Agriculture (Kamphaeng Saen Campus), peroxidase (Thermo Fisher Scientific, Waltham, MA, Kasetsart University, Nakhon Pathom, Thailand. USA) for 1 h. After washing with TBST, the protein band of interest was detected by adding SuperSignal® To evaluate the immune response against the West Pico Chemiluminescent Substrate (Thermo injected phage antigen, 0.5-1.0 ml blood samples were Fisher Scientific) according to the manufacturer’s collected from the rabbit prior to (day 0) and after instructions. The chemiluminescent signal was immunization to determine the titer of anti-phage SE- determined using a gel imaging system positioned W109 antibody by enzyme-linked immunosorbent under charge-coupled device (CCD) camera (Syngene, assay (ELISA) according to a previously described protocol (Zaczek et al., 2016). Briefly, Salmonella phage Cambridge, United Kingdom). SE-W109 was coated on an ELISA plate (Corning Inc., Corning, NY, USA) and the coated plate was blocked Mass spectrophotometry (MS) analysis for protein with 2% skimmed milk in PBS (Sigma-Aldrich identification: The protein band recognized by anti- phage SE-W109 antiserum (approximately 45 kDa) was Corporation) at 37°C for 1 h. Serially diluted rabbit identified by mass spectroscopy performed by serum (100 µl) was added to the well with subsequent Proteomics International, Perth, Australia. Briefly, the incubation at 37°C for 1 h. After washing with 1x PBS protein band was excised and prepared for tryptic (Sigma-Aldrich Corporation) containing 0.05% Tween digestion before analysis by LC-MS/MS using an Agilent 1260 Infinity HPLC System coupled with a (Sigma-Aldrich Corporation), the binding of antibodies Chipcube Nanospray Interface (Agilent Technologies, Santa Clara, CA, USA) on an Agilent 6540 Mass to coated Salmonella phage SE-W109 antigen was detected by secondary antibody (Goat anti-rabbit Spectrometer (Agilent Technologies). Digested antibody, 1:30,000 in 1x PBS) conjugated with alkaline peptides were loaded onto a ProtID-Chip-150 C18 phosphatase enzyme (Thermo Fisher Scientific, Column (Agilent technologies) and eluted with mobile Waltham, MA, USA) and the enzyme substrate. The phase gradient of water, acetonitrile (Proteomics Int’l), and 0.1% (v/v) formic acid (Proteomics Int’l). The mass optical density (OD) of the sample was then observed spectra of each peptide fragment were analyzed to at a wavelength of 405 nm. identify proteins of interest using MASCOT® sequence matching software (Matrix Science Ltd, London, Purification of anti-phage SE-W109 polyclonal United Kingdom) with MSPnr100 database, Virus antibody: Rabbit serum fraction that contained anti- phage SE-W109 polyclonal antibody was purified by taxonomy. ammonium sulfate precipitation (Wingfield, 2001) and rProtein A SepharoseTM Fast Flow Kit (GE Healthcare, Sequencing of amplified Salmonella phage SE-W109 Chicago, IL, USA) according to the manufacturer’s major capsid DNA: The gene-encoding major capsid instructions. The eluted anti-phage SE-W109 protein of Salmonella phage FSL SP-101 (GenBank polyclonal antibody was dialyzed against 0.1x PBS (Sigma-Aldrich Corporation), and the final antibody accession number KC139511.1, nucleotide positions concentration was determined by Bradford protein 5,779-6,828) was used as a template to design two assay (Bradford, 1976). major capsid primers: forward (5’- SDS-PAGE and Western blot analysis: To identify phage proteins recognized by the antiserum, sodium ATATGAGTGAAAGTGAGCGATTAGC-3’) and dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analysis were reverse (5’-CCTGTCTTTGACATTATGTAGTCTCC- performed, as previously described (Laemmli, 1970; 3’), corresponding to nucleotide positions 5,693-5,718 Towbin et al., 1979). Phages or suspension bacterial cell pellets were suspended in a reduced sample buffer and 6,902-6,876, respectively. The designed PCR (Laemmli, 1970) before heating at 95°C for 15 min. The prepared samples were then separated by 12% SDS- primers are located outside the coding region. PAGE for 2 h. After electrophoresis, proteins were transferred from polyacrylamide gel onto a Therefore, based on the positions of the PCR primer, nitrocellulose membrane using a Trans-Bot® SD Semi- Dry Transfer Cell (Bio-Rad Laboratories, Hercules, CA, the amplified DNA fragment is approximately 1,210- USA). bp in length. Genomic DNA of Salmonella phage SE- W109 was used as a DNA template for amplification with the major capsid primers. The PCR cycle consisted of a hot start at 94°C for 3 mins, followed by 35 cycles of 94°C for 1 min, 60°C for 30 sec, and 72°C for 30 sec, before a final extension of 72°C for 5 min. After amplification, the expected PCR amplicon (1,210-bp) was detected by 1% agarose gel electrophoresis and

1224 Sangwiman A. et al. / Thai J Vet Med. 2019. 49(2): 121-129. subjected to DNA sequencing by Axil Scientific Pte showed rapid anamnestic response, with the Ltd., Singapore. generation of a high titer (1:500,000) of anti-phage SE- W109 antibody on day 45 that remained stable until Results day 75. Serum samples (from days 45, 60 and 75) were Generation of anti-phage SE-W109 polyclonal collected for antibody purification. The concentration antibody: A rabbit was immunized with Salmonella of purified antibody obtained was 1.06 mg/ml. phage SE-W109 (1x1010 PFU/injection). After three boosts (days 7, 15 and 30), antibody responses against Specificity of anti-phage SE-W109 antibody: To investigate the specificity of anti-phage SE-W109 Salmonella phage SE-W109 antigen was not generated antibody, the antiserum was tested against phage SE- or detected. A possible cause for this inability to induce W109 and other phages isolated by our research group. antibodies against phage SE-W109 may be our use of These phages included 5 Salmonella (SE-W88, SE-W112, too low a dose of antigen. For the fourth boost (day 60), STm101, STm118, and STm374) and 3 Burkholderia (BT- we increased the phage SE-W109 antigen to 1x1012 57DW, BT-94DW, and BP-M3) phages. Western blot PFU/injection. The antibody response gradually increased from an antibody titer below 2,000 (day 75 analysis revealed that the antiserum recognized and day 90) to 1:100,000 on day 105 (Fig. 1A). This Salmonella phage SE-W109 antigen molecular weight result suggests that the antigen dose, at least in part, approximately 45 kDa. No positive band was detected contributes to antibody induction. on Western blot analysis of protein antigens from 5 other tested Salmonella phages (Table 1), which To confirm the result and generate more antiserum, suggests no cross-reactivity to our anti-phage SE-W109 a second rabbit was immunized with Salmonella phage antibody against tested Salmonella phages. In addition, SE-W109 (1x1012 PFU/infection) on day 0, followed by the generated antiserum showed no cross-reactivity three boosts on days 7, 15 and 30. As shown in Fig. 1B, when tested against Burkholderia phages (Table 1). antibody response against Salmonella phage SE-W109 Figure 1 Antibody responses of rabbit immunized with Salmonella phage SE-W109. (A) A female white rabbit was immunized with Salmonella phage SE-W109 (1x1010 PFU/injection) followed by 3 boosts (days 7, 15 and 30). This regimen did not induce antibody response. The fourth boost with the amount of Salmonella phage SE-W109 increased to 1x1012 PFU/injection was performed on day 60. Serum samples containing high titer of antibody (1:100,000) (day 105) were generated. (B) Another rabbit was primarily immunized with Salmonella phage SE-W109 (1x1012 PFU/injection) followed by three boosts (days 7, 15 and 30) of 1x1012 PFU/injection and that rabbit also showed antibody induction. Serum samples on days 45, 60 and 75 (titer 1:500,000) were collected for antibody purification. Table 1 Bacterial cells and bacteriophages used in this study, and Western blot analysis of antigens derived from the microorganisms immunostained with anti-phage SE-W109 polyclonal antibody.

Sangwiman A. et al. / Thai J Vet Med. 2019. 49(2): 121-129. 125 Microorganisms No. of isolates Source/ Western blot analysis results Bacteria reference Salmonella enterica serovars: 5 Clinical isolate - 5 Clinical isolate - Enteritidis 5 Clinical isolate - Choleraesuis 5 Clinical isolate - Typhimurium 5 Clinical isolate - Virchow 5 Farm isolate - Hadar 5 Farm isolate - Campylobacter jejuni 5 Clinical isolate - 5 Clinical isolate - Campylobacter coli 5 Clinical isolate - Listeria monocytogenes 1 Unpublished data + 1 Unpublished data - Escherichia coli 1 Unpublished data - Shigella spp. 1 Unpublished data - Phages 1 Unpublished data - 1 Unpublished data - Salmonella phages Phage SE-W109 1 Unpublished data - Phage SE-W88 1 Unpublished data - Phage SE-W112 1 Unpublished data - Phage STm101 59 Phage STm118 Phage STm374 Burkholderia phages Phage BT-57DW Phage BT-94DW Phage BP-M3 Total In addition to testing anti-phage SE-W109 antibody protein antigen recognized by the anti-phage SE-W109 specificity against phages, we further investigated the antibody (Fig. 2), the protein band was excised and activity of the antibody against Salmonella spp. and other bacteria. The reason for this additional testing subjected to mass spectrometry analysis. As showed in against bacterial pathogens is because this antibody Fig. 3, MASCOT® data showed that the 45 kDa protein will be used to develop an assay to detect amplified from Salmonella phage SE-109 matches 6 peptide Salmonella phages in food samples. If it cross-reacts fragments of a major capsid protein derived from with Salmonella spp. and/or other food-borne Salmonella phage FSL SP-101 in the NCBI virus pathogens that may be found in a food sample, it will database (score 166), which suggests that the 45 kDa generate a false-positive result. Table 1 shows that no protein of Salmonella phage SE-109 is a major capsid positive reaction was detected for any of the tested protein. bacteria. Taken together, the aforementioned findings and the results of Western blot analysis suggested that To confirm that the 45 kDa antigen is a phage major the anti-phage SE-W109 antibody is specific to capsid protein of Salmonella phage SE-W109, PCR Salmonella phage SE-W109. analysis was undertaken using PCR primers generated from gene encoding major capsid protein sequences of The 45 kDa antigen is a major capsid protein of Salmonella phage FSL SP-101. As shown in Fig. 4, the Salmonella phage SE-W109: To identify the 45 kDa expected 1,210-bp DNA fragment was detected from DNA amplification. DNA sequencing analysis

126 Sangwiman A. et al. / Thai J Vet Med. 2019. 49(2): 121-129. revealed that the amplified 1,210-bp DNA showed indicates that the 45 kDa antigen of Salmonella phage 100% amino acid sequences similar to the major capsid SE-W109 is a major capsid protein (Fig. 5). protein of Salmonella phage FSL SP-101, which Figure 2 Western blot analysis of Salmonella phage SE-W109 immunostained with anti-phage SE-W109 antibody. (A) Salmonella phage SE-W109 lysates (Lanes 1 and 2) were separated by 12% SDS-PAGE. (B) Lane 1 shows blotted proteins from (A) immunostained with anti-phage SE-W109 antibody and detected by Goat anti-rabbit antibody conjugated with enzyme alkaline phosphatase (secondary antibody) and enzyme substrate. Lane 2 shows blotted proteins from (A) incubated with only secondary antibody to serve as a negative control. Figure 3 Identification of 45 kDa protein of Salmonella phage SE-109 using LC-MS/MS analysis. (A) The MASCOT® score histogram shows hits (score 166) as red bars outside the green portion, which indicates that they are considered a significant match for the major capsid protein of Salmonella phage FSL SP-101. (B) The matched protein fragments are highlighted in bold with sequence coverage and expected mass values.

Sangwiman A. et al. / Thai J Vet Med. 2019. 49(2): 121-129. 127 Figure 4 A 1% agarose gel electrophoresis shows Salmonella phage SE-W109 major capsid protein DNA. Salmonella phage SE- W109 DNA was amplified with PCR primers targeting major capsid protein DNA. Lane 1 shows expected 1,210-bp DNA fragment, with lane 2 used as a negative control (PCR reaction without template DNA). Lane M is a GeneRuler 1Kb DNA ladder. Figure 5 Amino acid sequences of Salmonella phage SE-W109 major capsid proteins aligned with that from Salmonella phage FSL SP-101 (GenBank accession number KC139511.1). The amino acid sequences identified from LC-MS/MS analysis are shown in red. Discussion coli M13 phage that required 5x1010 PFU/infection (Twair et al., 2013), which suggests that different Anti-phage SE-W109 antibody against Salmonella phages may have different levels of immunogenicity. phage SE-W109 was successfully generated. In this The generated anti-phage SE-W109 antibody is specific study, we demonstrated that successful immunization required a phage concentration approximately 1012 to Salmonella phage SE-W109 since it shows no cross- PFU/infection. Concentrations of Salmonella phage SE- reactivity with other phages previously isolated from W109 lower than 1012 PFU/infection were unable to our group that infect Salmonella, such as phages SE- induce an immune response in our study rabbit. The W88, SE-W112, and STm101. immunization dose used in the present study was higher than the dose previously reported in Escherichia Although monoclonal antibody is currently in wider use than polyclonal antibody in immunodiagnostic assays, polyclonal antibody is associated with several

128 Sangwiman A. et al. / Thai J Vet Med. 2019. 49(2): 121-129. advantages that cannot be realized when using a References monoclonal antibody. In general, polyclonal antibody has high affinity and the ability to recognize multiple Bradford MM 1976. A rapid and sensitive method for epitopes, which results in more robust detection. the quantitation of microgram quantities of protein Monoclonal antibody is specific to only one epitope, utilizing the principle of protein-dye binding. Anal and it is more expensive than polyclonal antibody Chem. 2(72): 248-254. (Koczula and Gallotta, 2016). Previous study reported the use of polyclonal antibodies to establish phage- Coburn B, Grassl GA and Finlay BB 2007. Salmonella: based detection systems, such as anti-γ phage the host and disease: a brief review. Immunol Cell polyclonal antibodies that were developed for the Biol. 85(2): 112-118. rapid detection of Bacillus anthracis by lateral flow immunoassay combined with phage amplification Cox CR, Jensen KR, Mondesire RR and Voorhees KJ technique (Cox et al., 2015). Further development of the 2015. Rapid detection of Bacillus anthracis by anti-phage SE-W109 antibody to detect Salmonella gamma phage amplification and lateral flow contamination in chicken meat is currently ongoing in immunochromatography. J Microbiol Methods. our laboratory. 118(51-6): 51-56. Using mass spectrophotometry, we also found that Eng SK, Pusparajah P, Mutalib NSA, Ser HL, Chan KG the 45 kDa antigen recognized by the anti-phage SE- and Lee LH 2014. Salmonella: A review on W109 antibody is the major capsid protein of Salmonella pathogenesis, epidemiology and antibiotic phage SE-W109. This result is consistent with the result resistance. Front Life Sci. 3(8): 284-293. of a previous study that found the major capsid protein of Escherichia coli filamentous phage fd to be a main Hagens S and Loessner MJ 2007. Application of the epitope that is recognized by the antibody (Kneissel et bacteriophages for detection and control of foodborne pathogens. Appl Microbiol Biotechnol. al., 1999). This data suggests that the major capsid 76(3): 513-519. protein of the phage might be the main immunogen Kneissel S, Queitsch I, Petersen G, Behrsing O, Micheel that induces antibody production. The major capsid B and Dubell S 1999. Epitope structures recognized protein is the main component of the phage by antibodies against the major coat protein (g8p) of icosahedral capsid, which functions to encapsidate the phage genome. The Salmonella phage SE-W109 major filamentous bacteriophage fd (Inoviridae). J Mol Biol. capsid protein consists of 349 amino acids (approximately 45 kDa). In addition, amino acid 288(1): 21-28. sequence alignment of Salmonella phage SE-W109 showed 100% similarity to that of the major capsid Koczula KM and Gallotta A 2016. Lateral flow assays. protein of Salmonella phage FSL SP-101. The Salmonella Essays Biochem. 60(1): 111–120. phage FSL SP-101 was previously isolated from a dairy farm located in New York, USA (Switt et al., 2013). Kropinski AM, Mazzocco A, Waddell TE, Lingohr E and Johnson RP 2009. Enumeration of There is no report from Thailand on the isolation of this bacteriophages by double agar overlay plaque phage. The high amino acid identity between the major assay. Bacteriophages methods and protocol. 1st ed. capsid protein of Salmonella phages FSL SP-101 and SE- Clokie MRJ and Kropinski AM (eds.). New York: W109 suggested that the developed anti-phage SE- W109 antibody could recognize both of these phages. Humana Press. 69-76. However, in term of assay development, binding of Laemmli UK 1970. Cleavage of structural proteins anti-phage SE-W109 antibody against phage FSL SP- 101 should have no problem because the assay can be during the assembly of the head of bacteriophage designed to remove other phages in food sample T4. Nat. 227(5259): 680-685. before testing. Malorny B, Paccassoni E and Helmuth R 2014. Conclusion Diagnostic Real-time PCR for detection of Salmonella in food. Appl Environ Microbiol. We report herein a successful protocol for the 70(12): 7046-7052. generation of antibodies against Salmonella phage SE- W109, which could be applied for generation of Nilsson AS 2014. Phage therapy-constraints and antibodies against other Salmonella phages. The major possibilities. Upsala J Med Sci. 119(2): 192-198. antigen recognized by the anti-phage SE-W109 antibody was the major capsid protein of Salmonella Niyomdecha N, Mungkornkaew N and Samosornsuk phage SE-W109. The development of anti-phage SE- K 2016. Serotypes and antimicrobial resistance of W109 antibody to detect Salmonella contamination in Salmonella enteritica isolated from pork, chicken food samples is currently ongoing in our laboratory. meat and lettuce, Bangkok and central Thailand. Southeast Asian J Trop Med Public Health. 47(1): Acknowledgements 31-39. Ms. Phothaworn P., was supported by a Royal Thai Salmond J and Fineran PC 2015. A century of phage: Golden Jubilee Ph.D. Program scholarship past, present, and future. Nat Rev. 13(12): 777-786. (PHD/0137/2556). We thank Mr. Kevin Jones for Stambach NR, Carr SA, Cox CR and Voorhees KJ 2015. reviewing the manuscript. Rapid detection of Listeria by bacteriophage amplification and SERS-lateral flow immunochromatography. Viruses. 7(12): 6631-6641. Swiff AM, Bakker HC, Vongkamjan K, Hoelzer K, Warnick LD, Cummings KJ and Wiedmann M 2013. Salmonella bacteriophage diversity reflects host diversity on dairy farms. Food Microbiol. 36(2): 275-285. Towbin H, Staehelin T and Gordon J 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets:

Sangwiman A. et al. / Thai J Vet Med. 2019. 49(2): 121-129. 129 procedure and some applications. Proc Nat Acad Sci. 76(9): 4350-4354. Twair A, Okla SA, Kawas H and Abbady AQ 2013. Production of polyclonal antibody against M13 phage for application in nanobody technology. Adv Environ Biol. 7(11): 3216-3223. Valadez AM, Luna CA, Tu SI, Morgan MT and Buanai AK 2009. Evanescent wave fiber optic biosensor for Salmonella detection in food. Sensors. 9(7): 5810- 5824. Wingfield P 2001. Protein precipitation using ammonium sulfate. Curr Protoc Protein Sci. 3(1): 1- 10. Zaczek M, Lusiak MS, Jonczyk EM, Weber BD, Miedzybrodzki R, Owczarek B, Kopciuch A, Fortuna W, Rogoz P and Gorski A 2016. Antibody production in response to Staphylococcal MS-1 phage cocktail in patients undergoing phage therapy. Front Microbiol. 7(1681): 1-14. Zee H 1994. Conventional methods for the detection and isolation of Salmonella Enteritidis. Int J Food Microbiol. 2(21): 41-46.



Original Article Restoration of tiger (Panthera tigris) follicles from frozen-thawed ovarian tissues Ajjima Chansaenroj1 Nucharin Songsasen2 Ampika Thongphakdee3 Kaywalee Chatdarong1* Abstract Ovarian tissue cryopreservation has been proposed as a tool to conserve the valuable genetics of endangered species. However, sustaining the viability of follicles and oocytes enclosed within the frozen-thawed tissues is important for the application of this technology. This study evaluated the impact of eCG supplementation on the viability and growth of tiger follicles and oocytes within frozen-thawed ovarian tissues during in vitro culture. Six frozen-thawed ovarian fragments from a tiger obtained post-ovariohysterectomy were included. Twelve antral follicles were mechanically isolated from the ovarian fragments and randomly allocated to two culture conditions (control and 0.05 IU/mL eCG supplementation) and cultured in an alginate hydrogel for 3 days. Follicle growth was evaluated on Day 0 and 3 using Image J software. At the end of the culture, follicles were removed from the hydrogel and stained with neutral red to assess follicle viability. The oocytes were thereafter recovered and evaluated for nuclear status using Hoechst 33258 dye. Follicle diameter in the control group significantly decreased (P < 0.05), whereas that of the eCG supplementation group increased their relative growth (P < 0.05). The oocyte recovery rate from cultured follicles was 33% and 67% in the control and eCG groups respectively (P > 0.05). All recovered oocytes remained in the germinal vesicle phase. The present study showed that tiger frozen-thawed antral follicles could maintain their viability and structure when eCG was supplemented in the culture medium. In conclusion, viable oocytes within follicles can be rescued from the tiger ovarian tissues post-mortem. Keywords: antral follicle, eCG, Endangered, Gamete rescue 1 Research Unit of Obstetrics and Reproduction in Animals, Department of Obstetrics, Gynaecology and Reproduction, Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand. 2 Center for Species Survival, Smithsonian Conservation Biology Institute, Front Royal, VA 22630, USA. 3 Wildlife Reproductive Innovation Center, Bureau of Conservation and Research, Zoological Park Organization under the Royal Patronage of H.M. the King, Bangkok 10300, Thailand. *Correspondence: [email protected] (K. Chatdarong) Thai J Vet Med. 2019. 49(2): 131-136.

132 Chansaenroj A. et al. / Thai J Vet Med. 2019. 49(2): 131-136. Introduction follicle morphology/viability evaluation (Tanpradit et al., 2015; Mouttham and Comizzoli, 2016; Martins et al., During the past decades, many wild felids have 2018); and 3) transplantation of ovarian tissue (Demirel gradually decreased in numbers. Of the 38 wild felids et al., 2018) but the method of isolated follicle culture is worldwide, five species including the tiger (Panthera lacking. tigris) have been classified as endangered by the International Union for the Conservation of Nature To date, the information on isolated follicle culture (IUCN 2019. The IUCN Red List of Threatened Species. from the cryopreserved tissues especially in the tigers Version 2019-1. <https://www.iucnredlist.org>). The is limited. The aims of the present study were to 1) tiger population has rapidly decreased because of the evaluate tiger follicle growth in an alginate hydrogel loss of habitat, declining prey population and direct three-dimensional culture system supplemented with persecution (Goodrich, 2010) contributing to the need or without eCG and 2) investigate the feasibility of for a captive breeding program establishment to secure female gamete restoration from frozen-thawed tiger populations, as well as for education and research ovaries. purposes. Materials and Methods To date, various assisted reproductive technologies (ARTs) developed for the domestic cat have been Chemicals: All chemical used in this study were applied to aid in the genetic management of wild felid purchased from Sigma Aldrich, St Louis, MO, USA, populations. Ovarian stimulation protocols followed unless otherwise indicated. by either in vitro fertilization or artificial insemination with fresh semen have resulted in the production of Samples: Ovaries of an adult tiger (9 years old), housed tiger cubs (Donoghue et al., 1990; Donoghue et al., at the Zoological Park Organization under the Royal 1993). Tiger embryos obtained from in vitro fertilization Patronage of His Majesty the King, were obtained after with frozen-thawed sperm have also been reported ovariohysterectomy in 2013. The ovaries were (Crichton et al., 2003). transported at 4°C in sterile normal saline (NSS) supplemented with 1% penicillin–streptomycin to our For animal post-mortem, cryopreservation of laboratory within 24 h. Upon arrival, blood female gametes enclosed in the ovary is an option for surrounding the tissue was removed and the ovaries preserving female gametes to expand the gene pool. were then washed in NSS supplemented with 1% Moreover, ovarian cryopreservation could solve the penicillin–streptomycin. The ovaries were cut into delay needs for oocyte maturation and embryo small piece before cryopreservation. production. There are three options to cryopreserve oocytes within the follicles: whole ovary, ovarian Ovarian tissue cryopreservation: The ovarian tissue cortex or isolated follicles, using slow freezing or dimension of 5 x 5 x 3 mm3 (75 mm3) was previously vitrification methods. After cryopreservation, frozen- frozen (Thuwanut and Chatdarong, 2012). Briefly, thawed ovarian tissues can be cultured or transplanted ovarian tissues were incubated in the equilibration to the renal capsules of SCID mice (Bosch et al., 2004; solution, composed of medium 199 with Earle’s salts Dos Santos et al., 2016) to produce mature fertilizable (M 199), 20.0% (v/v) fetal calf serum (FCS), 7.5% oocytes. However, the cryopreservation of ovarian dimethyl sulfoxide (DMSO) and 7.5% ethylene glycol cortex provides more success because it allows more (EG), for 10 min and placed in vitrification medium, cryoprotectant perfusion than the whole ovary. which consisted of 0.5 M sucrose, 20.0% (v/v) FCS, Therefore, the in vitro culture of ovarian cortical tissue, 15.0% (v/v) DMSO and 15.0% (v/v) EG in M 199, at which contain abundant of primordial follicles, has 4°C for 30 mins. Tissues were vitrified by plunging on been performed in many mammalian species including to aluminum foil containing liquid nitrogen for 10 humans (Amorim et al., 2011; Herraiz et al., 2014), mice mins, transfer to frozen cryogenic tubes and kept in a (Wang et al., 2011; Youm et al., 2014), cats (Luvoni et al., liquid nitrogen tank. The vitrified tissues were donated 2012; Mouttham and Comizzoli, 2016; Mouttham and to the Research unit of Obstetrics and Reproduction in Comizzoli, 2017; Brito et al., 2018; Martins et al., 2018), Animals, Department of Obstetrics, Gynaecology and cows (Herraiz et al., 2014), sheep (Fathi et al., 2011) and Reproduction, Faculty of Veterinary Science, goats (Carvalho et al., 2013). Furthermore, the Chulalongkorn University, Bangkok, Thailand. advantage of ovarian tissue vitrification in human is to preserve fertility in cancer patients before Ovarian tissue thawing: The ovarian tissues were chemotherapy or radiotherapy (Paulini et al., 2016; taken out of the cryotubes and transferred into a Dolmans, 2018). This approach also provides options thawing solution, composed of M 199, 20.0% (v/v) FCS for rescuing gametes of valuable species that die and 1 M sucrose at 25°C for 10 min and then transferred abruptly or are ovariohysterectomized for medical to the holding medium composed of M 199 containing reasons (Jewgenow and Paris, 2006). Although gamete 25 mM HEPES and 10.0% (v/v) FCS prior to follicle resource banking (GRB) is considered as an important culture. approach to conserve endangered species, the limitation is the availability of mature oocytes. Follicle isolation, encapsulation and culture: Antral Previous studies of frozen-thawed ovarian tissues in follicles (>500 μm; n = 12) were isolated from ovarian the domestic cats (Luvoni et al., 2012; Mouttham and cortical strips using 25G gauge needles. Individual Comizzoli, 2017; Brito et al., 2018; Martins et al., 2018) normal follicles with intact basement membrane and wild felids (Wiedemann et al., 2012; 2013) have without vacuoles or dark cytoplasm (Antonino et al., been conducted with the focus on: 1) cumulus oocyte 2019), were then encapsulated into a bead of alginate complexes culture (Luvoni et al., 2012); 2) preantral

Chansaenroj A. et al. / Thai J Vet Med. 2019. 49(2): 131-136. 133 solution with the first step being transferred into a 5 to (Bulgarelli et al., 2018). The oocytes within positively 10 µL droplet (dependent on follicular size) of 0.5% stained follicles were collected and transferred into a alginate using a 20 µL pipette. Single droplets were mixture of 2 µM Hoechst 33258 in 500 µL holding immersed into a solution containing 50 mM CaCl2 and medium for 15 mins in the dark. The nuclear 140 mM NaCl and alginate beads were allowed to configuration of stained oocytes was examined under cross-link for 2 min, and then washed three times in a a fluorescent microscope (BX51; Olympus) at X 2,000 culture medium: MEM (supplemented with 3 mg/mL magnification. BSA, 2 mM L-glutamine, 10 ng/mL activin, 10 µg/mL insulin, 1.9 µg/mL transferrin, 5 µg/mL selenium, 10 Statistical analysis: Data was analyzed using IBM IU/mL penicillin G sodium and 10 mg/mL SPSS Statistics for Windows, Version 23.0 (Armonk, streptomycin sulfate). The entire procedure was NY: IBM Corp.). Normal distribution and equal performed on a warm plate set at 38°C. For each variance were tested by the Shapiro test and Bartlett's experimental replication, two follicles were cultured in test, respectively. Differences in mean follicle diameter 500 µL of culture medium supplemented with 0 between Days 0 and 3 and the relative growth of the (control) or 0.05 IU/mL eCG at 38.5 °C in 5.0% CO2 in follicle at the end of the culture between control and humidified air for 3 days. There are three replications 0.05 IU/mL eCG supplementation were determined by in the study, totaling six follicles for each treatment. paired t test. Pearson Chi-Square test was used to evaluate the differences in the numbers of oocytes Assessment of follicle growth: Follicle diameter was recovery between the control and eCG treated group at assessed under an inverted microscope at x 1,000 the end of culture. For all statistical analysis, magnification. Screen shots were taken with digital differences were regarded as significant if P < 0.05. camera at Olympus BX51 microscope (Olympus, Germany). Each follicle image was sized from the outer Results layer of somatic cells, with the measurements including the widest diameter and perpendicular The results of frozen-thawed tiger ovarian tissue width in the initial assessment by Image J software, are presented in Table 1. At the end of the culture, the and then, the actual follicle diameter calculated by follicle diameter significantly decreased in the control comparing to the scale bar. The mean of these two group (P < 0.05), whereas the follicle diameter of eCG metrics was calculated and reported in terms of treated group sustained their initial size (P > 0.05). The diameter. The mean diameters of each follicle on Day 0 relative growth of the follicles was significantly and Day 3 were recorded. The relative growth of the different between the control and eCG treated groups follicles (compared to day 0) was calculated. (P < 0.05). In 100% follicle survival (Fig. 1B), four (66.7%) and two (33.3%) oocytes were viable (Table 1). Follicle survival and oocyte nuclear configuration: All oocyte size measured without zona pellucida was Viability of isolated follicles was primarily evaluated ~ 140 µm (141.8 ± 0.9 µm). Hoechst 33258 staining by staining with 50 ng/mL neutral red at 38 °C in 5.0% revealed that the nuclear configuration of all CO2 in atmospheric air for 30 min. Follicles with no red recovered, viable oocytes remained in the germinal coloration were considered dead follicle. Follicles vesicle stage (Fig. 2). incubated with neutral red were classified as surviving follicles when the oocyte and more than 75.0% of the granulosa cells stained positive for neutral red AB Figure 1 Micrographs of (A) Tiger antral follicle encapsulated in an alginate hydrogel on Day 0. and (B) neutral-red positive tiger antral follicle at the end of the culture. Scale bar, 500 µm.

134 Chansaenroj A. et al. / Thai J Vet Med. 2019. 49(2): 131-136. Figure 2 The germinal vesicle stage oocyte stained with Hoechst 33258 at the end of the culture. Scale bar, 50 µm. Table 1 Mean ± SEM of follicle diameter on Day 0 and 3 of culture and the percentage of oocyte recovery at the end of culture. Group n Follicle diameter (µm) Relative growth of Oocyte recovery (%) Day 0 Day 3 the follicle 33.33 Control 6 1,553.10 ± 269.50a 1,514.58 ± 270.85b 0.97±0.01B 66.67 eCG 6 1,541.45 ± 210.54a 1,644.73 ± 230.90a 1.07±0.03A Value with different superscripts (a, b) differ significantly (P<0.05) between culture days. Value with different superscripts (A, B) differ significantly (P<0.05) between groups. Discussion appeared as the important factors contributing to the degeneration of frozen-thawed ovarian tissues in the In this study, the tiger ovarian tissues were vitrified present study. However, in this study, the antral 5 years ago. Although the successful vitrification protocols for feline ovarian tissue have been follicles were obtained from tissue edges that were established (Mouttham and Comizzoli, 2017; Martins probably perfused well by the CPA, resulting in some et al., 2018), the tissues in our experiment showed signs surviving. of degeneration (dark and decomposed appearance) post-thawing. In fact, the essential part of vitrification To the best of our knowledge, there have been no is to permeate the tissue with cryoprotectant to studies of isolated follicle culture in tigers. Our study minimize ice formation. Apart from the selected type of cryoprotectants, an optimal equilibration duration is is the first report of survival of antral follicles cultured important and can affect post-thaw cellular survival from frozen-thawed tiger ovarian tissue after long- (Newton et al., 1998). Using the same protocol, the term storage. The germinal vesicle stage of the oocytes sperm plasma membrane and DNA integrity have revealed by that the tiger ovarian tissues is capable of been protected in the cat testicular tissues (tissue restoring their viability after long-time storage in dimension of 4 x 4 x 4 mm3) (Thuwanut and Chatdarong, 2012). The protocol likely provided liquid nitrogen. Moreover, this study showed that the different results for the cat ovarian tissues in this study. tiger antral follicles responded to eCG similar to those In addition, the post-thawed degeneration appearance in the domestic cats (Chansaenroj et al., 2019). might have occurred because of the initial large tissue Granulosa cell apoptosis and follicular atresia of antral size. In domestic cats, ovarian cortical tissues sliced follicles seemed to be prevented by eCG as described into 1 x 1 x 0.2 mm3 obtained 47% of normal follicles after thawing (Mouttham and Comizzoli, 2017) which previously (Li et al., 1998). In this study, the initial was higher than our study. In baboons, the percentage oocyte size could not be measured because of the large of normal follicles in frozen-thawed ovarian tissues volume of antral cavity. However, the oocytes were sliced into 0.5 x 1.5 x 1 mm3 was higher than those evaluated at the end of the culture. The different sliced into 2 x 1 x 1 mm3 (Lu et al., 2014). Similarly, the culture conditions had no significant effect on the previous investigation of the ovarian tissue size confirmed that tissue dimension of 3 x 3 x 3 mm3 oocyte recovery rate. The recovery oocyte diameters fragments was adequate for cryoprotectant perfusion were approximately 140 µm which is larger than the than the greater dimensions (3 x 3 x 5 mm3 and 3 x 3 x normal size for cat oocytes obtained from antral 7 mm3) (Gorricho et al., 2018). Altogether, the optimal follicles (120 µm) (Izumi et al., 2012). Our finding CPA incubation duration and tissue dimension suggested that the fully-grown oocytes of the tigers are slightly larger than domestic cats (Izumi et al., 2012). The relation between oocyte diameter and meiotic competence has been reported previously in cold storage domestic cat ovaries. The small diameter oocyte is sensitive to low temperatures, granulosa cell degeneration precedes the loss of developmental

Chansaenroj A. et al. / Thai J Vet Med. 2019. 49(2): 131-136. 135 competence of oocytes (Otoi et al., 2001). However, the Chansaenroj A, Songsasen N and Chatdarong K 2019. information on this relation in tigers is limited. Future Equine chorionic gonadotropin induces in vitro research to assess the ability of tiger oocytes recovered follicular growth from the multi-layered from cryopreserved ovarian tissue to develop to secondary developmental stage in cats. complete nuclear maturation are warranted. Theriogenology. 123: 116-122. In conclusion, the rapid transport of tissue at 4°C is Crichton EG, Bedows E, Miller-Lindholm AK, crucial for rescuing the female gametes of valuable Baldwin DM, Armstrong DL, Graham LH, Ford JJ, species. The ovarian tissue size for vitrification is Gjorret JO, Hyttel P, Pope CE, Vajta G and recommended as being less than 3 x 3 x 3 mm3 in order Loskutoff NM 2003. Efficacy of porcine to preserve the survival of follicle post-thaw. In this gonadotropins for repeated stimulation of ovarian study, we demonstrated the feasibility of female activity for oocyte retrieval and in vitro embryo gamete restoration from frozen-thawed tiger ovaries. production and cryopreservation in Siberian tigers The recovered antral follicles can grow and sustain the (Panthera tigris altaica). Biol Reprod. 68(1): 105- viability of immature tiger oocytes in a three- 113. dimensional alginate hydrogel culture system supplemented with eCG. However, appropriate Demirel MA, Acar DB, Ekim B, Celikkan FT, Alkan conditions to complete meiotic maturation and in vitro KK, Salar S, Erdemli EA, Ozkavukcu S, Yar SS, fertilization are worth investigating. Kanca H and Bastan A 2018. The evaluation of xenotransplantation of feline ovarian tissue Acknowledgements vitrified by needle immersed vitrification technique into male immunodeficient mice. Cell The authors acknowledge the Zoological Park Tissue Bank. 19(1): 133-147. Organization under the Royal H.M. the King, Thailand (ZPO) for providing the tiger ovaries. This research Dolmans MM 2018. Recent advances in fertility was supported by the Royal Golden Jubilee (RGJ) preservation and counseling for female cancer Ph.D. Program (PHD/0112/2557), the 90th patients. Expert Rev Anticancer Ther. 18(2): 115- Anniversary of Chulalongkorn University Fund 120. (Ratchadaphiseksomphot Endowment Fund, GCUGR1125593053D) and the Smithsonian Institute. Donoghue AM, Johnston LA, Armstrong DL, Simmons LG and Wildt DE 1993. Birth of a References Siberian Tiger Cub (Panthera-Tigris-Altaica) Following Laparoscopic Intrauterine Artificial- Amorim CA, David A, Van Langendonckt A, Insemination. J Zoo Wildl Med. 24(2): 185-189. Dolmans MM and Donnez J 2011. Vitrification of human ovarian tissue: effect of different solutions Donoghue AM, Johnston LA, Seal US, Armstrong DL, and procedures. Fertil Steril. 95(3): 1094-1097. Tilson RL, Wolf P, Petrini K, Simmons LG, Gross T and Wildt DE 1990. In vitro fertilization and Antonino DC, Soares MM, Junior JM, de Alvarenga embryo development in vitro and in vivo in the PB, Mohallem RFF, Rocha CD, Vieira LA, de Souza tiger (Panthera tigris). Biol Reprod. 43(5): 733-744. AG, Beletti ME, Alves BG, Jacomini JO, Goulart LR and Alves KA 2019. Three-dimensional levitation Dos Santos FA, Pimentel MM, Teixeira AC, Cosmo IC, culture improves in-vitro growth of secondary Lima MA, de Brito PD, de Macedo MF and Bezerra follicles in bovine model. Reprod Biomed Online. MB 2016. Follicular right shift: Xenografting 38(3): 300-311. queens' ovarian tissue into severe combined imunnodeficiency mice and its responses to Bosch P, Hernandez-Fonseca HJ, Miller DM, exogenous gonadotropin. Theriogenology. 86(7): Wininger JD, Massey JB, Lamb SV and Brackett BG 1811-1817. 2004. Development of antral follicles in cryopreserved cat ovarian tissue transplanted to Fathi R, Valojerdi MR, Eimani H, Hasani F, Yazdi PE, immunodeficient mice. Theriogenology. 61(2-3): Ajdari Z and Tahaei LS 2011. Sheep ovarian tissue 581-594. vitrification by two different dehydration protocols and needle immersing methods. Cryo Brito DCC, Domingues SFS, Rodrigues APR, Letters. 32(1): 51-56. Figueiredo JR, Santos RR and Pieczarka JC 2018. Vitrification of domestic cat (Felis catus) ovarian Goodrich JM 2010. Human-tiger conflict: a review and tissue: Effects of three different sugars. call for comprehensive plans. Integr Zool. 5(4): Cryobiology. 83: 97-99. 300-312. Bulgarelli DL, Ting AY, Gordon BJ, de Sa Rosa ESACJ Gorricho CM, Tavares MR, Apparicio M, Fonseca- and Zelinski MB 2018. Development of macaque Alves CE, Macente BI, Mansano CFM and Toniollo secondary follicles exposed to neutral red prior to GH 2018. Vitrification of cat ovarian tissue: Does 3-dimensional culture. J Assist Reprod Genet. fragment size matters? Reprod Dom Anim. 53 35(1): 71-79. (Suppl 3): 125-132. Carvalho AA, Faustino LR, Silva CM, Castro SV, Herraiz S, Novella-Maestre E, Rodriguez B, Diaz C, Lopes CA, Santos RR, Bao SN, Figueiredo JR and Sanchez-Serrano M, Mirabet V and Pellicer A Rodrigues AP 2013. Novel wide-capacity method 2014. Improving ovarian tissue cryopreservation for vitrification of caprine ovaries: Ovarian Tissue for oncologic patients: slow freezing versus Cryosystem (OTC). Anim Reprod Sci. 138(3-4): vitrification, effect of different procedures and 220-227. devices. Fertil Steril. 101(3): 775-784. Izumi T, Sakakida S, Muranishi Y and Nagai T 2012. Allometric study on the relationship between the growth of ovarian follicles and oocytes in domestic cats. J Reprod Dev. 58(4): 484-489.

136 Chansaenroj A. et al. / Thai J Vet Med. 2019. 49(2): 131-136. Jewgenow K and Paris MC 2006. Preservation of Wiedemann C, Hribal R, Ringleb J, Bertelsen MF, female germ cells from ovaries of cat species. Rasmusen K, Andersen CY, Kristensen SG and Theriogenology. 66(1): 93-100. Jewgenow K 2012. Preservation of primordial Li J, Kim JM, Liston P, Li M, Miyazaki T, Mackenzie follicles from lions by slow freezing and AE, Korneluk RG and Tsang BK 1998. Expression xenotransplantation of ovarian cortex into an of inhibitor of apoptosis proteins (IAPs) in rat immunodeficient mouse. Reprod Dom Anim. 47 granulosa cells during ovarian follicular (Suppl 6): 300-304. development and atresia. Endocrinology. 139(3): Wiedemann C, Zahmel J and Jewgenow K 2013. Short- 1321-1328. term culture of ovarian cortex pieces to assess the Lu XL, Yu J, Zhang G, Wei ZT, Li JT and Zhang JM cryopreservation outcome in wild felids for genome conservation. BMC Vet Res. 9: 37. 2014. Effects of varying tissue sizes on the Youm HW, Lee JR, Lee J, Jee BC, Suh CS and Kim SH efficiency of baboon ovarian tissue vitrification. 2014. Optimal vitrification protocol for mouse Cryobiology. 69(1): 79-83. ovarian tissue cryopreservation: effect of Luvoni GC, Tessaro I, Apparicio M, Ruggeri E, cryoprotective agents and in vitro culture on Luciano AM and Modina SC 2012. Effect of vitrified-warmed ovarian tissue survival. Hum vitrification of feline ovarian cortex on follicular Reprod. 29(4): 720-730. and oocyte quality and competence. Reprod Domest Anim. 47(3): 385-391. Martins JLA, Lopes MD, de Souza FF, Possebon FS, Wibbelt G and Jewgenow K 2018. Cat preantral follicle survival after prolonged cooled storage followed by vitrification. Cryobiology. 81: 94-100. Mouttham L and Comizzoli P 2016. The preservation of vital functions in cat ovarian tissues during vitrification depends more on the temperature of the cryoprotectant exposure than on the sucrose supplementation. Cryobiology. 73(2): 187-195. Mouttham L and Comizzoli P 2017. Presence of sucrose in the vitrification solution and exposure for longer periods of time improve post-warming follicle integrity in cat ovarian tissues. Reprod Dom Anim. 52 (Suppl 2): 224-229. Newton H, Fisher J, Arnold JR, Pegg DE, Faddy MJ and Gosden RG 1998. Permeation of human ovarian tissue with cryoprotective agents in preparation for cryopreservation. Hum Reprod. 13(2): 376-380. Otoi T, Murakami M, Ooka A, Karja NW and Suzuki T 2001. Effects of size and storage temperature on meiotic competence of domestic cat oocytes. Vet Rec. 148(4): 116-118. Paulini F, Vilela JM, Chiti MC, Donnez J, Jadoul P, Dolmans MM and Amorim CA 2016. Survival and growth of human preantral follicles after cryopreservation of ovarian tissue, follicle isolation and short-term xenografting. Reprod Biomed Online. 33(3): 425-432. Tanpradit N, Comizzoli P, Srisuwatanasagul S and Chatdarong K 2015. Positive impact of sucrose supplementation during slow freezing of cat ovarian tissues on cellular viability, follicle morphology, and DNA integrity. Theriogenology. 83(9): 1553-1561. Thuwanut P and Chatdarong K 2012. Cryopreservation of cat testicular tissues: effects of storage temperature, freezing protocols and cryoprotective agents. Reprod Dom Anim. 47(5): 777-781. Wang X, Catt S, Pangestu M and Temple-Smith P 2011. Successful in vitro culture of pre-antral follicles derived from vitrified murine ovarian tissue: oocyte maturation, fertilization, and live births. Reproduction. 141(2): 183-191.

Original Article Mycobacterium marinum and Mycobacterium fortuitum infections in Siamese fighting fish, Betta splendens (Regan), in Thailand Sompoth Weerakhun1∗ Peerapol Sukon1 Kishio Hatai2 Abstract Mycobacterium marinum and Mycobacterium fortuitum are important causative agents of mycobacteriosis in fish worldwide. Moreover, M. marinum can cause granulomatous skin lesions in humans. The objectives of this study were to determine the prevalence of Mycobacterium infections in Siamese fighting fish, Betta splendens (Regan), in Thailand and to evaluate the pathogenicity of the Mycobacterium isolates in goldfish. In the prevalence study, 190 Siamese fighting fish (15 moribund and 175 clinically healthy fish), collected from culture farms and ornamental fish markets in Thailand, were included and examined. Mycobacterium spp. were isolated from the kidneys, spleen, liver and gills. The isolates were then identified on the basis of morphological, biochemical characteristics and the analysis of a partial 16S rRNA gene sequence. The prevalence of Mycobacterium infections in this study was 15/15 (100%) in the moribund fish and 50/175 (25.71%) in the clinically healthy fish. In the pathogenicity study, 150 clinically healthy goldfish were used to test for the 2 isolates (Mycobacterium marinum KKVB0901 and Mycobacterium fortuitum KKVB0926). Results from the test showed that both isolates were pathogenic to experimental goldfish. Keywords: Mycobacterium marinum; Betta splendens; Siamese fighting fish; Fish disease 1Faculty of Veterinary Medicine, Khon Kaen University, Khon Kaen 40002, Thailand 2Laboratory of Fish Diseases, Nippon Veterinary and Life Science University, Musashino, Tokyo 180-8602, Japan *Correspondence: [email protected] (S. Weerakhun) Thai J Vet Med. 2019. 49(2): 137-145.

138 Weerakhun S. et al. / Thai J Vet Med. 2019. 49(2): 137-145. Introduction Materials and Methods Mycobacterium marinum and Mycobacterium Sample collection and bacteria isolation: In this fortuitum are known as important causative agents of survey, 15 moribund and 175 clinically healthy mycobacteriosis in many fish species worldwide Siamese fighting fish were randomly collected from 5 including ornamental fish (Beran et al., 2006; Zanoni et culture farms and 3 ornamental fish markets in Khon al., 2008; Gauthier and Rhodes, 2009). Fish Kaen, Ratchaburi and Bangkok provinces, Thailand. Mycobacterium spp., were isolated from the kidneys, mycobacteriosis is a chronic, progressive disease spleen, liver and gills of each fish. The small pieces of affecting many organs of fish such as eyes, gills, each tissue mentioned above were homogenized with visceral organs, muscles, and fins (Gauthier and 4% NaOH for 10 min and then each homogenized Rhodes, 2009) and may result in a significant decrease solution was inoculated on 1% Ogawa medium (Nissui in fish production especially a reduction in the market seiyaku, Japan), Middlebrook 7H10 agar with OADC (Becton Dickinson, USA), and BHI agar (Becton value of ornamental fish (Novotny et al., 2010). The Dickinson, USA) by a loop. In addition, each tissue was affected fish often have granulomatous inflammation, also inoculated on BHI agar without treatment with 4% a specific clinical manifestation, in various organs NaOH for detection of other bacteria. All samples were especially the kidney, digestive tract, liver and spleen incubated at 25 °C for 2 months and then visible (Novotny et al., 2010); however, they also often have colonies were purified. In addition, other bacteria were also been isolated and identified by biochemical test. non-specific clinical signs including abnormal behavior, scale loss, pigment changes, spinal defects, Histopathology: The gills, spleen, kidneys, heart and ascites and emaciation (Gauthier and Rhodes, 2009). In liver from the moribund fish were fixed in 10% addition, M. marinum and M. fortuitum can also be phosphate-buffered formalin solution, and later the found in clinically healthy ornamental fish (Beran et al., gills were decalcified with 10% EDTA solution. The fixed samples were routinely embedded in paraffin 2006). and sectioned at 3 to 5 µm. The sections were stained M. marinum and M. fortuitum are also zoonotic with Haematoxylin and Eosin (H & E), Giemsa, and Ziehl Neelsen. agents causing mycobacteriosis in humans. M. marinum infections in humans have been well Mycobacterium identification: Morphological and documented (Feng et al., 2011; Bonamonte et al., 2013; biochemical characteristics: 63 out of 81 strains isolated from 60 infected fish were selected at random and were Slany et al., 2013; Babamahmoodi et al., 2014). People at used for bacterial identification. They were classified risk are professional fish handlers and aquarists. The according to a manual of clinical microbiology infected cases usually develop cutaneous granulomas, (Herbert and Robert, 1985), Bergey’s manual of commonly known as “fish tank granuloma” or systematic bacteriology (Sneath et al., 1986) and Cowan “swimming pool granuloma” (Wu et al., 2012; Slany et and Steel’s manual for the identification of medical bacteria (Barrow and Feltham, 1993). Morphologies of al., 2013). Although infections with M. marinum or M. the isolated bacteria were observed on 1% Ogawa fortuitum are not a cause of death, severity may be seen medium and Middlebrook 7H10 agar. Motility, shape, in immune-compromised cases probably resulting in Gram-stain, acid-fast, and the growth on Middlebrook invasive infections and serious complications (Tamaki 7H10 agar containing 5% NaCl were examined as et al., 2012; Flondell et al., 2013). described by Herbert & Robert (1985) and Barrow and Feltham (1993). Pigmentation, arylsulfatase reduction, The siamese fighting fish (Betta splendens) is an nitrate reduction, degradation of PAS (para economically important fish for aquaculture in aminosalicylic acid), inhibition by picric acid, urease Thailand. According to a report of Inland Aquatic and tween 80 hydrolysis were tested by commercial Animal Health Research Institute, Thailand in 2010, the standard kits (Kyokuto seiyaku industry, Japan) that fish were exported with a value over 12 million USD. can differentiate 16 different species in the genus Mycobacterium. This value had increased more than 10 times compared with that in 2009. More interestingly, Siamese fighting A partial 16S rRNA gene sequence: Two strains fish can be used as a biological control of an Aedes (KKVB0901 and KKVB0926) from different kinds of aegypti larva, a vector of dengue disease that is found biochemical characteristics used for the identification in tropical and subtropical regions around the world were selected at random for comparative analysis of a partial 16S rRNA gene sequence. The partial 16S rRNA (Cavalcanti et al., 2009; de Oliveira Lima et al., 2010; gene was amplified and sequenced using PCR Paiva et al., 2014). The prevalence of mycobacterium employing six prokaryotic 16S rRNA universal infections in ornamental fish or fresh water fish varies primers as described by (Kageyama et al. 2004) (Table from as low as 1.7% in one study (Mrlik et al., 2012) to 1). The 50 μL reaction mixtures contained 1.2U Taq as high as 41.7% in another study (Slany et al., 2014) and DNA polymerase (Promega, USA), 1.5 mM MgCl2, 0.25 mM deoxynucleotide triphosphate, 0.25 μM each depends on methods of bacterial detection (Slany et al., primer such as forward 8F (5’- 2014). Although the prevalence of Mycobacterium AGAGTTTGATCCTGGCTCAG-3’) and reverse infections in Siamese fighting fish has been reported, primer 1542R (5’-AGGAGGTGGATCCAGCC-3’) and little is known about the pathogenicity of Mycobacterium spp. isolated from Siamese fighting fish. The objectives of the study were to determine the prevalence of Mycobacterium spp. in moribund and clinically healthy Siamese fighting fish collected from culture farms and ornamental fish markets in Thailand and to evaluate the pathogenicity of the isolated Mycobacterium spp., in goldfish, Carassius auratus (L.).

Weerakhun S. et al. / Thai J Vet Med. 2019. 49(2): 137-145. 139 one bacterial colony of the strains in the buffer water, 4 µl of BigDye Terninator V1.1 Cycle Sequencing supplied with a commercially available Promega Kit (Applied Biosystems, USA), and 1 µl (3.0 pmol/µl) TaqTM. Amplifications were performed by a PCR of each primers, such as 8F, 520F, 926F, 691R, 1100R thermal cycler (TaKaRa, Japan) and the following and 1542R. Each vial consisted of only one kind of amplification conditions were used: 1 cycle of 94 °C (4 primer. The product was placed in a PCR thermal min), followed by 40 three-step cycles of denaturizing cycler and the following amplification conditions were at 94°C (1 min), annealing 60 °C (1 min), extension at used, 1 cycle of 98°C (4 mins), followed by 25 three-step 72 °C (2 mins), and a final extension cycle at 72 °C (5 cycles of denaturizing at 98°C (10 secs), annealing 50°C min). The PCR products were electrophoresed on a 2% (7 secs), and extension at 60°C (4 mins). Then the agarose gel stained by ethidium bromide and product was precipitated and dehydrated. They were illuminated with UV light. Each PCR product was sequenced using an automated sequencer (3100 Avant recovered and purified by PCR purification kit Genetic Analyzer, ABI PRISM) according to standard (ExoSAP-IT, Ambion, CA). Briefly, 5 µl of PCR product manufacturers’ protocols. Alignment of the nucleotide was mixed into 2 µl of ExoSAP-IT and incubated at sequences and homology analysis were analyzed using 37°C (15 min) and inactivate ExoSAP-IT by heating to SeqMan software (DNAstar) and BLAST programs 80°C (15 min). Then, 1 µl of PCR product was placed (http://www.ncbi.nlm.nih.gov/blast). into 6 vial (0.2 ml vial), containing 14 µl of DNase free Table 1 Six prokaryotic 16S rRNA universal primers used for the identification of Mycobacterium spp., in this study Primer 5’- AGAGTTTGATCCTGGCTCAG-3’ Forward 8F 5’- CAGCAGCCGTAATAC -3’ Forward 520 F 5’- AAACTCAAAGGAATTGACGG -3’ Forward 926 F 5’- TCTACGCATTTCACC -3’ Reverse 691 R 5’- GGGTTGCGCTCGTTG -3’ Reverse 1100 R 5’- AGGAGGTGGATCCAGCC -3’ Reverse 1542 R Pathogenicity test: A total of 150 clinically healthy the bacteria were re-isolated. These sample collections goldfish, Carassius auratus (L.), (3.25-4.10 g in body and investigations were performed for reasons of weight and 17-20 cm in total length) were used for medical indication. The experiments were conducted experimental infection. The goldfish is a suitable in strict accordance with the recommendation in the infection model and often used for pathogenicity study Japanese guidelines and regulations for scientific and (Talaat et al., 1998; Choe et al., 2017; Jin et al., 2019) and ethical animal experimentation (the 3R principal) and bacterial infection need to investigate before using followed the previous methods of Weerakhun et al. instead of the Siamese fighting fish that may be (2008). naturally infected. The cumulative mortality observation requires a long observation period because Results the bacterial infection might grow slowly and because Prevalence: The prevalence of Mycobacterium infections of unstable disease formation. Therefore, the was 15/15 (100.0%) in the moribund fish but was experiments are necessary to use animals in sufficient 50/175 (25.7%) in the clinically healthy fish. Almost all amount. These fish were fed pellets on a daily basis and fish were infected with M. marinum and M. fortuitum. then were divided equally into 5 groups (4 Co-infections with these bacteria accounted for 60.0% experimental groups and 1 control group, n = in the clinically healthy fish, include Aeromonas hydrophila, Pseudomonas spp., Streptococcus spp. and 30/group). Mycobacterium marinum KKVB0901 was Edwardsiella tarda. However, the Mycobacterium adjusted with 0.85% NaCl to 2.83 x 105 and 2.83 x 103 infections in the moribund fish were identified as only CFU mL-1 (for group 1, the higher dose of M. marinum M. marinum. and group 2, the lower dose of M. marinum, respectively) and M. fortuitum KKVB0926 was adjusted Clinical signs and gross findings: The affected fish had lethargy, anorexia, emaciation, and abdominal with 0.85% NaCl to 3.49 x 105 and 3.49 x 103 CFU mL- distension (Fig 1a). Coelomic membrane edema with 1 (for group 3, the higher dose of M. fortuitum and group 4, the lower dose of M. fortuitum, respectively). ascites was seen (Fig 1b). Inflammation of several In experimental infection groups, each fish was internal organs with white nodules was generally intramuscularly injected with the bacterial suspension found including the kidneys, spleen, and liver. Hepatomegaly, splenomegaly, and kidney according to group assignments described above at a enlargement were observed (Fig 1c). dose of 0.1 mL per fish. In control group, each fish was intramuscularly injected with 0.1 mL of 0.85% NaCl. Histopathological findings: Acid-fast bacilli stained All groups were observed for cumulative with Ziehl-Neelsen were found in the granulomas and mortalities and bacteria were re-isolated from parenchyma of examined tissues (Fig 2a). moribund fish at various times post-infection. At the end of the experiment, 210 days after experimental Disseminated granulomatous hepatitis, infection, the surviving fish were euthanised followed IACUC methods by appropriately trained personnel granulomatous splenitis and granulomatous nephritis with sedative agents: tricaine methane sulfonate, then were observed. All granulomas were classified as soft rapid submerging of the fish in 2 to 4◦C for 10 minutes following cessation of operculum movement. Finally, tubercle-type without caseous necrosis in the center and without the hard periphery so that fibroblast and

140 Weerakhun S. et al. / Thai J Vet Med. 2019. 49(2): 137-145. multi-layer of epitheloid cells could be found at the The electrophoresis figure showed specific primer border of the granuloma (Fig 2b). pairs amplified the expected size PCR products from two isolates KKVB0901 and KKVB0926 compared Identification: According to the morphological and other Mycobacterium spp. (Fig 3). The products of biochemical characteristics, the bacterial isolates could approximately 1400 bp length of a partial 16S rRNA be classified into 2 different types. The first type gene of both isolates were analyzed. The isolates were consisted of 39 strains that were Gram-positive, acid- identified as Mycobacterium marinum and fast, non-motile and photochromogenic. All of these Mycobacterium fortuitum, respectively. This strains were slowly growing at 15 to 32 ˚C with an identification was in accordance with their optimum temperature of 25 ˚C on Middlebrook 7H10 morphological and biochemical characteristics. agar showing smooth colony. The colony did not grow on 5% NaCl Middlebrook 7H10 agar. They were Pathogenicity test: The cumulative mortality of the negative for the reduction of nitrate and degradation of goldfish injected with M. marinum KKVB0901 and M. PAS. The isolated bacteria resisted picric acid fortuitum KKVB0926 depended on the dose (Fig 4). inhibition and were positive for reduction of However, no fish died within 90 days after the arylsulfatase (at day 14), urease, Tween 80 hydrolysis experimental infection. The experiments were (at day 5), and semi-quantitative catalase. These strains continually observed for 210 days. The fish injected were classified as Mycobacterium marinum (Table 2). with a higher dose of M. marinum KKVB0901 died at The second type consisted of 24 strains that were also 100.0% within 156 days, whereas the lower dose died Gram-positive, acid-fast and non-motile; however, at 100.0% on day 197 after experimental infection (Fig these strains were non-photochromogenic and had 4a). The fish injected with higher dose and lower doses rapid growth at 15 to 42˚C with an optimum of M. fortuitum KKVB0926 died at 88.0% and 72.0%, temperature of 25-37˚C on Middlebrook 7H10 agar and respectively within 210 days after the experimental were rough colony. They can grow on 5% NaCl infection (Fig 4b). Results from re-isolation of the Middlebrook 7H10 agar. They were positive for all the bacteria showed that 100% of the experimental fish same biochemical tests used identified Mycobacterium were positive for both M. marinum and M. fortuitum. In spp. These strains were classified as Mycobacterium contrast, no fish in the control group died and all fish fortuitum (Table 2). in this group were negative for the bacterial culture and isolation. (a) (b) (c) (d) K K S S Figure 1 Gross lesions of Siamese fighting fish (a, b, c) and goldfish (d). (a) Abdominal distension. (b) Ascites (black arrow). (c, d) Hepatomegaly and ascites, kidney enlargement (K), splenomegaly (S).

Weerakhun S. et al. / Thai J Vet Med. 2019. 49(2): 137-145. 141 (a) (b) (c) (d) Figure 2 (a) Acid-fast bacteria in examined tissue (white arrow). Ziehl-Neelsen staining. Bar = 20 µm. (b) Mycobacterium was observed in the center, and the large proliferating fibroblast and multiple layers of epitheloid cells were found in the periphery. Ziehl-Neelsen staining. Bar = 30 µm. (c) Granulomatous nephritis. Ziehl-Neelsen staining. Bar = 10 µm. (d) Granulomatous splenitis. Ziehl-Neelsen staining. Bar = 10 µm. Table 2 Biological and biochemical characteristics of Mycobacterium spp., isolated from Siamese fighting fish Picric acid Urease Arylsulfatase, 14 days Arylsulfatase, 3 days Tween hydrolysis, 5 days Nitrate reduction Degradation of PAS Growth rate at 25C Pigmentation Colony type Motility Acid-fast stain Gram stain Isolate M. marinum +a + Nb S/ SRc Pd Se -f - +- ++- M.fortuitum subsp.acetamidolyticum + + N Sf/Rf N R - + Vg + NDh + - M. fortuitum subsp.fortuitum + + N Sf/Rf N R + + V + ND + + M. fortuitum subsp.peregrinum + + N Sf/Rf N R + + V + ND + + M. chelonae subsp.abscessus + + N S/R N R + - V + ND + + M. chelonae subsp.chelonae + + N S/R N R + - V + ND + - KKVB0901-KKVB0915 + + NS PS- - +- ++- KKVB0916-KKVB0925 + + NS PS- - +- ++- KKVB0926-KKVB0935 + + NR NR + + + + + + + KKVB0936-KKVB0945 + + NS PS- - +- ++- KKVB0946-KKVB0955 + + NR NR + + + + + + + KKVB0956-KKVB0959 + + NS PS- - +- ++- KKVB0960-KKVB0963 + + NR NR + + + + + + + * Modified from Herbert and Robert (1985), Sneath et al., (1986) and Barrow and Feltham (1993). a: Positive, b: Non-motility, c: S, smooth; SR, intermediate in roughness; R, roughness; f, filamentous, d: P, photochromogenic; N, nonphotochromogenic e: S, slow; M, moderate; R, rapid, f: negative, g: V, variable, h: ND, not determined, i: d, 11 – 89% of strains are positive

142 Weerakhun S. et al. / Thai J Vet Med. 2019. 49(2): 137-145. M12 3 45 67 8 1500 bp Figure 3 The results of PCR amplification of Mycobacterium spp. isolated from fishes by electrophoresis. Lane M, marker; lane 1, negative control; lane 2, Mycobacterium marinum NJB0419; lane 3, Mycobacterium chelonae NJB0414; lane 4, Mycobacterium fortuitum NJB0505; lane 5, KKVB0901; lane 6, KKVB0902; lane 7, KKVB0926; lane 7, KKVB0927. (a) (b) 120 100 Control 90 Control 80 High Dose 100 70 Low Dose High Dose 60 50 80 Low Dose 40 30 60 20 10 40 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 20 Days after injection (x10) 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Days after injection (x10) Cumulative mortality (%) Cumulative mortality (%) Figure 4 The cumulative mortality of goldfish intramuscularly injected with (a) Mycobacterium marinum KKVB0901 and (b) Mycobacterium fortuitum KKVB0926 suspension of high and low dose. The clinical signs and histological features of the but was 100.0% in the moribund fish that closely relates experimentally infected goldfish closely resembled those observed in Siamese fighting fish naturally with a previous study (Pungkachonboon et al., 1992). infected with the bacterium. The goldfish had retarded However, the prevalence of mycobacterium infections growth, cutaneous ulceration at the site of injection and in ornamental fish or fresh water fish may vary from as abdominal distension. The necropsy findings were low as 1.7% in one study (Mrlik et al., 2012) to as high hepatomegaly, splenomegaly, kidney enlargement as 41.7% in another study (Slany et al., 2014) and is with white nodules and ascites (Fig 1d). Acid-fast bacilli stained with Ziehl-Neelsen were found in the dependent on the methods of bacterial detection (Slany granulomas and parenchyma of the examined tissues. et al., 2014). The results of this study indicated that Distinct lesions were disseminated granulomatous clinically healthy Siamese fighting fish from cultured inflammation of kidney (Fig 2c), spleen (Fig 2d), liver, farms and ornamental fish markets in Thailand were pancreas, muscle fiber and vertebrae. Most reservoir for M. marinum and M. fortuitum with lower granulomas were also soft tubercle-type. prevalence and more difficult to detect compared with Discussion the moribund fish. Therefore, concern should be raised for people at risk especially the sellers or the buyers to The isolates were identified as M. marinum and M. avoid mycobacterial infections from clinically healthy fortuitum on the basis of morphological and Siamese fighting fish. biochemical characteristics as in previously reported papers (Herbert et al., 1985; Sneath et al., 1986; Barrow Results of this study also showed that there was and Feltham, 1993) and of the analysis of a partial 16S high morbidity of mycobacteriosis in Siamese fighting rRNA gene sequence. The prevalence of Mycobacterium fish in Thailand. Although most naturally infected spp., in this study was 25.7% in clinically healthy fish Siamese fighting fish presented with subclinical signs, clinical signs and histopathological findings of the moribund fish closely resembled those observed in experimentally infected goldfish. The clinical signs of the experimentally infected goldfish were lethargy,

Weerakhun S. et al. / Thai J Vet Med. 2019. 49(2): 137-145. 143 anorexia, emaciation, abdominal distension and KKVB0926 isolated from Siamese fighting fish were ascites. Histopathological findings were disseminated effective pathogens in goldfish. The cumulative granulomatous inflammations of multi-organs which mortalities of the goldfish injected with both bacteria were found similarly in other species of affected fish were depended on the dose (Weerakhun et al., 2008). (Majeed et al., 1981; Shamsudin et al., 1990; Gómez, Moreover, M. marinum KKVB0901 accidentally 1998; Brocklebank et al., 2003; Overton et al., 2003; infected one of the authors on his finger by Weerakhun et al., 2007). Moreover, all granulomas unintentional injection of the bacterium. The affected were classified as a soft tubercle-type that could be site showed cutaneous ulceration with pustules after 4 explained as the bacteria being weakly harmful weeks of injection (Fig 5). He was treated with pathogens, slow growing and slow progression, or on clarithromycin for 2 months and recovered. This early stage of the diseases (Hatai et al., 1993; iatrogenic case confirmed the pathogenicity in human Puttinaowarat et al., 2002; Brocklebank et al., 2003; that M. marinum can cause skin lesions in human Overton et al., 2003; Weerakhun et al., 2008). (Johnston and Izumi, 1987; Edelstein, 1994; Histopathological findings at the periphery of Ramakrishnan, 1997; Ryan and Bryant, 1997; Lim et al., granulomas were the multiple layers of epitheloid cells 2000; Weitzul et al., 2000). In severe cases, other lesions and proliferating fibroblasts. Numerous acid fast may be found such as chronic breast abscess, rhinitis, bacilli could be found in the examined organs arthritis, tenosynovitis and bone lysis (Harth et al., (Brocklebank et al., 2003; Weerakhun et al., 2008). 1994; Barton et al., 1997; Shih et al., 1997; Saadatmand et Results from the pathogenicity test showed that al., 1999; Van Seymortier et al., 2004; Lam et al., 2006). Mycobacterium marinum KKVB0901 and M. fortuitum Figure 5 Accidental infection in one of the authors with Mycobacterium marinum KKVB0901. The skin inflammation was found in the second week after infection and then the lesion was progressed week by week. In conclusion, this study showed high morbidity of with sporotrichoid presentation. Iranian Red Mycobacterium infections in Siamese fighting fish. Two species, M. marinum and M. fortuitum, were isolated Crescent Medical Journal, 16, e10120. and these can be potent pathogens in goldfish, Barrow GI and Feltham RKA 1993. Cowan and Steel’s confirmed by pathogenicity test. The clinical signs and histological findings of moribund Siamese fighting fish Manual for Identification of Medical Bacteria. 3rd were similar to those of experimentally infected edn. Cambridge University Press, Cambridge. 262 goldfish. Moreover, the accidental infection with M. pp. marinum in a human strengthened its effective, zoonotic pathogen. Barton A, Bernstein RM, Struthers JK and O'neill TW 1997. Mycobacterium marinum infection causing Acknowledgements septic arthritis and osteomyelitis. British Journal of Rheumatology, 36, 1207-1209. This study was funded by the Japan Student Services Organization and Faculty of Veterinary Beran V, Matlova L, Dvorska L, Svastova P and Pavlik Medicine, Khon Kaen University. I 2006. Distribution of mycobacteria in clinically References healthy ornamental fish and their aquarium environment. Journal of Fish Diseases, 29, 383-393. Babamahmoodi F, Babamahmoodi A and Nikkhahan B Bonamonte D, De Vito D, Vestita M, Delvecchio S, 2014. Review of Mycobacterium marinum infection Ranieri LD, Santantonio M and Angelini G 2013. reported from Iran and reports of three new cases Aquarium-borne Mycobacterium marinum skin infection. report of 15 cases and review of the literature. European Journal of Dermatology, 23, 510-516. Brocklebank J, Raverty S and Robinson J 2003. Mycobacteriosis in Atlantic salmon farmed in

144 Weerakhun S. et al. / Thai J Vet Med. 2019. 49(2): 137-145. British Columbia. Canadian Veterinary Journal, 44, Lam A, Toma W and Schlesinger N 2006. 486-489. Mycobacterium marinum arthritis mimicking Cavalcanti LP, De Paula FJ, Pontes RJ, Heukelbach J rheumatoid arthritis. Journal of Rheumatology, 33, and Lima JW 2009. Survival of larvivorous fish 817-819. used for biological control of Aedes aegypti larvae Lim YW, Chia J and Looi KP 2000. A case report of in domestic containers with different chlorine concentrations. Journal of Medical Entomology, 46, Mycobacterium marinum infection of the hand. 841-844. Singapore Medical Journal, 41, 221-223. Majeed SK, Gopinath C and Jolly DW 1981. Pathology De Oliveira Lima JW, De Goes Cavalcanti LP, Pontes RJ and Heukelbach J 2010. Survival of Betta of spontaneous tuberculosis and splendens fish (Regan, 1910) in domestic water pseudotuberculosis in fish. Journal of Fish containers and its effectiveness in controlling Diseases, 4, 507-512. Aedes aegypti larvae (Linnaeus, 1762) in Northeast Mrlik V, Slany M, Kubecka J, Seda J, Necas A, Babak V, Slana I, Kriz P. and Pavlik I 2012. A low prevalence Brazil. Tropical Medicine and International Health, 15, 1525-1532. of mycobacteria in freshwater fish from water Choe Y, Park, J, Yu JE, Park D, Oh JI, Kim S, Moon KH reservoirs, ponds and farms. Journal of Fish and Kang HY 2017. Goldfish, Carassius auratus, as Diseases, 35, 497-504. an infection model for studying the pathogenesis of Novotny L, Halouzka R, Matlova L, Vavra O, Bartosova L, Slany M and Pavlik I 2010. Edwardsiella piscicida. Veterinary Research Communications, 41, 289-297. Morphology and distribution of granulomatous Edelstein H 1994. Mycobacterium marinum skin inflammation in freshwater ornamental fish infections: Report of 31 cases and review of the infected with mycobacteria. Journal of Fish literature. Archives of Internal Medicine, 154, 1359- Diseases, 33, 947-955. Overton AS, Margraf FJ, Weedon CA, Pieper LH and 1364. Feng Y, Xu H, Wang H, Zhang C, Zong W and Wu Q May EB 2003. The prevalence of mycobacterial infections in striped bass in Chesapeake Bay. 2011. Outbreak of a cutaneous Mycobacterium Fisheries Management and Ecology, 10, 301-308. marinum infection in Jiangsu Haian, China. Paiva CN, De Oliveira Lima JW, Camelo SS, De França Diagnostic Microbiology and Infectious Disease, Lima C and De Góes Cavalcanti LP 2014. Survival 71, 267-272. of larvivorous fish used for biological control of Flondell M, Ornstein K and Björkman A 2013. Invasive Aedes aegypti (Diptera: Culicidae) combined with different larvicides. Tropical Medicine and Mycobacterium marinum infection of the hand. International Health, 19, 1082-1086. Journal of Plastic Surgery and Hand Surgery, 47, Pungkachonboon T, Shariff M, Tajima K and 532-534. Lawhavinit O 1992. Isolation and characterization Gauthier DT and Rhodes MW 2009. Mycobacteriosis in of Mycobacterium sp. from Siamese fighting fish fishes: A review. Veterinary Journal, 180, 33-47. Betta splendens Regan. In: Disease in Asian Aquaculture M Shariff, RP Subsinghe and JR Gómez S 1998. Unusual morphopathological features Arthur (eds) Asian Fisheries Society, Manila, in a case of fish tuberculosis. Journal of Fish Diseases, 21, 237-239. Philippines: 291-298. Puttinaowarat S, Thompson KD, Kolk A and Adams A Harth M, Ralph ED and Faraawi R 1994. Septic arthritis due to Mycobacterium marinum. Journal of 2002. Identification of Mycobacterium spp. isolated Rheumatology, 21, 957-960. from snakehead, Channa striata (Fowler), and Siamese fighting fish, Betta splendens (Regan), Hatai K, Lawhavinit O, Toda K and Sugou Y 1993. Mycobacterium infection in pejerrey, Odonthestes using polymerase chain reaction–reverse cross blot hybridization (PCR–RCBH). Journal of Fish bonariensis Cuvier & Valenciennes. Journal of Fish Diseases, 25, 235-243. Diseases, 16, 397-402. Ramakrishnan L 1997. Images in clinical medicine. Herbert MS and Robert CG 1985. Mycobacterium. In: Mycobacterium marinum infection of the hand. Manual of Clinical Microbiology, 4th ed ED Lennette, A Balows, WJ Hausler and HJ Shadomy The New England Journal of Medicine, 337, 612. Ryan JM and Bryant GD 1997. Fish tank granuloma--a (eds) American Society for Microbiology, Washington, DC: 216-246. frequently misdiagnosed infection of the upper Jin S, Fu S, Li R, Dang H, Gao D, Ye S and Jiang Z 2019. limb. Journal of Accident and Emergency Identification and histopathological and Medicine, 14, 398-400. pathogenicity analysis of Aeromonas salmonicida Saadatmand B, Poulton JK and Kauffman CL 1999. salmonicida from goldfish (Carassius auratus) in Mycobacterium marinum with associated bursitis. North China. Aquaculture and Fisheries, available ournal of Cutaneous Medicine and Surgery, 3, 218- from https://doi.org/10.1016/j.aaf.2019.04.004. 220. Johnston JM and Izumi AK 1987. Cutaneous Mycobacterium marinum infection (\"swimming Shamsudin MN, Tajima K, Kimura T, Shariff M and pool granuloma\"). Clinics in Dermatology, 5, 68-75. Anderson IG 1990. Characterization of the Kageyama A, Torikoe K, Iwamoto M, Masuyama, causative organism of ornamental fish mycobactriosis in Malaysia. Fish Pathology, 25, 1-6. Shibuya Y, Okazaki H, Yazawa K, Minota S, Shih JY, Hsueh PR, Chang YL, Chen MT, Yang PC and Kroppenstedt RM and Mikami Y 2004. Nocardia Luh KT 1997. Osteomyelitis and tenosynovitis due arthritidis sp. nov., a new pathogen isolated from a to Mycobacterium marinum in a fish dealer. patient with rheumatoid arthritis in Japan. Journal of Clinical Microbiology, 42, 2366-2371.

Weerakhun S. et al. / Thai J Vet Med. 2019. 49(2): 137-145. 145 Journal of the Formosan Medical Association, 96, 913-916. Slany M, Jezek P and Bodnarova M 2013. Fish tank granuloma caused by Mycobacterium marinum in two aquarists: Two case reports. Biomed Research International, 2013, ID161329. Slany M, Makovcova J, Jezek P, Bodnarova M and Pavlik I 2014. Relative prevalence of Mycobacterium marinum in fish collected from aquaria and natural freshwaters in central Europe. Journal of Fish Diseases, 37, 527-533. Sneath PHA, Mair NS, Sharpe ME and Holt JG 1986. The mycobacteria. In: Bergey’s Manual of Systematic Bacteriology, vol. 2 PHA Sneath, NS Mair, ME Sharpe and JG Holt (eds) Williams & Wilkins Co, Baltimore: 1435-1457. Talaat AM, Reimschuessel R, Wasserman SS and Trucksis M 1998. Goldfish, Carassius auratus: An animal model for studying fish mycobacteriosis. Infection and Immunity, 66, 2938-2942. Tamaki K, Nabeya D, Yoshida S, Aoyama M, Sawada M, Souta U, Takeshima M and Kubo Y 2012. A case of lung infection complicated by pneumothorax caused by Mycobacterium marinum. The Journal of the Japanese Association for Infectious Diseases, 86, 139-143. Van Seymortier P, Verellen K and De Jonge I 2004. Mycobacterium marinum causing tenosynovitis. 'Fish tank finger'. Acta Orthopaedica Belgica, 70, 279-282. Weerakhun S, Aoki N, Kurata O, Hatai K, Nibe H and Hirae T 2007. Mycobacterium marinum infection in cultured yellowtail Seriola quinqueradiata in Japan. Fish Pathology, 42, 79-84. Weerakhun S, Aoki N, Wada S, Hatai K, Nibe H and Hirae T 2008. Artificial infection of Mycobacterium marinum isolated from yellowtail Seriola quinqueradiata in Japan. Aquaculture Science, 56, 231-235. Weitzul S, Eichhorn PJ and Pandya AG 2000. Nontuberculous mycobacterial infections of the skin. Dermatologic Clinics, 18, 359-377. Wu TS, Chiu CH, Yang CH, Leu HS, Huang CT, Chen YC, Wu TL, Chang PY, Su LH, Kuo AJ, Chia JH, Lu CC and Lai HC 2012. Fish tank Granuloma caused by Mycobacterium marinum. PLoS ONE, 7, e41296. Zanoni RG, Florio D, Fioravanti ML, Rossi M and Prearo M 2008. Occurrence of Mycobacterium spp. in ornamental fish in Italy. Journal of Fish Diseases, 31, 433-441.



Original Article Association of LOC101800257 gene with eggshell color in Leizhou black duck Kun Zou Jun-teng Huang Aamir Nawab Li-li Lu Hong-yan Cui Shao-wei Zhang Yuan Xue Ying Su* Abstract LOC101800257 is a newly screened gene associated with eggshell color. The aim of this study was to explore association of LOC101800257 with eggshell color in Leizhou black duck. The real-time quantitative Polymerase Chain Reaction (RT-qPCR) was performed for expression pattern of LOC101800257 in the liver, oviduct and uterus of Leizhou black duck. The highest expression level of LOC101800257 was found in the liver and nearly no expression in other tissues. There were significant differences (P<0.05) in the expression between blue shell ducks (BSD) and white shell ducks (WSD) in the liver. There was fluctuation in the general expression of LOC101800257 from 27 to 59 weeks in the liver, with a significant turning point reported at 43 weeks. In addition, Polymerase Chain Reaction-Single Strand Conformation Polymorphism (PCR-SSCP) was used to detect the single nucleotide polymorphisms (SNP) of LOC101800257. Two SNPs were identified in LOC101800257 (c.1406A>G and c.1642+16A>G) and both SNPs showed extensive genetic polymorphisms and were in Hardy-Weinberg non-equilibrium, and the GGGG combined genotypes were significantly correlated with the eggshell color (P<0.05). The above results suggested LOC101800257 may be involved in regulation of eggshell color through its function in the liver, and the GGGG combined genotype can serve as a novel genetic maker for eggshell color. Keywords: Eggshell color, expression pattern, Leizhou black duck, LOC101800257, SNP Department of Agricultural College, Guangdong Ocean University, Zhanjiang 524088, China *Correspondence: [email protected] (Y. Su) Thai J Vet Med. 2019. 49(2): 147-154.