HPLC Catalogue

HPLC/UHPLC Columns • Totally spherical particle shape HPLC/UHPLC Columns Since 1911 • Outstanding surface microstructur • High pressure stability • Low metal content The NUCLEODUR® column family has expanded! NUCLEODUR® is a fully synthetical type B silica offering highly advanced physical properties: 18 Phases C18 Gravity | C18 Gravity-SB | C8 Gravity | C18 Isis | C18 Pyramid | PolarTec | Phenyl-Hexyl | π2 | PFP | Sphinx RP C18 HTec | C18 ec | C8 ec | C4 ec | HILIC | CN/CN-RP | NH2/NH2-RP | SiOH 1 Pore Size 110 Å 3 Standard Particle Sizes 1.8 μm | 3 μm | 5 μm | 7, 10, 12 and 16 μm particles for preparative purposes on request 7 Standard Column Lengths 30 mm | 50 mm | 75 mm | 100 mm | 125 mm | 150 mm | 250 mm 4 Standard Column IDs 2 mm | 3 mm | 4 mm | 4.6 mm NUCLEOSIL® 18 Phases C18 | C18 AB | C18 HD | C18 Nautilus | C18 Protect I | C8 ec | C8 | C8 HD | C4 | C2 | C6H5 | CN | OH | NH2 N(CH3)2 | SA | SB | SiOH 7 Pore Sizes 50 Å | 100 Å | 120 Å | 300 Å | 500 Å | 1000 Å | 4000 Å 4 Standard Particle Sizes 3 µm | 5 µm | 7 µm | 10 µm 4 Standard Column Lengths 250 mm | 150 mm | 125 mm | 100 mm 4 Standard Column IDs 2 mm | 3 mm | 4 mm | 4.6 mm 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN F-1 LIFE SCIENCE

Colonnes HPLC/UHPLC Overview of NUCLEODUR® HPLC Phases (Macherey-Nagel) Colonnes HPLC/UHPLC Phase Specification Particle Size Pore Size Surface Area Carbon Load Endcapped (µm) (Å) (m2/g) (%) C18 Gravity octadecyl phase, high density 1.8, 3, 5 110 340 18 Yes coating multi-endcapping. 18% C ∙ USP L1 C8 Gravity octyl phase, high density coat- 1.8, 3, 5 110 340 13 Yes ing multi-endcapping. 110 340 20 Yes 11% C ∙ USP L7 110 340 14 Yes C18 Isis octadecyl phase with specially 1.8, 3, 5 crosslinked surface modifica- tion endcapping 20% C ∙ USP L1 C18 Pyramid C18 modification with polar 1.8, 3, 5 endcapping 14% C ∙ USP L1 PolarTec octadecyl with embedded polar 1.8, 3, 5 110 340 17 Yes group. USP - L11 octadecyl phase, medium C18 ec density coating endcapping 3, 5 110 340 17.5 Yes 17.5% C ∙ USP L1 C8 ec octyl phase, medium density 3, 5 110 340 10.5 Yes coating endcapping 10.5% C ∙ USP L7 Contact your sales representative for more information F-2 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

HPLC/UHPLC Columns Overview of NUCLEODUR® HPLC Phases (Macherey-Nagel) Structure Application Similar Separation Principle - Retention Mechanism HPLC/UHPLC Columns Phases** NUCLEODUR® in general compounds with NUCLEOSIL® C18 HD (Si-O2)n ionizable functional groups such Waters Xterra® RP18 / MS C18; as basic pharmaceuticals and Phenomenex Luna C18 (2), pesticides Synergi and Max RP; Zorbax Extend C18; Inertsil ODS III; Purospher RP-18; Star RP-18 only hydrophobic Si(CH3)3 CH3 interactions H3C N NUCLEODUR® (Si-O2)n (van der Waals O interactions) like C18 Gravity, however NUCLEOSIL® C8 HD generally shorter retention times Waters Xterra® RP8 / MS C8; for nonpolar compounds Phenomenex Luna C8; Zorbax Eclipse; XDB-C8 NUCLEODUR® high steric selectivity, NUCLEOSIL® C18 AB steric interactions (Si-O2)n thus suited for separation Inertsil ODS-P; and hydrophobic of positional and structural YMC Pro C18RS isomers, planar/nonplanar interactions molecules NUCLEODUR® OH basic pharmaceutical Phenomenex Aqua; hydrophobic OH CH3 (Si-O2)n OH ingredients, very polar YMC AQ; interactions H3C N compounds, organic acids and polar Pol Waters Atlantis® dC18 interactions O Si OH (H bonds) NUCLEODUR® Pol Exceptional selectivity for NUCLEOSIL® C18 Nautilus Pol (Si-O2)n Si O Si(CH3)3 phenols and nitrogen containing ProntoSIL® C18; Zorbax® compounds, polar compounds Bonus-RP, Po-laris® Amide- Hydrophobic and Si(CH3)3 HO C18; Ascentis® RP Amide; polar (H bonds) like basic pharmaceuticals, SymmetryShield™ RP18; organic acids, pesticides, amino SUPELCOSIL™ LC-ABZ+; Pol acids, water soluble vitamins, HyPURITY™ ADVANCE etc. NUCLEODUR® Si OH robust C18 phase for routine NUCLEOSIL® C18 only hydrophobic Si(CH3)3 CH3 (Si-O2)n Si O Si(CH3)3 analyses Spherisorb® ODS II; Hypersil interactions SiOH H3C N ODS; Waters Symmetry® C18; NUCLEODUR® Si OH robust C8 phase for routine Inertsil ODS II; Kromasil C18; (van der O (Si-O2)n Si O Si(CH3)3 analyses Waals interactions) LiChrospher RP 18 some residual NUCLEOSIL® C8 ec / C8 silanol interactions Spherisorb® C8; Hypersil MOS; Waters Symmetry® C8; Kromasil C8; LiChrospher RP 8 ** phases which provide a similar selectivity based on chemical and physical properties Contact your sales representative for more information 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN F-3 LIFE SCIENCE

Colonnes HPLC/UHPLC Overview of NUCLEODUR® HPLC Phases (Macherey-Nagel) Colonnes HPLC/UHPLC Phase Specification Particle Size Pore Size Surface Area Carbon Load Endcapped (µm) (Å) (m2/g) (%) octadecyl, high density coating, high capacity, 3, 5 110 340 18 Yes multi-endcapping USP - L1 bifunctional RP phase, 1.8, 3, 5 110 340 15 Yes balanced ratio of propyl- phenyl and C18 ligands; endcapping 15% C; USP L1 and L11 pentafluorophenylpropyl, PFP multi-endcapping 1.8, 3, 5 110 340 8 Yes USP - L43 HILIC ammonium – sulfonic acid 1.8, 3, 5 110 340 7 No cyano (nitrile) phase for NP 3, 5 110 340 7 Yes and RP separations 7% C ∙ USP L10 aminopropyl for NP and NH2/NH2-RP RP separations 3, 5 110 340 2.5 Yes USP - L8 unmodified SiOH NUCLEODUR® 3, 5 110 340 - No USP - L3 Contact your sales representative for more information F-4 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

HPLC/UHPLC Columns Overview of NUCLEODUR® HPLC Phases (Macherey-Nagel) Structure Application Similar Separation Principle - Retention Mechanism HPLC/UHPLC Columns Phases** NUCLEODUR® Sophisticated analytical and XTerra® RP18 / MS C18 / only hydrophobic Si(CH3)3 CH3 (Si-O2)n preparative separations of basic, SunFire™ C18; Luna® C18(2), interactions H3C N neutral and acidic pharmaceu- Gemini®, Synergi® Max RP; ticals, derivatised amino acids, Zorbax® Extend-C18; Inertsil® (van der Waals O pesticides, fat-soluble vitamins, interactions) aldehydes, ketones and phenolic ODS III;Purospher® STAR RP-18; Hypersil™ BDS compounds NUCLEODUR® compounds with aromatic and no similar phases π-π interactions (Si-O2)n multiple bond systems and hydrophobic NO2 interactions NUCLEODUR® NUCLEODUR® (Si-O2)n Si OH Aromatic and unsaturated com- ACQUITY® CSH Fluoro- polar interactions O FF pounds, phenols, halogenated Phenyl; Hypersil™ GOLD PFP; (H bonds), F compounds, isomers, polar Luna® PFP(2); Discovery® HS dipole-dipole O FF compounds like pharmaceuti- F5; Allure® PFP Propyl, Ultra II interactions, cals, antibiotics; high retention of FF H Si O Si(CH3)3 PFP Propy π-π interactions, basic compounds hydrophobic F interactions FF CH3 SO3 – Hydrophilic compounds such H3C + SO3 – as organic polar acids and N (Si-O2)n +N bases, polar natural compounds, CH3 SO3 – nucleosides, oligonucleotides, O CH3 Si OH CH3 amino acids, peptides, water SeQuant™ ZIC®-HILIC; Ionic / hydrophilic CH3 Obelisc™ and electrostatic HO N NH soluble vitamins H3C + +N N SO3 – NH2 CH3 Si OH CH3 NUCLEODUR® CN polar organic compounds NUCLEOSIL® CN / CN-RP π-π interactions, C≡N O (Si-O2)n Si OH (basic drugs, molecules contain- polar interactions C ≡N HO CN ing π electron systems (H bonds), Si O Si(CH3)3 hydrophobic interactions NH2 NUCLEODUR® NUCLEODUR® (Si-O2)n Si OH polar compounds under RP NUCLEOSIL® NH2 / NH2-RP Polar / ionic and + NH3 conditions (sugars, DNA hydrophobic NH2 OH Si OH bases), hydrocarbons under NP O conditions (Si-O2)n Si OH polar and midpolar compounds Unmodified NUCLEOSIL® Polar / ionic SiOH O2N Si OH under normal phase conditions ** phases which provide a similar selectivity based on chemical and physical properties Contact your sales representative for more information 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN F-5 LIFE SCIENCE

Colonnes HPLC/UHPLC Nucleosil (Macherey-Nagel) Colonnes HPLC/UHPLC • Spherical porous silica • Wide range of bonded phases • Excellent mechanical stability NUCLEOSIL® 100 Å and 120 Å have very similar pore sizes and relative retention characteristics. NUCLEOSIL® 100 Å has the greater capacity while the 120 Å material exhibits the lower column back pressure. NUCLEOSIL® 300 Å silica is a wide pore, used as the base material for the reversed-phase bioanalytical columns. NUCLEOSIL® 100-5C18AB was the first of the newer generation NUCLEOSIL® materials which include the HD (high density) phases and the Nautilus, for use with up to 100% aqueous eluents. • Wider pore NUCLEOSIL® (500, 1000 and 4000 Å), Polygosil and columns for special applications eg PAH and hop constituents can be supplied on request. • Available in ChromCart® cartridge format, please enquire for part numbers and pricing. NUCLEOSIL Phase Functional Group Endcapped Particle Size (µm) Pore Size (Å) Carbon Load (%) C18 Octadecyl Yes 3, 5, 7, 10 50, 100, 120 15 C18 AB Octadecyl Yes 5 100 25 C18 HD Octadecyl Yes 3, 5 100 20 C18 Nautilus Octadecyl Yes 3, 5 100 16 Protect I Protective polar group Yes 3, 5 100 11 C8 ec Yes 5 9 Octyl No 50, 100 9 C8 Octyl Yes 3, 5, 7, 10 100, 120 13 C8 HD Octyl Yes 3, 5 2 Butyl No 5, 7 100 3.5 C4 Dimethyl No 7 120, 300 8 C2 Phenyl No 5, 7 - C6H5 Cyanopropyl Yes 100 4.5 CN/ CN-RP Nitrophenyl No 5, 7, 10 100, 120 5 NO2 Diol No 5, 10 100, 120 3.5 OH aminopropyl No 5, 7 4 NH2/ NH2 RP Dimethylamino No 3, 5, 7 100 4 N(CH3)2 Benzenesulphonic acid No 100 15 SA Quarternary ammonium No 5 100, 120 - SB 5, 10 100 Silica - 5, 10 100 5, 7, 10 100 50, 100 Contact your sales representative for more information F-6 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

HPLC/UHPLC Columns HPLC/UHPLC Columns TM Shodex™ brand LC columns have been manufactured by Showa Denko K.K. in Japan since 1973. With over 1000 different columns covering all separation modes, we are confident that we can provide the perfect polymer-based column for your analytical needs. Shodex™ is best known for innovative polymer-based columns offering size-exclusion chromatography, HILIC, and sugar analysis columns. The following names are trademarks or registered trademarks of SHOWA DENKO K.K.Shodex: AFpak, Asahipak, AXpak, CLNpak, CXpak, HILICpak, MSpak, ODP, OHpak, ORpak, RSpak, SUGAR, USPpak Shodex offers 3 polymer-based materials with or without functional group depending on the separation mode required. Polyhydroxymethacrylate Polyvinyl alcohol Styrene divinylbenzene copolymer Reversed-Phased HILIC Reversed-Phase Ion Chromatography Ion Chromatography Ion Chromatography GFC Multiple GFC/GPC GPC Ion-Exchange Ion-Exchange GPC Clean-up Ion-Exchange HIC GPC Clean-up Ligand Exchange Affinity Chiral Do you know the advantages of polymer-based HPLC columns? • Great chemical stability leading to an extended pH range applicability (2 to 13) • Low bleeding allowing the use of sensitive detection • Large variety of material properties • Available for most separation modes Why choose Shodex polymer-based HPLC columns? • Full production control: ownership of polymer gels and column packing • 50 years of experience • Large application database • Full product support 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN G-1 LIFE SCIENCE

Colonnes HPLC/UHPLC Brand Product Base Functional Separation Shipping USP Name Material Group Mode Solvent - Colonnes HPLC/UHPLC HILICpak VG-50 Polyvinyl alcohol Amino HILIC H2O/CH3CN=20/80 Shodex™ HILICpak VT-50 Polyvinyl alcohol Quaternary HILIC 25mM HCOONH4 aq. /CH3CN=15/85 - HILICpak HILICpak VC-50 Polyvinyl alcohol ammonium Carboxyl HILIC H2O - Series Diol HILIC HILICpak VN-50 Polyvinyl alcohol H2O/CH3CN=25/75 - NH2P-50 Polyvinyl alcohol Amino HILIC Shodex™ SC1011 Styrene divinylbenzene CHӡCN L82 Asahipak Sulfo (Ca²⁺) Ligand Exchange Sulfo (Ca²⁺) Ligand Exchange H2O L19 & L22 Shodex™ SC1821 Styrene divinylbenzene Sulfo (Pb²⁺) Ligand Exchange H2O L19 & L22 SUGAR Styrene divinylbenzene Series SP0810 Styrene divinylbenzene Sulfo (Na+) Ligand Exchange H2O L22 & L34 SUGAR Styrene divinylbenzene Shodex™ Rspak KS-800 series Sulfo (Na+) Ligand Exchange & HILIC H2O L22 & L58 DC-613 Sulfo (Zn²⁺) Ligand Exchange & HILIC H2O/CH3CN=30/70 L22 & L58 SZ5532 Styrene divinylbenzene Sulfo (Ca²⁺) Ligand Exchange & HILIC H2O/CH3CN=30/70 L22 SC1211 Styrene divinylbenzene Sulfo (Ca²⁺) Ligand Exchange H2O/CH3CN=30/70 L19 & L22 USPpak MN-431 Styrene divinylbenzene Shodex™ Styrene divinylbenzene Sulfo Ion Exclusion H2O L19 & L22 SUGAR SH1011 Series Sulfo Ion Exclusion Sulfo Ion Exclusion H2O L17 & L22 Quaternary Ion Chromatography - Anion SH1821 Styrene divinylbenzene ammonium H2O L17 & L22 KC-811 Styrene divinylbenzene Quaternary non-supressor method Shodex™ NI-424 Polyhydroxymethacrylate ammonium Ion Chromatography - Anion 0.1% H3PO4 aq. L17 & L22 Rspak Quaternary - ammonium non-supressor method 8mM 4-Hydroxybenzoic acid + 2.8mM Bis-Tris - I-524A Polyhydroxymethacrylate Quaternary Ion Chromatography - Anion + 2mM Phenylboronic acid + 0.005mM CyDTA aq. ammonium Quaternary with supressor method 2.5mM Phthalic acid aq. ammonium Ion Chromatography - Anion SI-90 Polyvinyl alcohol Quaternary 1.8mM Na2CO3 + 1.7mM NaHCO3 aq. - ammonium with supressor method SI-50 Polyvinyl alcohol Carboxyl Ion Chromatography - Anion 3.2mM Na2CO3 + 1.0mM NaHCO3 aq. - Shodex™ IC SI-52 Polyvinyl alcohol Sulfo with supressor method 3.6mM Na2CO3 aq. - Ion Chromatography - Rapid Anion SI-35 Polyvinyl alcohol Sulfo 3.6mM Na2CO3 aq. - with supressor method - YK-421 Silica Hydrophilic polymer Ion Chromatography - Cation 5mM Tartaric acid + 1mM Dipicolinic acid - Y-521 Styrene divinylbenzene + 1.5g/L Boric acid aq. T-521 Hydrophilic polymer Ion Chromatography - Cation KW Series copolymer 4mM HNO3 aq. LW Series Styrene divinylbenzene - Ion Chromatography - Cation SB Series 3mM HNO3 aq. - GS-HQ copolymer - SEC (GFC) Shodex™ GF-HQ Silica H2O L20, L33, L59 PROTEIN - SEC (GFC) Silica H2O L20, L33, L59 Shodex™ SEC (GFC) 0.02% NaN3 aq. OHpak Polyhydroxymethacrylate H2O/CH3OH=70/30 L25, L38, Multimode L37, L39 Shodex™ Polyvinyl alcohol Asahipak SEC (GFC/GPC) - Polyvinyl alcohol H2O/CH3OH=70/30 - G-2 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

HPLC/UHPLC Columns Brand Product Base Functional Group Separation Shipping USP Name Material - Mode Solvent L21 KF Series Styrene divinylbenzene - GPC Tetrahydrofuran (THF) L21 HPLC/UHPLC Columns copolymer - L21 HK Series Styrene divinylbenzene - Rapid GPC Tetrahydrofuran (THF) L21 copolymer - Rapid GPC L21 HK-HFIP Styrene divinylbenzene - HFIP L21 copolymer - GPC L21 Shodex™ K Series Styrene divinylbenzene - GPC Chloroform L21 GPC KD Series copolymer - GPC - Styrene divinylbenzene - GPC Dimethylformamide (DMF) - LF Series copolymer - High Temperature GPC - Styrene divinylbenzene - GPC Clean-up Tetrahydrofuran (THF) - HT-800 copolymer GPC Clean-up L23 Styrene divinylbenzene Quaternary GPC Clean-up Toluene - UT-800 copolymer ammonium GPC Clean-up - Styrene divinylbenzene Diethylaminoethyl Strong Anion-Exchange Toluene - EV-2000 copolymer Diethylaminoethyl Weak Anion-Exchange - Styrene divinylbenzene Diethylaminoethyl Weak Anion-Exchange Ethylacetate/Cyclohexane=3/7 - Shodex™ EV-2000AC copolymer Sulfopropyl Weak Anion-Exchange - CLNpak PAE-2000 Styrene divinylbenzene Carboxymethyl Strong Cation-Exchange Acetone/Cyclohexane=3/7 - copolymer Sulfopropyl Weak Cation-Exchange - PAE-2000 AC Styrene divinylbenzene Carboxymethyl Strong Cation-Exchange Acetonitrile - copolymer Sulfo (Na+) Weak Cation-Exchange - QA-825 Styrene divinylbenzene Cation-Exchange Acetone - copolymer Phenyl HIC Shodex™ DEAE-825 Protein A Affinity 50mM Na2SO4 aq. IEC Polyhydroxymethacrylate Choline oxydase, Affinity acetylcholine esterase 50mM Na2SO4 aq. AXpak WA-624 Polyhydroxymethacrylate 0.1M Sodium phosphate buffer (pH3.0)/CH3CN Shodex™ ES-502N Polyhydroxymethacrylate =80/20 Asahipak 0.1M Sodium phosphate buffer (pH 4.0) Polyvinyl alcohol SP-825 50mM Na2SO4 aq. Polyhydroxymethacrylate 50mM Na2SO4 aq. Shodex™ CM-825 IEC Polyhydroxymethacrylate 20mM *MES buffer (pH5.6) SP-FT 4A Non-porous 0.1M Sodium phosphate buffer (pH4.4) Polyhydroxymethacrylate Shodex™ ES-502C H20 Asahipak Polyvinyl alcohol H2O 0.1M Sodium phosphate buffer + 0.5M NaCl Shodex™ CXpak P-421S Styrene divinylbenzene + 0.02% NaN3 (pH7.0) 10mM Sodium Phosphate buffer Shodex™ HIC PH-814 Polyhydroxymethacrylate + 1.0M NaCl (pH 7.4) Shodex™ APA-894 Polyhydroxymethacrylate AFpak ACH-494 Polyhydroxymethacrylate 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN G-3 LIFE SCIENCE

Colonnes HPLC/UHPLC Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (HILICpak) Colonnes HPLC/UHPLC Shodex HILICpak - VG-50 Shodex HILICpak - VC-50 • Suitable for saccharides and polar sample analysis using • Modified carboxyl group is suitable for cationic substance HILIC mode analysis including amines, amino acids and sugars • Recovers reducing saccharides with high ratio • The dominant separation mode is RP using HILIC mode as • Polymer-based packing material provides excellent secondary- least polar column of HILICpak chemical stability and minimum deterioration • Polymer-based packing material provides stability and over an extended time period • Easily regenerated by washing in an alkaline solution minimal deterioration over time. • Appropriate for evaporative light scattering detector, corona charged aerosol detector, and LC/MS Shodex HILICpak - VT-50 Shodex HILICpak - VN-50 • Multimodal - combines HILIC with anion exchange • The modified diol groups on the packing material create the • Suitable for analysis of anionic substances including HILIC mode suitable for polar compounds phosphorylated saccharides and metabolites • Targeted for oligosaccharide and oligonucleotide analysis • Use of some eluents add ion exchange mode • Polymer-based packing material provides excellent which is not possible by SEC column or conventional HILIC columns chemical stability and minimum deterioration over an extended time period • Packed in PEEK and suitable for LC/MS analysis Dimensions Shodex™ HILICpak Series ordering information ID x Length (mm) Particle Product Name Manufacturer Item Base Functional Pore Size Separation Size (µm) Item Number Material Group (Å) Mode 4.6 x 250 HILICpak VG-50 4E 4.6 x 150 5 HILICpak VG-50 4D F7630100 SHVG-504E 100 HILIC 4.6 x 10 5 HILICpak VG-50G 4A (Guard) 2.0 x 150 5 HILICpak VG-50 2D F7630200 SHVG-504D 2.0 x 10 5 HILICpak VG-50G 2A (Guard) 4.6 x 150 5 HILICpak VN-50 4D F6711100 SHVG-50G4A Amino 4.6 x 10 5 HILICpak VN-50G 4A (Guard) 2.0 x 150 5 HILICpak VN-50 2D F7630300 SHVG-502D 2.0 x 10 5 HILICpak VN-50G 2A (Guard) 2.0 x 150 5 HILICpak VT-50 2D F6711200 SHVG-50G2A 2.0 x 10 5 HILICpak VT-50G 2A 2.0 x 150 5 HILICpak VC-50 2D F7630500 SHVN-504D 2.0 x 10 5 HILICpak VC-50G 2A 5 F6711400 SHVN-50G4A Polyvinyl alcohol Diol F7630600 SHVN-502D F6711500 SHVN-50G2A F7630400 SHVT-502D Quaternary F6711300 SHVT-50G2A ammonium F7630700 SHVC-502D Carboxyl F6711600 SHVC-50G2A G-4 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

HPLC/UHPLC Columns Recovery of reducing sugar Rare sugar Recovery of reSRdameupccleoi:n5vmgeg/rmsyLueogafcahr,r5eµdL ucing sugar Rare sugar Rare sugar HPLC/Polymer-basedUHPLCHydrophilicColumnInteractionsChromatography (HILIC) Columns (HILICpak) Recovery of reducing sugar Rare sugarRecoR1ve2e3cr1oy11v221o34e3f2ryr(V1431(S(eG424c.146o3i1432o.-l2di6m....25cmfmFSMG0auV(mp4rV(u3-lS((mraGu4u44c3cb.a(S(cGn614ccie.c4S123DIo4.-lnra6i.i6n142S3tmoIi.oo-l....5caDmo.syi62mdon....5mcaDssmMFSGm0ae-smm.MSGFseem0parAu-e.mldumga(Vueppur4xu-balcm4auxp)3u4nc(S(blcaGDcInaerc4acn.c1lc.nDtIIoo6nerai1D241S3om.ossy.nt-lI5ooo:DssiD6o.msyi5....54e-scaom:Dss.0s5eeunim1e-sAeSMFG.0m0.dans5eeexmmAme.dprexm)2u-xmolmgaupu4xa)bg3a1cmnac1lcgm1DmIc/nera5a1.ntmmIoo5/45oD)o.ssy0m)5oi:4Dss0r0nle-sLim.su05eenuLmAem.odexmmme1omx4)egmacmag1nmac2c1o)m/)5acoh)m5l4)h0u,i(Vl0rnu4L,mm35(S(Gmomc45.µe6iWSsrsHxein3S214mo.µ-lLmmaai6cnmaa....yn5cLamcIcomth)LFSMGlccm0hpa)hiohmlpeorIucc-aulrmi,auspCu4fbnaocshhnm5nfcelSHsWiexrscDInrepa.mvaaaSWessiHrx.µnctIooabaaynmDcno.syaIiearrLaaoyn:thiDsssLcnlccaIhpnhe-siiiothdk.Lsml5cceeddhpeohIAcciose.ardgilesCoaxmIccfoaneeorsiehhxs)nCpfef1Vnmoshhtwarnpss.vgf1aaec068rhabewp1.GHsexrSWsivaam,cie/ao5abrrmi000iasnesmaIdn5iaaayn4biirrciidkIs0-mnvddatInitthuiiLs0loccdkughpnmhle5ddhLshiaoemsoeegecoleImccapocaecer1o0iVeemsCdectwresspfnhros1Vhhm0mnirhantwewrfsseGemaon,c08porh.i0vewraaGcuesis,dabncdaobi00elrg)is-ieevsat)dnrrutuibishsenioausI-uhvnel5ttcsiihteudkmuomddue,chie5cshseccaecegv0oldcsacmm5ochreeece0oediiipanntcnv1eVharmonµnttwrihssanrvenu0aeioysnrhewdacLGelrggrs,ieuiseoui0daianrsseelrgsesdncutocbuiisye-rvmtseuminttucacohcauvofhyue5meshisecmacaovomcosiinatrcnmvtecsei0andtocchniintahsnhrvvseHrWixSaaeryntieranihcmegvcoanieaeeotniyeeaaayncranscdgudisIiiecdaeohthelrgs,anryoLoslrccthpscmunhoaisiaoeehysirfuyuatecsomncfIaaccoaahrmoeimfiyunsgCocsartcafrsaivonoooosmrhhscnmnaahrsfties'iorrraeriinctnpdvfi.navhslaaacontcreotnireehabarulivbdaaedcyyiieeaotniecrrahrigu,rsoondietdamIeiniinanrhaessee,dsskoomictddanopcfayasoregisliamnnac.gaoduascfnahroosooeefyuorengospaliofr1'aVmoormrlouar.atywrrdssftsiolti'aor0r8rcarhnulaehwsdfvGcsbwlaz,roeeyrereoiri00ulrurcbaeseotniemednyaeiimbniesrdiuerdss-inivntmnphtun,ioooesrteotssuihiae5csn.hpduaeenggnhsiosyaciacfcr.aduocnlecef0soolnugdos.cysroohrtloforluia.nyvis'aecoswtrrzonaedfrlrvcoswurziseeuldiaimrbelrgasyenineeuiirmuisroertsmiunintcniesegssgnohrtsymeinpicrcaggnhvosyiac.dusrmnsooiintnvlfoalunt.yhsotvaeycvcswgzeieeranrseciimoyrninsmnaorthifyuggnhasyomrartsicnahsrericeotnieaddih,ootaeiacfaongosrRoori'arradflorulbaayeerurmniesessnrpiac.dunsoelfolu.ysRotvcswzerseiimaninortiuggnhsyrr geasrug1ar Sample : 0.2% each, 10µL Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (HILICpak) 1. L-Ribose Sample : 0.2% each, 10µL PolPyomlyemr-ebra-sbeadseHdydHryodprhoiplihcilIinctIenrtaecrtaicotnioCnhCrohmroamtoagtroagprhayph(HyI(LHICIL)ICC)oCluomlunms n(HsI(LHICILpICakp)ak) Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (HILICpak) 2. D-PsSicaomspele : 0.2% each, 10µL1. L-Ribose 3. DDLD----GTAXS2314ayllul356412....oglaic......tDDLDmsaooLLDDDD-et---lspRo--XTP----GReTAXPlsiayesbeialysllgib4312Sulioc:ogltia....ioccaoost0satoDDDLoosmelsoe.tel-2ssoe---spReTXPe%seliayesebglieioc:taaoos0tcelso.2hes%,e310eµaLc32564h....., 3 4. 5. D-Allo5s. eD-Allose DD10--XPµyLsliictoolse 5. D-Tagatose 1 6. D-Allose 1 L-Glucose 3 2 4 3 6.3L-Glu66c.oLs-eG1lucose 4 Recovery of Mannose (%) 15 4 62 6 RecovReercyoovferMyaonfnoMsaen(no%)se (%) 4 66 Recovery of Mannose (%) 2 4 5 Recovery of Mannose (%) 2 25 31 4 ((S34c4i4o.2li60cmmap-S(mcba((Sc4iolnai4ioI.lcm.syi6cDmae-m2paB-.dp5-bamx)S(banacamnai1mosyl1Ii.isy5e-cnmDi2e-B0danB.dp3m)-oxa)baammcna1mosy)5inle-iu0nBodmmo)4canmcomol)uilnumS((om4cino.li6cncmomalp-umbam42na000In.syDe-B.dx)684a6420001m0005i0nmo 684mc000o)lumn 60 55 2 31 40 0 5 10 15 20 25 20 1 0 5 10 2315 LaCEDFCllceoooutllwetueunmocm0rCEDFCtta0ECDFCnosllneoootullreooeoutltelweueutellweuneumcmm,nrmctmtartnotp0ECFDCnaetnonre.tll5teoorouepe5t:::::tlelwemueuSSH410Rimnmcm..0lihpIr2t06ltpaa˚iOnoo.Cmmnct.:::::rdec/a5t:::::LLCeSHS10R4e1t//SSH1R041bm0H..0xihmm2I2060ol..0aihI2˚iO06o3lpCmmHc˚iiOsoCCnnmmcsd./aeIdLLC/aL:::::Ne((eLLCd//eVSbHIxSHS14R01mm=//bCHxGa0i,mmECFDC0a.0.l3ih221I2aHi06iilsp3lmc1lCnn-˚H5eioOo0oiiousCammcCennI55aatl/LNlweedI((/iuaed0u8kLNVSnnLLC((Inbde=mcSVm0CIo//Gibr4=atVaHxClt2dmmGaiianoplDa2mcs-nG(i0c3t1pHmc4-5riiaesa0)Cnn5t/5o5-aia.20led8eIk/n6i52bl0LN08akn((m0udbomSV004aVaI0=o4mCVacDGpimsaGmcl42DsiGe.pc)mcn-toD(0i-e)4dn5:::::oaa-s5uIl/di.2uo058klHSS410R1n0D6aubf00ml002a0..orihmIm42c.Vma064ol25om˚iOooD4Cxns5mmcGDmcimnnsDldemi/s)auo1n-LLCmsodeem5iI5olf//nob.uHixrmmf0cDn0atanromc2o31hmmHo.ii4)som5Cnn5lexnmuDeImilnLuNrm((smd1oSVomI)m=oiC5ftGnnialr2htcn0i)paomch-0oe)m5naame/lri20u8ukmnrb0mm0foo4mVa)aatDnsGcchan)e)tone-udu5lruurf0aaefmm2aVmcr45GcsantD2iutn-nms00u5ro0uire0fnfVercraVo4GrsocGDsm-ltu-25Au5m(00S0omcr0ioletin4inmcVh4r)DoaGpseD-CaAb-r(onSMAa5mc(Slyimmscuol0-iiieonmmlcAiidnmeaoca4)pnoa-nCpDab-lCAaonbua(SaAonlmycasu(Sfil-ymoclesumaiAiim-nmoecldmiAi)cnmodacp)noa-tCpaAbi-uC(naoSA0bamcn(Solynrimascoul-ileyiiesonmumlcBeiV-iednmromcaA)pndGsoa-)Cpanb--Canoaba5Anolyas(uS-lym0cesnumBi-oeldmiBi)4nmdcd)noaDp-CabAno(Sramclysiuoe-lieimBnmcdoa)lnp-aCabonatCEDCFlysu-elelmeoAooud)tnllwedueunAmcm(Sr0CECFDtmctai0ECDFCsonolllnieoiootunmcllreooeouutoltalwepueutell-weCuaneubmcbmmnnormcatmtlyartsnuotps0-ECDCFnaetnomBnre.tdllteootro)uenet:::::tlaelwemueuSH05Rmnmc5nm.0hpIr2t56tpa˚Onoo.Cmnct.:::::rde/t:::::LeCeSH0R5e/SH0R5mH.0xhmIs26.0hI52˚O6o3pCmH˚iOoCCnmd./IdLC/L:::::NeLC/eH1IxSH05Rm//CH1x0Cm0EFDC.03hI20H6ip3llCn˚HHeoOooiouCmCnIatlLNlw3edI/ueukLNLCOIne/mcmCI/Cr/tVH1xCHtmaCnop0nHG3tp=HHriaeCnt3-5aeIk3O5LN/kmO180VIH15/5CV5HpC5G4=/G.p=H1E-5:::::a-550/35kSH0R58/0O801.05hI2V6H455˚/Oo4Cm1GE/=1Ed/0-5LC0e52//H1x28m000053Hi4Cn/1EILN0mI/C2iCn0pHa3mkOm21i25nVHi55nG=-55/m8025i5n4/1E0 20 25 min LLaLacactctLotooassceseet,,o,eeseppepi,ililalaeacccpLtttiaooloacsssceteeot,,,osaaaesnnne,ddd,elalpalanaicS1clcd.atatLmutcualuplctalloteluoocols:oss5tessmeeeueg,l/omaLsneeadch,la5µcL tulSoamspele : 5mg/mLMMeaecehl,la5aMµmmLeiilnna1eemaainneddarMreneeldlalaatrStemeaemdldipaMnlsetseue:eu1db0labµasnLssm,tdt5uaaµibngnrn/smececLtleeaaaesastnncehdcde(irnsSesHaul2maObp/tCleesH:td31aC0NsµnL=uc,55b0eµ/5sgs0/tm)aLneaccehs(in H2O/CH3CN=50/50) 2. EpilaScatomspele : 5mg/mL each, 51µ.LLactulose 1 NSoa.mpl1e : 10µL, 5µg/mLRe1ach (inRH22O/CHR33CN=50/50) 3. Lac1Sto231.as...LmeLLEapaapccclitelutta1Soul:co.las5tosLeommseasepceglt/euml:oL5smeeagc/hm, L5µe23La..cLEhap,ci5ltaoµcLsteose SN3142amRp1 lAAMCNe312NmmySo1342e:oa.almm1a.nm0m2ueeCAMµprlliAAMCiiinLmdnlycNeemme,y231eaeelomaaa5:nlmma.cnmµ1uemiueeg0drlNiiinrlln/CAMµciiiinmdneceLmyeaeee,LaRaclma5Nnc1iOOOedmµuieHadHHHgrlNici2inn/chmeeaNLOOR(cNiOOOHRniHHe1HdNNHHH1OON2aH41322HHcoHH2h22.ONOO/R(NNCiAAMCOHRnNNHH1OOHHRHmmy2H2eHHHNNNHH2aO223lmma222HHHnCHmOuee222Nrll/iiiNNinC=ndcORNNee5OHHeRHNNNH2aOHHR022H33cHHH/H322Ci5222d0N)=NN5ORNHH0OOOH3R/H225HHH120) R2 R3 1 1 2. Epilac2t.oEspeilactose 2 NH2 NH2 3. Lacto3s.eLactose NH2 NH2 R1 OH OH 1 2 R1 OH NH2 2N 2N RR13 21 3 1 R2 NN 34 Am4mR2elidAemNmelideRO3 H OOHH ONHH2 NH2 23 R2N N NN R3 N 4 3 1 21 3 R2 NR2 3 2 32 4 RN3 R3 4 3 3 3 44 0 5 10 15 min 0 5 10 15 20 min CFDEClleoooutllweueunmcmrDFECtta0FCDECnolln0eootullreooeouttlweeutellweuneucmmnrmctmtartotpDFECnatno0nre.tlleorouet:::::telweeu14RSHmncm0.hIr2t0tpa˚OooCmnt.::::rde/:::::LCR1HSe/1R4HSH.xhmI20.0hI2O0o3mH˚iOoCCnmd/IdLC/L::::NeLC/eHIxR1HSm//5CHxCmCFDE5.3hI2H00ip3llCnHHeoOooioumCnIatlLNlw3edI/ueukLNLCOIne/mcmCI/Cr/tVHxCHtmaC5nopnHG3tp=HHriaeCnt3-5aeIk3O5LN/kmO70VIH/CV5HpCG4=/G.p=H2E-5:::::a-550/35kR41SH7/0O70.05hI2V0H45˚/Oo4Cm2GE/=2Ed/0-5LC10e51//0Hx7m00553Hi4Cn/2EILN01I/C0CpHa3kOVHG=-55/7054/2E1015150mminin15 min Colum0 n15 min : Shodex H5IL0ICpak VG-50 4D10 5 10 15 20 min 15 20 min 20 min 20 min CFDElleooutlweue0nmcrFDECttaCFDECnolleootullreooeouttlweeutellweuneucmmnrmct0mtartotpFDECnatnonre.tlleorouet::::telweeuC043mncm.00rot6tpa˚morCmnt.o::::reM:::::nL0CS3a/C04S3.0hHmo6.00homc56orCm˚mioohrCnmdMoOnadLM::::enLra/eOxgC0S3Hma/xHmDFCCEcNe.0hoCH6cihlldnCmHeoo5HoiourhmOnIaotlLlOwedIaa4MueurLnOLIngeremcOmCaIa/grtNerxCtHmaqNoenopdncHtp.CHdsriaeH/hntaa4oCeOIkaa4LeklmaHrOeVIragqCoVr3pqNGeo.CsG.p/d.sH-oC1/N:::::a-5oC0la45Hk0C4S3=0lHe0a.003h3oV6r43qC˚mo5o4rCmCGDo.s/NDd/M6Nn-LoC1e=550a/l=HxH3m03c53CHi45hCn/O6DI/aLN65rOI5g=CNe3pd5Ha/a46ke51aVr5qoG.s/-oC5lH01345CDN=35/65 SimuClotlaumnnCetooelmuumpsn. :tae4m0n˚pCa. :ly40s˚Cis of saccharides, organic acids and amCionluomnaCtocelmuimdpn.s:te4wm0˚pCit. h: 40L˚CC/MS Simultaneous analysis of saccharides, organic acids and amino acids with LC/MSSS0iimmLueSuullittmaL5aPLIelMnVeehunPuaueeeTrAlleTotrtGSLloAphHaPAIoayellrLMPsIVyeiuhrlMsPrsVneeugnhaTPeeT1ruaA+seelTTyotr0ArselGTSotLlArphrHaGGSALlAphyHealraoAsAGCyiyePrllSraIssrsnnyiglMrsVTsrsenunylhgP+uTnpiyasee+TrymaAsrlTGotarrGSGLlAphAHGla1AlAyGenlClyrausl5syinlrysrsusngyplsTnulpss+ytiaraisGLsAGlelnnysuoluoep2sf11111121211111110foim784053138340731461PIsmlM944352488316004486Veuhs/Pizaaene((((((((((((((((((TraoAs––––––––––––––––––lTot121111111111111rcG)))))))))))))S)))))Ll1111111221111111AphmH37408781435034611cafAmy3358774814030e31461lrasc54816244380306844yir/scr4829431640385s08644nsgz/Tnh(((((((((((((((((z+–––––––––––––––––h((((((((((((((((((yaG––––––––––––––––––)))))))))))))))))aar0+SG)))))))))))))1111111121)))))11111alcumA014858343707GlC34116urlLcnryc15624844380308644csiyla/uuipdrzssch(((((((((((((((((rod–––––––––––––––––GoS+tsei)))))))))))))))))oS+naemlsueuA+LNPsiuscLTrcMeaersFGyc-5Xraaau,oaiscLrAroMMra,ylubcrdruooctuascotllofcotivaaioo-samccS+GnedoeonA+etMNPsEmillenrsoot+AcoeiTrtNPusiMseleircFiLcGryye-TricsXRcMssaaieseraCcFcygGysL-crAaXraMMGlecaaaaagayaelulgbsLrrartuAroMMaaut,aciac,yclueabhtorlumtlaocccaoa2121111111111111luifavaaoco-accctcciruMGlntl1acefrcristdvaaioMicmlo-aE5183473874003s31614iiccolloGnidiniredsiioaoti0cnccmotieMnidEcedtinlliiA+ecncrias4019432348658od06448otNrPnscyoeieyictdoscRcsoa/ilsioCcicyTrreynMecayaicseRcelrsiFeazacisGyCtlcy-aelgsXh((((((((((((((((((catasaGalnieactucgcicsa–––––––––––––,L–––––raAceleaghrMMatmtaacaoaaltefciyclubO,coruceahioriruM))))))))))))))))))mtuaacifoarcarlfdcdtmicclsocdilaciruMisiiidifivraaciorco-acdxccncilidGcnsidtneiaieiadiitadnieMccEinrdollidcdtnroinsoaotiaoenacoeidtennad,ocliicoiaroyleiyicccesslRcnsasai1sCnacGeyictlcaccsdlicsecanae5ucaGelgOoatciaaaitaciicl,edeaOhmomudtS+iracolsifiadeccdlcxmiruModfrcurscddecisixuciiiiidiiaiccLnenidccdnodtn,ssiaeiaadicdolno,dasiuosGeienaclrcal,GeiccsersoncclcoauataealOsoiauoioincdammcdces2nA+dcNPxsiocince0iTr11121511111131doMideaerFsGyin-X,dsada7304829140247908sgasleLrArdMMmmGeiayluberuc1130933575998319ocuactllacilivaa/ioaon-auccGndea((((((((((((((((ztMEiall––––––––––––––––nrscootncoeitc1111112113115nlicimr))))))))))))))))yoeyicsR12111351111111csaisCimc447097182083402ycadmGliecsa8812004042497379aelgdat931335598110799maatcice,eahmt0991353935173819caoailf/cciruMfricr(((((((((((((((nzd/iclsiii–––––––––––––––idiiai((((((((((((((((cnczanidcdtniae––––––––––––––––ad)))))))))))))))docoooe))))))))))))))))3211111115111naomatlcssn279713082404804uccmaeOoi119370539919583raiidmodFCDdtasaoSTVECais/dxh(((((((((((((((nzacnlellarhlGeeoo–––––––––––––––iokakuecgn,cmsiett)))))))))))))))lcallwaeio-ueGaeeiucrdicdp5lnlmcenciamhidlnaerluFDaaSTVtdsoEC0ntaetfictasaahFCDTaSaoVdstCEncoepcoallliarehlGencsehoinoktkuora:elllgarhldGoerecmororeokecktuitiet2galwaec1-daecmnodseaeetwutecldalwrcaed-p5uDleµanelowue,ccitceenrcimdmhip5lnolnoerlgmc0netncdiimhietfsitaanoerladi0ntcno/eponetpfieitaFDdoaSstTVaECnadaimttncoloepoar:fiseshunrdkarre.attllloarihlrG:ei211211111131151eoch1rokaenlokrudremtenLgiatt2:::::ilcmcch1eaenotidtD9427040413828970µastooiael,cwaet-moecdelaeo(wuDµciooeE04L1(S,ocrdgit9317951833591093uenAp5mlnowinlBnsnoceaooneciLgdnamhii.00inni/S/nhnesrldb0natond)Ln2deemts((((((((((((((((%flnnzr/icatnfspa;asu˚%iddka––––––––––––––––cooepoImClCeiseaofmins.suh-dtlktato.0tr:nLC))))))))))))))))aati::::irldrareotcMhl).fiitasnL2toFiatch1:::::.ilaeono(aLdslmoi((a/rist5eo0E1L(Soeii8eciuohnAdD1uolµnwooB(,c/Snii/ntneE04L1(SHeinaunAM%.0ig0xowmnSoBhmonydbngi2rnea)n2nnnaieMs.00i%csnrcHSshao;dLbd%r%int)dnd2no(/Iens%esrcosmHgsed;.ahu˚%hS-ieomttlo0Ia2cfCessounamsir.NdkhadaSt-ocMh).ftC0gdhtielFOsaIIo.ld(aLaStscMthm).nftLia(rtM(L::::5iFoeli8ei.Haahio(aiLsr1u0anmastoix1(Sri//en5oeHi8oedlhdom(%g1Iu0xn/mine0EL1(SCcmtSyi/aiinn2HurnAn3)5ynoCwwnB%g0xcnmnnHnitmeyiFDCStVToasadEC2nra%irtdMd.0ini(SvnhHscnHdoblHgemosneh)tnad2uhSr%iieteodasdt%p(rca2sllliarh;lGen%HgieerNoaouhSiooioeIkogkutt3oegsdhroe2tm(gselsq.OshnIoIi-orcmNa2ti0oeahHtttiegdhaltM(LCelalnwOsaedIarISt-ocHMhamau).ifoureae0.atwuFix1ncmMk(/Le.rro(adLs,Ha/maipo5mlrIi)nw(0ralN5oCex1ic8et/masecneenchgin3),(15yumhCiniwnmISi/onuiCnHcetrltBaa0nnthciVn3)%g5yi0xCmnvewntn=fHmsiyitohlin8a2iemotratdinancpotdipceponHvlnHisieyolsneem)r%ioGtdtd1di(ktaght)0to3paor:r;Hg(iesqauehoSrieop,sare2rtdeiiua2hsgHt3oi/ernt(2iCasqrNn%cho1onae-noma2Cudigdha4hHt.eleeOn8s.mIkrICouinrcr,Lm/u5tlDiiµ)wa.M(oLtN,cenmak)sHeearoiaigomr,,(0H0/aix1i)w,bao/oeNunCo0gBasehtcgiVms,n(IiilC=c(stihxaonu8nao%Ln35dBa)5yhCcybiwnV13pnetsd/npli=tsyihsn8/)dtG1ik2vmhy)0nHlptsdµaaofll;CemsosyutdsMh5tl)Gdpkau,sae1d.pkush)0Cia/ei;eaDlLac%in-pl,gseCtid3otur4sntL(es/qar8N.tro:::::ialuias2r%inLa-hHtCi5loeSa4asontoCetine8.arr)uoimoirudolL0H.o5(lfn/i,mabakgeE04L1(StnCerao0i),tunt/oiA)ncsoi)ww0HoBlN(n,banxsne1C%e;g0i5n,(atyibM.00is13resSloohdu2(msdbxBa/dehn%ct)inV52rey2bsy%=103oesµrcihsn8Cs;s˚%Mh5t/ltu0ptdofIe2lyCeµssyoiemssC).GDhlLac1Mh5%t-lkeuuht)0i0ath;tearNemtDp,lsLdesacadStcMuhs).iftio/SotneaFerN%ep.on-is(CaLsos4mtoS(f8.rorgno5geoeieu8iertLh5)il1noucnaoctfeS(sani/gn)aH1noi;it0H)%gnfc0x2lrhm,nbaoodn2mCmy0i21dert;tirusnls0)cco(rnHxod2%m5r%ideitybdidr130es(fe0ossioHg/tettoauh%Sieco2eusty0sµtfeh2CssoniMhpe5tmilrtNu%oeuingtdhhtenelDOhuslLaIceeImpotoiisitteirrNM(LogesepHao1iaiotiiroS0saoancncexo1(sn/oegaeznouumiIff2lhgcCc2t(snanatnn3)t)rshn5ycuCmownasf)2clhi1tn;initiiuimrvsondH2s)cmioloemtodetotdtdricasit0posdidooepetito0ifceigts3osnsrion(seiqohuaeope%vea2uitehahHentnernmCtnhuerm1uiinsee.sanconrmkeprzi)rro,us1/iui)wancoNgoe,2s.,ezgrish,(uimcau(snouan2nBanhciVrishf2mlhma=iihn8ndttnusipttd)cmlddyiso)iiGdt1kih)0tad;ootdetiaovicp,sesdsueisent/oopeaeia%vn-Cnne4seeenst8hu.eruir)rrL5lnrseaeste,a).,1oi)rri0Hanco,banC,z0.,utusl(2x%5rshymba13essnn/tim2yµiCsdtMh5tlutddeoiDlLaciioteeirNavseenttoSoneonseesfg)rrt)nco,.,1;irod2mder0o0fesi%euthmtiepoisogeic(snanf2lhtus)ciiottocssopennhuer1iancozuu2rshmannimidttddoiioeiaveentnsees)rr,., (–)15ColumnC20toelmmumipnn. :te4m0˚pC. : 40˚C Cy0s Cys 5 239 (1–0) 239 G(–l0)u1c5uroGnliucca5uc2r0iodnmicGinaacl1aid0ctuGr0oanlaic1tau5croidn5ic ac21i0d93m1i(n–0) 193 17 0 5 10 15 20 min G-517 0 10 85 88-25 1206-27107155 :1:5 20 [email protected] a10 ::10 1w5 ww15.2l0ifmeisn c20iemnince.ca CANADIAN 17 LIFE SCIENCE 17 17

Colonnes HPLC/UHPLC LLLCCC/LM/CM/SMSL/LL/MCSCMC//S//SMMMMaSaSSSnn//a/aMMaMlnylSSyaSssliaaysaissnnniooaasaofflllfoyyyoossofsrriiroigsgssgraaaogoonnanffiicniococirrscsgsguusaualulfnlnffoloifoicnocnninsiciscciuucalaalfacfoccocidniiindddsiicsssc aaaccciiidddsss LLLCCC//M/MMSSSLLaLCaCanCn/na/M/aMalMylLSlySsyCSsisa/saiisanMnsonaaofSoallfyyfplasypsapnisaisnasainstnlotoytofosftothifppstheahpaeonneannfitntciopoctitcaoathahntcaecheticdnoiendiitnidcahcainceaanadnncdcaiidviccdvdiitaivdataaicatnmniaamdddnminiadvnviniCnitvtdCaaiCtmvmaimitinanimnCCiCn C Colonnes HPLC/UHPLC 1 SS0Sa11a1.mam0m1ppµplelMele::e5:5aµ5µc0SLµSSLh.Laa0am(m1minµpppMlHlee2e:O:a55/cµCµhLLH(i3nCHN2=O1//C3)H3CN=1/3) 11 1 00.1.00.11TµµaMMureienaaecch10h0..(.0i(T0nin11aHµuµHMr2i2OnOee/Ca/CcHHh33C(iCnNNH==121O/3//3)C) H33CCNN==11//33)) 1 1 1 1 Sample : 1S00anmgp/mleL: 1e0a0cnhg, 1/m0µLLeach, 10µL 11.2.T.TTaauaururinirnoeech2o11.l.i.cTTTaaaucurirodinceholic acid S1a.mSVapimtlaepm:lei1n0:B101S.n50aVgS(0mP/iatnmapmgnmLl/eptmoienl:etaL1hBc:0eeh51n0a,(0incPc10gha0an/,nµmcg1tLio/Ld0mtµ)heLeanceihac,ca1hc0,iµ1dL0) µL 22..TTaauurroocchhool2i2lci.c. TaTacaaciudidrocholic acid 1. V1ai.tsaVmCitaianmlcBinu51mB(.Pa1V5psa.i(antVPCantiaomtaontlcihmnttihoeuiBentnmhni5ceBap(nPat5aeicac(nPindtaaot)ocntihtdthoe)entnhaietcenaicciadc) id) 124 > 80 (1–2) 4 > 80 (–) 2a. sViaCtasamlCciniaulmcC2i.u(pVAmaaistnacaptCmosaoarntiCbnhltciaoecCiulntchama(iecAutenimspdaca)topneratbonitcthoeatnhcaeidtne)ate 1124 > 80 (–1)12244>>8800(–(–)) 2. V2i.taVmitainmCin2(AC. 2sV(c.iAtoVasrimctbaoiicmnrbaiCnicci(CdAa)cs(Acidos)crboircbaicciadc)id) 22 220 (+) 220 (+) 22 22 222020(+()+) 22200(+(+) ) 22 2 2 22 175 (–) 175 (–) 171575(–)(–) 117755(–()–) 514 > 1245(1–4) > 124 (–) 551144 >> 112244 5((––51))144>>112244(–(–)) 00 55 10 min 10 min 0 05 5 10 10 15 15 20 min 20 min 1100 mminin 20 m20inmin 20 2m0inmin 00 00 55 55 1100mminin 00 00 5 5 5 5 10 10 1010 15 15 1515 Column Colum: Snhodex :HSILhIoCdpeaxkHVITL-IC50pa2kDVT-50 2D Column Colum: Snhodex :HSILhIoCdpeaxkHVITL-IC50pa2kDVT-50 2D CECFDCEFDCllECDFleloooeouooulltletolweloluweueuueutlnwenmcumecmmrrtnttmctaanornotnnttatnorreetttereetmemCEDFCEFDCmECFCDlleplpooloueooulleooouptl..ltwelweueutuellwe.::::::::::uneunmcmcmn::::rmctS5E03rS50E3mtttaratnot5E03no0.00.0aSnShhnto33tnr0.0m˚erStm˚eoIotIC3tCmrme--etm˚eIdCMmdeMMM-mmLLMemMeLS/S/pxpHxmHmS/p//H.m.MCHM.C/Hii:::::n::::MnC:::::iOISOInS5S3E0530ELLO5S30ESO00.00.OISSh(I(00.33SChMOCM3m˚m˚(NIoICNCm˚mmMo-I-CpmN-pRdMHMRMMHdMMLaLRaHMLe4MeS/4kS/kMS/xHm4Hmx)Ham//)aV/MMCV)aCqHiMiCHqninTqn.TOSOIS./OIS-L/.C-L/O5CO5(OIC(IM(H0CMCMNH0NNH3pR2pHR3HR2CH3DaCMaM4DCM4N4kkN)aN)a=)aV=qVq=q2T2.T.20.///0-C-0/CC55/8/H8H0H0800303322CCCDDNNN===222000///888000 CEDFCEDFClleooECCDFoulletololluwleeooueouutlwentulmeclwemueurntmctnamcrnomtntratttnoraenottnretetretemEDCFemCECDFmlpleCECFDooulleoooup.tlllweepootuoelulwe.:::::ueuntl.mclwen::::uemcuS5E30rmt:::::trnatmct5E30no00.maShrno2ttS50E3nt00.m˚arSteoInCo2tmre0.0n-Shtm˚te2IdCMmreMem˚-otImLCmM-emMeLSd/MMmxpHmLS/peHm.(S/CHp.SixHmn::::(CS:::::i.OII(nCHM53E0LSi:::::OIS53E0nOM00.ISOII00.2)S5E03SChOML2m˚NICm˚)m0.0OSo-IhCIpmN2-)MCHMm˚doIMNMCLam-HL4pedS/MkMHS/HmL4axHaemV4S(/CkaqS(xiHmCHnSiTqan.OI(VC/HOIMI-Siq.CMLn/O5TOIIO.C)IMHL0/)-CNCONH5I32)CpHH0CHN3Dap4C3N4H2kaCaND=a4kqVN=q3a.T3V0=./q/C-0/T3C.57/H/0-H070C5/3037H02CC0D3N2NCD==N33=00/3/77000/70 LLLCCC/L/M/MCM/SSMSLLLaaCSCaCnn/n/aaa/MMaMnllyylSaSySsslsiyiaasasissnnniooasaaoffllolfyyyggfssgslliigylyissyslppypoohhophffofohosggsgosallalsayyyttapteppeethhheaaoaoonansnssdnadadadttgteggeelglulauluaaufnffonnfoodosddssisginigginnnlalluaauuatftteftfoeeooesssiiinnnaaattteee LLLCCC//M/MMSSSLLaLCaCanCn/na/M/aMLalMyClSlySsy/SsisMasaiisannsSonaaofoalalfyyfplnsypshpaishisolhsiyossoosospsifopfshpfphpoohhpohfroohryopryslosyhalpsapltoahptehsetohdopedrorhdysyrsolalyasaarcltaycatceeclcthadedchtadhaessraardiasdircdcasiecdceacshhesccacsahhrraiiadrdrieeiddsseess 33 AMPA AMPA Sample : 1Sµga/mmpLlee:a1cµhg, 5/mµL each, 5µL 33 A((AAA(MMAmmmPPiinnAAinooommmeeettA(hh(tAA(AhyAyMmmMlylmppPlipiPhhnniAnhoAoooossmmmpspepehhetthoothhhonnyyyniillccpplipchhaahoacococsisidsdpipdp))hh)hooonnniiciccaaaccciididd))) SSaammpplele: :11µµgSSg/maa/mmmLLppelleaeeca::hc11,hµµ5,ggµ5//LµmmLLLeeaacchh,,55µµLL 3 S3ample : 1SµMamepalceh:,15µµML each, 5µL 41S23....1234aFFGG....m23S1GFFGrrll...auupuurrllGGFmccuulccuuerttccooccllupoouu:ttoosscloosscce1eessteeoossµ--oee--:eess614312M--s61--1324S1ee--61....e--61pp....µ--a--ppFFGG-e--16S132pphhFFGGMm6pphhrra--...llaoohhrruu-uulloohhcppuupuuFGGpmoosscceccoosshhhcclccrpphsstteaoollpp,ssupttoouuoopphhocoosspphh5c:lccssssaahhesheessaahhµteepp1oottaapoee--,ttaaL:ee--µhhss16eett--hs516tt1eeMeeaa61--ee((eaµ--((GGppµ--tt--FFpp((-tLee61((ppGGhhMee616FF16hh--hhooa((-PP16PP16oopp(GGpoocssFePPPP))ss))hhppsshh16a6pp))))oopp,hhoPPcPhhsshh5aash)))aappaattpµ,tteehhtteeLh5eeaa((aµ((GGttFF((GGtLeeFFe16616116((PPPP(GGPPPPF))))))61))6PPP))) 110 (–) 110 (–) 1 1 4. Fructose-41.-Fprhuocstpohsea-te1-(pFh1oPs)phate (F1P) 111100(–()–) 111100((––)) 12 12 21 12 2 2 GlufosinatGelufosinate 182 (+) 182 (+) 44 Glufosinate Glufosinate 182 (+) 182 (+) GlufosinateGlufosinate 182 (+) 182 (+) 44 44 GlyphosatGelyphosate GlyphosateGlyphosate 168 (–) 168 (–) GlyphosateGlyphosate 168 (–) 168 (–) 168 (–) 168 (–) MPPA MPPA 153 (+) 153 (+) 259 (–) 259 (–) (3-Methylp(3h-oMspethhinylipcohporsopphiionnicMicoPpaPrcoAidp)ionicMaPciPdA) 153 (+) 153 (+) 259 (–) 259 (–) (3-Methylph(o3s-MpheitnhicyolpphroosppiohninicicMaoPcpiPrdoA)pionicMaPcPidA) 153 (+) 153 (+) (3-Methylp(h3o-sMpehtihnyiclpohporosphioinicoapcriodp) ionic acid) 259 (–) 259 (–) 0 05 5 10 10 15 15 20 20 0 20 42 64 86 180 1120 1142 min 14 min 2m0in m2in0 0 05 5 10 10 15 15 min20 m2in0 0 20 42 64 86 10 8 1210 141m2 in 14 min min 0 05 5 10 10 15 15 min 0Column 2C0olum: Snh4o2dex :HSILhI6oC4dpeaxkHVITL-I8C560pa2kDVT1-0580 2D 1210 1412min 14 min Column Colum: Snhodex :HSILhIoCdpeaxkHVITL-IC50pa2kDVT-50 2D CEolluuemntn ECluoel:un:Smt 2hn5omdeMxHH:C:I2LOS5IChOmopNMdaHekH4xVCaHTqOI-.L/O5CI0CNH2pH3Da4CkaNqV=.T8/C-05/H02302CDN=80/20 CEolluuemntn ECluoel:un:Smt Hhno2Ode/1x%H::IHHLSCI2ChOop/Oda1Hek%xVaHHqTC.I-/L5COI0CHO2p3HDCakaNq=V.7T/C0-5/H2030C2/1DN0=70/20/10 EFlCuloeownlut rmatne FElColuwoe: ln:u2r:at05mtS.me3nhmMoLdH/emCx::iOnH0:2O.I53SLNmmhIHCoML4pd/maHekqxiCn.V/HOCTIOHL-N5I3C0CHpN42aD=akq8V0.//TC2-H0530C2ND=80/20 CEFloulloeuwnmt rnateCFEloolulwue:mn:HrSat0nh2t.Oeo3md/1eL%x/mHH::iInCS0LH.hOI32ComOpdH/Lae1/kx%maqVHin.HT/ICLC-5IHOC03OpC2aHDNk=aVq7T0./-/C25H0/312C0DN=70/20/10 FDlEoewluteercnattoer DFeElotleuw:ce:0:trnEo.a3t2rStme5I-mLM/MmSiHn:(S:CE:I0MSO.23I)5O-mMmNLSMH/m4(SHianICMqO.)/COHN3HC4Na=q8./0C/2H03CN=80/20 EFlDuoewtnetrcattoer EDFlueloteew:nc:t0HtrEo.a23rStOmeI/-L1M/%mSi:nH(S: HECI0MS2O.3OI)-OmM/1HLS%/am(qSHin.I/MCCO)HO3CHNa=q7./0C/2H03/C1N0 =70/20/10 FDlCoetowelucrmtaotnre teFCmDloepwltu.:em:rcE0at4n.Sto30eItrm-˚eCMmLS/pm.(Si:n:IM04E0.3)S˚CmI-ML/Sm(iSnIM) DCeFtoleolucwmtornratteeCmDoFepltuo.:emw:cE:t6nSro00aItr.-˚et3CMemmSpL.(/Sm::IM6i:En0)S0˚C.I3-MmSL/(mSIiMn ) DCeotleucmtonrtemDCepot.el:ucm4Eto0Snr˚IC-teMmSp(.S::IEM4S0)I˚-CMS (SIM) CoDleutmecnttoermCpDo.el:utem6:c0nEt˚CoStreI-mMpS. :(S:6I0EM˚SC)I-MS (SIM) Column temCpol.u:m4n0˚tCemp. : 40˚C Column temCpol.u:m6n0˚tCemp. : 60˚C LLCCL//MCM/SMSLLaSCaCnn/aa/MaMnlylaSySslsiyasaissnniosaaoflolfyyafsasmigmissliynionopofofhgagaolmylmsycaiciontnoesoosigadgidlnleyyedccaoaognsnlstuitidbdifboeieoisoaitantinnciacttstisibebiioottiiccss LLCC//MMSS/LL/MCMCS//SMMLaCaSSn/n/a/MMaMlylSySs/siaMsaisnnoSaaoflalfyyhnshsiaisiisssltytaoosamfifmshihnoiinisefsetthaaaaimnsmntdiadinnmheheiisansatnteindidddaininhnhedieissthtiiiddsitinindeeine LC/MSLaCn/aMlySsiasnoaflyasmisinoof galmycinoosigdleycaonstiidbeioatnictsibiotics LC/MSL/MC/SMaSn/aMlySsiasnoaflyhsiisstaomf hinisetaamndinheisatniddinheistidine 97 (–) H99H7S7SO((–O–4))-4- HHSSOSOSa44-ma-mpplele: : ASmaimnopglelyc: oAsmidineoagnlyticboiostiidces a0n.1tiµbgio/mticLs(0in.1Hµ2gO/m),L20(iµnLH2O), 20µL Sample 5: n5SgnSg/ama/mmmLppLelelaee:ca:h5c5nh(nign(gi/n/mHmH2LLO2eOe)a,a)c2,ch02hµ0(i(LµninLHH22OO),),H22H0is0µitsµLatLamminineeHHisisttaammininee 97 (–) AmSinaomglpylceo:sAidmeinaongtiblyicootiscisde0.a1nµtgib/mioLtic(isn0H.12µOg),/m20Lµ(Lin H2O), 20µL Sample : 97 (–) 9H478S5(O–()4+-) KaHnSaOmS4ay-mciKpnlaen:aAmmSyiacnmiongpllyec:oAsimdeinaongtliybciotsicidse0a.1nµtigb/iomtiLcs(in0.H12µOg/)m, 2L0(µinL H2O), 20µL Sample : 5nSga/mmLpHleeias:ct5ihdn(iginn/emHLH2Oiesa)t,icd2h0in(µienL H2O), H20isµtLamineN HistamiNnNNNeHH2 2 NH2 485 (+) 485 (+) Kanamycin Kanamycin N NH2 Histidine Histidine N 485 (+) O HistidOiOne Histidine NH2 485 (+) 485 (+) KanamycinKanamycin ON N N N NNH2 468 (+) TobramycTinobramycin NH HN 468 (+) 468 (+) N NOOOHH OOOHH H H 468 (+) TobramycinTobramycin N N 464878(+(+) ) N N NNHHHNH2 2N NH2 H H 478 (+) TobramycinTobramycin NH OH NH2 446788 ((++)) GentamiciGnentamicin H OH 478 (+) GentamicinGentamicin N NHNH2 NH2 H 478 (+) 478 (+) GentamicinGentamicin 615 (+) 615 (+) NeomycinNeomycin 615 (+) 615 (+) Neomycin Neomycin 615 (+) 615 (+) Neomycin Neomycin 156 > 1101(5+6) > 110 (+) 112 > 95 (1+1) 2 > 95 (+) 586 (+) 586 (+) Amikacin Amikacin 156 > 110 (+1)56 > 110 (+) 112 > 95 (+)112 > 95 (+) 586 (+) 586 (+) Amikacin Amikacin 586 (+) 586 (+) 5 5 Amika10cin Amik10acin 15 15 0 0 0 0 5 5 10 10 1m5in m1in5 Column Colum: Snhodex :HSILhIoCdpeaxkHVICLI-C5p0a2kDVC-50 2D min min 156 > 110 1(+5)6 > 110 (+) 112 > 95 (+1)12 > 95 (+) 00 55 10 10 15 15 FECCFDCEllFDCEllooeouoou0lletolwleoluweuueutlnwenumecmmrrtntmctaarnotnnttatnoreettreetemFCECFDEmFDCEClllplooeuooull0eoooup.ltwelwetuuellwe.::::::::uenunmcmn::::rmcE(L04S(trL(0S(mttBAarBAatt(L40E(noi.0i.aSnhhnBAnton3t3)%)n%i.0˚rSet;e;oInoeC3tmre)me%-t˚e;1I1deCaMmd)ae)-m1L.L.arMe)3mre535LS.//r3g0xp5%gm0x%mS/pg0r%%m.r%(Ha.SHi5ai%rn:::::::(nNadS:::::iNdIIInMt4(0LE(L(L0(SNdtLiHIBA40L(E(SBAoiHeoMtBAe0.ii.IShiIHnn0i.o3)3SC)hen)%3%nCn33˚1;);%Io1Cee˚)mm;n3to-ICepmt1a011-paa0dMa)1)t(daM)aq0La(%.L.Hrqa%r3LHe.35(5re3qS%/5k.H/k.g0Si/g/0x%m%mig0/x.%m(g(i%r/(V%rB((0gr%hVBaH(5S(ia0(hiHanBSiCn0)hNdnNCd)I;tNpIdI;tMtI)potL-iHMtL;tiooCpHe-roiHeCo5oreI5C)I5rn3eCHn3)01C5n3es1H015mtsHta0mt3spsa0pa20m3s(Cq(2%u3siH(qa%qHCaD%nuHiCuD.rniNk.ink./)reiN/gir/,)(Nge(g(),eB()(0(VhB,1VB;0)h0h)1;)11;0CC);t)p0;t0p;top0%oCo-r-%CCrr%e555eeH55HsH00(mss5mm3s((33ss525C2uiCCtuuniiDDnnrotNtrr)eNNoo,))ee,,1)1;))1111;5;105050m0%m%m%inii(nn)5((5)5) ttotoo11155m5m1mmi5niniinn))) 15 1m5in m1in5 min 00 5 5 10 10 min min 8 18 Detector Dete:cEtoSrI-MS (S: IEMS)I-MS (SIM) 15 18 Column temCpol.u:m4n0˚tCemp. : 40˚C Column ECC0louoleul:unm::Smt S2hnn5ho0odmdeexMxH5H::H:IS2LCISL5IhOCh0IoCoOpmddpaHeMeakxaxkHVqHH5VCC.I/CILC-OL5I-HICO50C3p0Hp2Ca2aDaNkDkq=V.V7/CCC01-/H-50353000C22NDD=70/1300 15 CE0olluuemntn min min G1-86 CANADIANLIFE SCIENCE EFDCDCFlleoCEFouletololweluoeoutlwnumeclwerutmctnarnomtrattnoraettnreetteemDCFmEDCFlpeoECFolleooup.tlllwotuoeluwe.::::uemclwen:::mcu24E0rt:::rnatt4E0no50.maSnro3ttS200.0˚rSateIC3tmre5.-nht˚met3ICMmee-0omLmMmMmLS/dpmLS/p/eMm.HM/./ixmn:::MC::::iSHnH4E0i:::O24E0SnC0.S(I50.3SS20MOL3˚(OIC0˚mM5.-IhCIm3H-RMCm0OoMLmRMLmpaSdM/HMS/mLqa)me/M//Ma).kHixMm/niqnCSHCVHSi.nH/COC(ICM(L3MOO-HCI5RCOHR3N0MpCMH=a2a)Nq7)Dak0=.q//V7C.3/0CH0C/-33H5C030NC2=ND7=07/300/30 Detector Dete:cEtoSrI-MS/M: SES(MI-MRMS/)MS (MRM) 1 8C8o8lu-m2n2te6mC-po2l.u7:m74n05˚tCemp:.:: 40i˚[email protected] :: www.lifescience.ca

HPLC/UHPLC Columns LC/MS/MS analysis of monoamine neurotransmitters LC/MS/MS analysis of oral anti-diabetes drugs HPLC/UHPLC Columns LC/MS/MS analysis of monoamine neurotransmitters LC/MS/MS analysis of oral anti-diabetes drugs OH PPoloylmymere-rb-absaesdedHyHdyrdorpohpihliciliIcnItnetrearcaticotnioCnhCrohmroamtoagtoragprahpyh(Hy I(LHICIL)ICC)oCluomlunms n(HsIL(HICILpIaCkp)ak) LC/MS/MS analysis mo m ne neurotransmitters LC/MS/MS analysis of oral anti-diabetes drugsLC1111111111111155887711777857/44442727000447M>>>>>>>>>>>>>> 91911991111191S16616655000166/660077760(((((M+++++(((((((((+++++++++))))) )))))))))SLaLC1111n7857CNNANAA1111DDD/7404a8577dddoooMooo/7440rrrrrr>>>>SSSlpppeeeMaaayeee>>>>nnnaaaddd1911Srrraaammms1066rrrooo1911SeeeHNNH/lll6706610iitttiiiii(nnnnnnooonnnMNN/+067s(((aaaeee(nnneeeM+++)+lll(((iiiiii)))+++)nnnSnnnoHHHHHHHHH)))HHHHHHeeeSOOOOOOOOOfOOOOOOaaHHHnHHHNAnDOOOOOONNNAadoDoHHadrorSlopea22nrrSyelpenaadOOONHNNHHHHyernaodamsroHHHriieamlsssrotiiiaennlttontiNNNsiiaannaeonNneOONNNNNNsHHHmmaelneiiHHHHHHHHn222nloiiiiHHnHn222HHnnoeiHHHOOHHeOfeeOOOONNNOfOOHHHmHHm222HHOOOONooHen2nONHuONHoHoHraaS0S0S0NoNONNm...aaaHON111NmHHHmmmHt2µµµHHH2r2MMMippp2inalllnNeeeeeeNnHeaaa:::He2ccc2222shhh000nnµµµm(((iiiLLLennneiHHHuut222trOOOrS00Seoo))).a.a11rmtmtµµrsMrpMpalaleeeenna:a: c2c2sshh00µmµm((iiLLnnLiHiHtt22CttOOee)/) Mrr61222612226ss0044363640686600888886S>>>>>>>>>>>/M7397397737914201042042444S((((((((++++++++(((LL+++)))))))) a)))CCn//aM226M262064l604y886SAAA886Ss>>>ccc/>>>/aaaiM973Mrrr937MMMs240bbbVVV4204oooiiiS4((gggoooS++((osss(++lllggg+iii())eeettt+))flllaooo)iiiabbb)lllnoooonsssareeeaallyAlyAscscaaiarMisnbrMsVboiVMMtgooiosgoilgoeesietl-gflitteoitfffbdloioolboolrrioosmmarseriiaebnnalelata55SSS5ennnnaaangggstmmm///itmmmppp-idllleeedLLL-dr:::eeeiu555aaaaiµccµµcagbhhhLLLb(((seiiinnnetHHHS5et222na5SeOOOgsmna/)))gsmp/dlmepLdlr:eLu5ar:ecµu5aghLµcg(shLin(siHn2HO2)O)PoPloylmymePreo-rbly-abmsaesrde-dbHayHsdyerddorpoHhpyihldiicrloicIpnIhtneitlriecarcaIntcitoteinoranCchCtrihoornmomCathaortgormgarpaathpoyhgy(rHa(IHpLhIILCyI)C(HC) IoCLloIuClmu) mnCsonls(uH(mIHLnIILCsIpC(HapkIaL)kIC) pak) 0 LL(SS((BAAiihh1nn))%C;;1ooee1222ddaao1) 00rreel26>u55500gg0xx>mmm9rr%HHaa59nMMNHddII50((LLiiN0+ee0HHII()CC+nntCCott)ppOO((aa5HHOO:mkkiigg111SHHiVV000hhnhCC)aaNopp, qq--Hd6rr555..ee20e//005ss((%xHBBss22iuu))HHNsDD;;tNHrrtINoCCeeaL))HHmI1111C;;033555ipnCC%eaNNk1(150V0NtCoH-625m0HH222ii2sni000sDt)ta,mmmam1m1iiinnn015i5ni%nee(6 : 0 71 (+): (LLSS((BAACiihhnn))%o;;ooeel221uddaa1)555003rrmee36000gg00xxnmm0rr%>0HH>aaMMdd7II7(LL1ii0ee1HHIICCnn(tCC+(ott+pp):OO(()aa5HHSOOmkk111iihgg000HHiVVohhnCCd)aa5pp,5eqq--6rr55x..ee0//00ss((H%BBss22Iuu))LDD;;trrIoCCeeMC))HH2111pe;;555033atfCC%ko10NN1rVm0(5Cin-to5062mD222inM000)M,1emmm251tefiii05nnnotf%romrm(i6ninto C1o1l2u>m9n5 0(+) : : CElouleunmt n 20 min ECClooulle1uun3mmt0nn0> : 20 min Eluent : Eluent 20m20inm) in 20m20in)min 0 to 0 FClolwumrante : 0(SBC.h3%Eomlld)uuLe6em/0nxmnt%HinI(L0ICtop:a5:mkS(hAiVno)C);d,-26e500x00%Hm2DIMtLoICH1p0C%aOkO(V5HCtao-q56.0/m(B2inD);),C1H03%CN(6 to 20min) FClolwumrante : 0(SBEC.h3l%uomeld)unLe6mt/0xmn%HinI(L0ICtop::a5(AmkS)hi;Vno2C)d,0-6e050mx0%MH2DItLHoICC2Op0%aOkH(V5aCqto-./5(6B0m)2;inDC)H, 23C0%N (6 to 20min) 0LEE4(AE.i0SSn3)l˚;IIueCm--2eaMML0nrSS/0tgmm//rMMainMdSSieH((nMMCtRRO(:HMMOL(iAg))iL(HnB)hi;ne%a2paeq0ar).e0r6g/sm(g0rBsar%Mu)ad;rdiCe(Hi0e)nHCn;tt3otO(CH(5OHNimgiHghihnap)qp,r.6er/es0(Bss%su);urtCreoe)H)1;;30C%N (5 to 6min), 10% DFEleoutweencrttaotre : (6 to 20miFDDCEnleeo)outtlweueenmccrtttanootrretemp. : E0E4L(AE.0iSSn3)l˚;IIuCem--2eaMML0nrSS/0tgmm//rMMainMdSSieH((nMMCtRRO(:HMML(OBL(iiAng))i%Hn)eh;ea)a2par6q0rg0.e0g/r%sm(arBsadMu)d(;i0eriCenHt)noHtC;t(35HO(CHmiOgNiighnHh)p,ap6rqe0r.es%/ss(Bustru)o;erC)e2;)H0;%3C(N5 (6 to : DCeotluemctnortemp. : (4B0%˚FClo) 6w0r%ate(0 to 5:m(B0i%n.3),m) 6L0/%mint(0o t1o0%5m(i5n)t,o660m%int)o, 10% (65 to 260mminin),)10% to 6min), 20% (6 to 20min) Column temp. : 0F.3lDomweLte/rmacttieonr : :0.E3SmI-LM/mS/inMS (MRM) 20miCno) lumn temp. : 4(BF0l%o˚Cw) 6ra0t%e (0 to: 50m(.B3i%mn),L) 6/m0%in t(0o t2o0%5m(i5n)t,o660m%int)o, 20% (65 to 260mminin),)20% (6 to 20min) Flow rate : 4EaaCD0Snn˚eCoIC-tloMaauelmcuSlltmyyno/MrnssteStiimess(mMp.pooR::.Mff:4E)04Srr˚0ICii-˚bbCMaaS/vvMiiSrrii(MnnRM) LCFDle/otMwecrtSaotreana::lyE0DCFD.Ss3eoleoImt-iltuewMseLmccS/rttmnoaoo/trMrtiefneSmo(pMl.iR::g::ME4E0o0S).S˚3IC-ImD-MMLSNS//mM/AMinSS(M(MRRMM) ) LLDCCCeo//tlueMMmctnoSSrt//emMMpSS. :: LCCo/lMumSn teamnpa. :ly4C0s˚oCilusmon ftemopl.ig: 4o0˚CDNA LC/MS/MS analysis of ribavirin Sample : 1µL LC/MS analysis of oligo DNA LC/MS/MS analysis of ribavirin LC/MS analysis of oligo DNALC/MS/MSLaCn/aMlySs/iMs Sofarnibaalyvsiirsinof ribSaamvplier:i5nµL 1 S1.aRmibpalevi:ri5nµ0L.5ng/mL LC55SS2SS2/44..ayyya22M55nnnmmmm..ttt11hhhppggSeeell//ee((sssmm––iii::))zzzLLa11eeeµµ((dddniinnLLoooaHH22llliiiLggg22mmloooOOyCee))DDD2SSsrrSS/.ayNNN2ay((inTTmMnmmAAAstTTthpghp222))elSe/eol000esmsmmmi:zfi:Lz1aeeee1eµ(drrroµidnnL(((LoAAAloHalTTTiilgi2gAAAgloOoCCCyo)DCCCDsNGGGNDiAAAAs2TTTN20TTTo0mAAAAmAAAfeerGGGro(CCCA(ATlGGGTiAAAAgACAAACCoGGGCGTTTGATTTDATTTTTT;;;NATcccArrrAAuuuAGdddGCeee)))CGGAAAGAGTTTTT;Tc;rcurdued)e) 1 N O 1 1(1S(iinn..aRRmHHiibb22pOOaalevv//CCii:rrii5HHnnµ3300LCC..55NNnn==gg11//mm//S1441(Si.LLa))n.aRmRmHiibpb2palOaleevv/i:Ci:rri5i5nHnµµ30L0LC..55Nnn=gg1//mm/4LL) 2.2mg/mL (in H32mOe5)2r4.(25Tm.T1gT(/–)m) L (in 2Hm2Oer) (TT) N O 1O 1 849.2 (–) NO HO N NH2 NH2 (in H2O/CH3CN=1/(4in) H2O/CH3CN=1/4) 854495..21 ((––)) 23m4mmee85rer44(r(9T5T(.TG.T21)TT((–)T–))T) 2mer (TT) HO ON NH2 NN N NH2 1178.2 (–) 3mer (TTT) ON NO 1187489..22 ((––)) Monitored ions N :::::::::iioo[[[[[[[[[MMMMMMMMMnnss---------2HH2H2444333HHHHHHH]]]25M21---]]]]]]]--0242232334425M12o14-------m---02nm11o14-meim9ntm11eromeim9retreromerererdrere::::drio[[[[MMMM::::nio[[[[sMMMM----nH243s----HHH]H234-]]]HHH432]---]]]324--- 745.2 (–) 34m15me1m8er74re(89Tr(.G.T22(ATT((–G)T–))TT)TT) 34mmeerr ((TGTTTT)T) 2M-o4nmiteorred NH2 1714758..22 ((––)) 25-141mmerer HO 51-21-1m9merer 901.7 (–) 2M212-002o4-mmnm1eei9terromrreedr HO OH OHN NHO ON 970415..72 ((––)) 5-11mer N 1066.2 (–) 12-19mer 20mer OHO OH O 45m17m16e47mre58r(.eG.22(rAT(((–GTA–))TTA)TGTT) TT45) mmeerr ((GATGTTTT)T) OH OH 59m7604me15r.7e.72(rmA(((–GeA–))rTA(TGGTTA)TATG)5T6mTmTe)er r(A(AGATGTTTT) T) 245 > 113O(+H) OH OH OH 245 > 113 (+) 1066.2 (((–––))) 109660m61.7e.27rm(((–8eA–)m)rA(eGGrTA(TCATGG) ATTA6TmG)7TemTr eT(Ar) A(GGATATGTT) TT) 245 > 113 (+) 1920110..77 0 1 2 3 4 5 6 7 8 9 10 min 1210.7 (–) 11201606.7.72m((–8e–)m)r (e9GrmA(CeArGG(AGTTACTGG)T7ATmA8TeGm)rTe(TrGT(AC)AGGATATGTT)TT) 1011m0367in65..23 ((––)) 0 245 >1113 (+) 2 2453> 113 (+4) 5 6 7 8 9 10 min 7 8 0123456 9 0 CEClooulleuu1nmmt nn 2 0:: SS50hhmoo3ddM1eexxHCHHOII4LLOII2CCHppaaqkk.5/VVC3CCH--355C00N622=DD410/907 5 8 6 9 7 10 8min 9 10111m325713in501...378 ((––)) 11327150..37((–8–)m) e9rm1(Ce0rGm(AGeArCG(GATAGTACT8GG)mT9AeTmArTGe()CrTG(TGTAC)AGGATATGTT) TT) (–) FElouwenrtate : 05.02mC5omMluLHm/mCniOnOH a:q.S/ChoHd3eCxNH=I1L0I/C9p0ak VC-50 2D 11533715..83 ((––)) 11533715..83((––)) 9m1e0rm1(G1emrC(eGArAG(AACAGGGTAT9CATm1GG)0eATmrATe(TGGr)CT(ATGGTAC) AGGATATGTT) TT) FDleotwecrtaotre : E0.S2EI5-lMumeSLn/tmMiSn (MRM: 5) 0mM HCOOH aq./CH3CN=10/90 1688.0 (–) DCeotlueumcmtnonrtemp. : E4SC0Sh˚FoIC-lldoMuwemSx/rnMaHtISeLI(CMpR:aM:kS0)hV.o2Cd5-me5x0L/H2mDILinICpak VC-50 2D 1688.0 (–) 10m111e2mrm(eAerGr(A(CTAGAGAACGAGGC1A0TG1mAT1ATGmeA)rTGeT(rATT(GTA) TAC)GGCAGAGAATGTTT)TT) CElouleunmt n temp. : 45E0l˚mDuCeMtnetHctCoOr OH :a:q5.E0/mCSIHM-M3CHSNC/M=O1SO0(H/M90aRqM./)CH3CN=10/90 1531.8 (–) Flow rate : 0F.2lCo5womluLrma/mtneintemp:. :04.205˚CmL/min 1226.6 (–) 11658381..08((––)) Detector : EDSeI-tMecSto/Mr S (MR:ME)SI-MS/MS (MRM) 11262868..60 ((––)) 11262868..60((––)) 1112m1m3eemrr(eA(TrAA(GTATCGAGCAAGGA11AC2G1AGmmTGATeeTrATrT()G(TTATA)ATAGTGC)CGGAAAAGGTTTTTT)) HHHyyydddCrrooorloullmyylyzznzeeteeddmdpdd.d:eee4Cxx0x˚ottCtlrruraamannnntemp. : 40˚C 1327.9 (–) ((––)) Hydrolyzed dextran 1327.9 11322276..96((––)) 121m3emr1e(4TrmA(TAeTrGA(CAAGTGTAC1AA12GA3GmAGmTeACTerGGrT(TT)(ATATATTAAG)GATCGTGTCA)GAAGATGTTTT)T) 1226.6 Sample : 10µL 1432.3 (–) HydroDDlyeeggzrreeeeedooHff dppyooedllyyxrmmoteerrrliiayzzaaznttiieoonnd((DDdpp))extran 11433227..39 ((––)) HSaymdrpoleyz:e1d0dµLextran 0.5% 1542.0 (–) 11433227..39((––)) 13m1e4rm(Te1Tr5A(mAATeGTrCA(GGA1AAG3TAm1CTG4GeAmTrAAT(eGATTrTGC)(AATGTATATGTAA)CAGGGTATCATGG)ATATGTT) TT) (HinydHr2oOly/zCeHd3dCeNxt=ra5n0S/05a.05m)%ple : 10µL 11544322..03 ((––)) 1 Degree of polymerization ((iDn pH)2O/CH3CN=50H/5y0d)rolyzed dextran 0.5% 1638.3 (–) Sample : 10µL S(ianmHp2lOe /:C1H03µCLN=50/50) 11653482..30 ((––)) 14me1r5(mA1Te6TrmA(GeArAG(TCCT1GGA4AAAmT1GAeT5GCrAmT(GAAeTAGrTTAT(C)GAGGAATATGTATTCAG)GATGATATC)GTATATG) TTT) 1 of polymeDr1iezgatrieoeno(Df po) lymeDripzation (DHpyd) rolyzed deExntlraarngH0ey.d5r%ovileyzwed dextran 0.5% 1734.7 (–) 11544322..03((––)) Degree D20p (in H2O/CHD3pCENn=la5r0g(i/ne5d0H)2vOie/wCH3CENn=la5r0g/5e0d) view 11763348..73 ((––)) 1711m65e34r82.(.3C0C((––G)) ATTAAGCGAAGT1T5Tm) 1e6rm(GerA(TCTGAAATGT1CA51GmA6AGemArCeG(GGrT(AACTATGTGT)AATTATTGTA)CAGGACAGGATATGTT)TT) 1 1 20 20 Dp Dp Enlarged view Enlarged view 117811mm76e3e3r4r8.((.7CA3CC((––CG))GATATTA1T7AAmGAeGCrCG(CGACAAGGAAGTTTTTTTA)T1A)6GmCeGr A(CAGGATTTTTA) A1G6CmGeAr (ACGGTATTTT) AAGCGAAGTTT) 20 20 30 1839.0 (–) 30 11873394..07 ((––)) 11178911mmm87e3ee3r9rr4.(((.0CAT7ACC((–C–CG))CGAGTATATA1TT18AAT7mAGAmAGeCerGCGr(CA(GACCGAACCAGAGGAGTAGTATTTTTT)TTTAA)TA)AGGCCGGAAAAGGTTTT) 25 30 35 30 1940.4 (–) 25 30 m3i5n 10 25 30 mi3n0 30 35 1940.4 (–) 119811mm984ee30rr9.((.4TA0AC((–C–C))CGGAAT1TT19TA8mAAmAGeerGCr(CTG(AAGACCAACCAGGGGTAATTTTTTTT)TAA) AGCGAAGTTT) 10 10 min 1839.0 (–) 1533.3 (–) 20mer (ATACCGATTAAGCGAAGTTT) 25 20 3205 3350 11593430..34 ((––)) min 35 210911mm593ee43rr0.((.3TA4AT((–AC–))CCCGGA2AT10TT9mATmAAeerGAr(GCA(TCTGAAGACCAACCAGGGGTAATTTTTT)TTAA) AAGGCCGGAAGTTT) min 10 10 20 20 0 5 10 15 20 min 05 10 15 20 222550 30 35 min 1533.30 (–) 201m5:e3Sr3(h.A03o5Td(A–e)CxCHGILA2ITC0TmpAaeAkrG(VA5C1NT0GA-A5C0ACG2GDTATTTT) AAG1C01G5 AAGTTT) 20 min 20 min :0Sh10odex H5ILI1C5pak V1N0-5200 4D 20 30 35 min 30 Column 15 20 min 05 Column 15 20 35 CElouleunmt n : 0E00E44L(6L6L(6(SS(((DFCCEBBBAAAFEC...00i0ii0SShhnnnl222l)))e%%%oololu˚˚%%%0;;;oooIIu5CCeeemmmtl--lwe555uelwueddaaaMM)))unLLLm000cn(((mrrree666rm111tSS///tmmmrtaggg000xxnommma555ntnrrr%%%MMMr((teHHtaaaSSiiietttnnneooodddIIIImHHHMM(((LLiii000222eeeIICCCp))000CCnnnttt.oooOOOmmmtttpp:::::;;;OOO:::aa111iii0EL6(4(SnnnBA000kk0L6(S(NNN.i00)))BAShn2mmm).i0%h%˚n;HHH2VVoI)%eCm%-;o15e5miiidNNaM444)nnn50dLa0)(re6)))--L10aaaS(/r,,,me6g550x1m/5qqqm666g0xmr%005M(...Ha000Sir%tM///nHaoi22(((dt%%%IInBBBoHM(LdDDIi02eH(L)))IiC02;;;e)0CntttItCooo0CCCCoOnmttpoOmt;HHHp555Oa1in;O555a1i0k333Nn)%%%0CCCkmN)HVmNNNHViN4n(((1iN11114n)-a0,50005)-qa6,05q.ttt06/0ooo.2(%0/BD2(111%B)D555;t)ommmC;toCH5iiinnn5H53)))%C,,,53%CN(N1(0112500totmo1i5n1m5min)in, ), 1199 25 35 minEl0uent : CElouleunmt n : S((S(LLLCC14141AAAECFiii.0.0.hhoo1nnn000)))ll˚˚ECDFC;;;oo0ourreeeCCmmmoollHHHlweeooddaaaouunnLLLtnlrrrl222weeeumeuaa///rOOOtngggxxmmmmcamrntccrrr///tta5HHaaaniiio(((ehhnnnnBBBtdddrIIeaatLL)))iiie;;;rreeeIIggm1CCCCnnnee5tttpHHHppdd;;;:::.aa333aa(((:::::CCCkk(SL1BBBAeeS(L41C.ihNNN)))1nA0VVrr)7770i.;hoo0one0m)NN000˚;HossrCedamo%%%H--Loodar2e55nL/2llrO2egxm00a/0Otttgxrm/oooHai(44cr/nBHai(dhDD555InBLd)Iia000;eL)Ii;r1%%%eCCnIg5CCntHpetHp;(((da3000;a(3Ck2Ba(CtttkB5oooNe)V7N)Vr7N444o0N0000%s-%-o5mmm250l0tiii0nnnto4o)))4D5D53000%%((002t5too minColumn : FElouwenrtate : 0 Eluent 5 0: 35 min30 FDleotwecrtaotre : 40min) DCeotluemctnortemp. : Flow rate : Column temp. : 40min) Flow rate : CDFleotlweucmrtaontre : ECDleoutleuenmcttnortemp. : Column temp. : Flow rate : 19 G-7 Detector : CDoerotencatocrharged: aCeororosnoal charged aerosol Detector : EDSeI-tMecSto(rSIM) : ESI-MS (SIM) 19 Column1te8m8p.8:-42C02˚oClu6m-2n t7em7p5. : 40::˚C [email protected] :: www.lifescCieolnumcnet.ecmap. : 4C0˚oClumn temp. : 40˚C CANADIAN LIFE SCIENCE 19

Colonnes HPLC/UHPLC accharide syrup Cyclodextrins Stevioside and rebaudioside A Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (Asahipak) Polymer-based Hydrophilic Interaction Chromatography (HIL ple : Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (Asahipak) Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (Asahipak)ooligosaccharide syrup, 2.5%, 20µL Sample : 250µg/mL each, 20µL Sample : 0.05% each, 20µL 1. α-Cyclodextrin 1. Stevioside uctose 2. γ-Cyclodextrin 2. Rebaudioside A Colonnes HPLC/UHPLC ucose Shodex Asahipak - NH2P 3. β-Cyclodextrin Shodex Asahipak - NH2P-40 crose • 1 Provides higher theoretical plate number than NH2P-50 Kestose saccharides series stose for analysis using HILIC mode • SuitableFructofuranosyl-D-nystose • Polymer-based packing material provides excellent chemical stability and minimum deterioration over extended time 2 period 4 5 • Easily regenerated by wash1 ing in an alkaline solution • Appropriate for edveatpeoctroatri,vaenldigLhCt/s2McaStte3 ring detector, corona c6harged aerosol 10 15 • 2F0 ulfills25USP L82 r0equirem5 ents 10 15 20 0 5 10 15 min min min hodex Asahipak NH2P-50 4E Column : Shodex Asahipak NH2P-50 4E Column : Shodex Asahipak NH2P-50 4E O/CH3CN=30/70 Eluent : H2O/CH3CN=40/60 EFllouwenrtSathe ode::xH1™.20Om/ALC/Hsma3iCnhNi=p2a5/k75NH2P 0mL/min Flow rate : 1.0mL/min ˚C Dimensions FrSuPizcaetrDCote(oiµtlocuemcmlletinog)rteomspa. ::c4Rc0I ˚PChraordiudcet Nsyarmuep ManufacDCtueotlrueemctrnortemp. : 3UI0tV˚eC(2m10nm) Base Functional Pore Size Separation ID x Length (mm) : Material GrSotuepvioside an(Åd)rebaudiosMidoedeA IteCmyclodextrNinusmber peptides 4.6 x 250 Swiam5teurl-tsaSonamleupolebu:les avintNaaHlm2yPs-i5ni0ss4Eof F7630A00s1corbicSaHcNHid2SPaa-m5n0p4dleE:e25r0yµtgh/moLrebacihc, 2a0µcLid Sample : 0.05% each, 20µL 1. Stevioside 4.6 x 150 5 FructooligosaccNhaHr2idPe-5sy0ru4pD, 2.5%, 20µL F7630002 SHNH21P.-α5-0C4yDclodextrin 2. Rebaudioside A e : 20µL 1. Fructose Sample : 20µL 2. Sγ-aCmypclleod: 5eµxgtr/imn L each, 10µL 1 anine 20024µµ.gg6//mmLL x 50 5 2. S1G-ulKucceroossstoeesNe2H2PN-H512340....2GVNVNPiiii-ttcc4aa5oommA0ttiiiinn4nn(GaiBcBBmua61ia2cdriedd) 50µg/mL F7630005 SHNH23P.-21β5..-0CLE4-ryyABctshlocodorrbebxicitcraianccidid ethyl-L-histidine 5 3. 10µg/mL 4. 10µg/mL nserine 554µµ.gg6//mmLL x 10 10µg/mL F6710016 SHNH2P-50G4A dine 5. Nystose arnosine 5µg/mL 5. Folic acid 10µg/mL F6710030 1 ate (derived from L-A3n.s0erine Nxitrate) 10 5 6. 1-FructoNfuHra2nPo-s56y0.l-GVDit-3anmAyisn(tGoCuseard) 10µg/mL F7630006 F6713000 SHNH2P-50G3A 2.0 x 150 52 NH2P4 -50 2D F7630007 POol=yCvinyl alcohol Amino 100 2 HILIC F7630010 O=C 2 2.0 x 10 5 NH2P-50G 2A (Guard6) F7630009 HOC O HHSOOHCCNHO2P-502D 2 HOC 4 5 3.0 x 250 4 14 NH2P-40 3E SHHNCH2P-50G2A 3 HC HCOH 2.0 x 250 43 N3H5 2P-405 2E HOCH SHCNHH22OPH-403E CH2OH SHN1H2P-402E 2.06 x 150 4 1 NH2P-40 2D 6 3 SHNH2P-402D 2 2.0 x 50 4 NH2P-40 2B F7630008 SHNH2P-402B 8.0 x 75 0 Filter5 10 1N5H2P-LF 20 25 F67101000 5 SHNH2P-L1F0 15 20 0 5 10 15 min 10 min min min 10 15 20 25 0 5 min 0 12345 min CCoolulummnn : :SShohdoedxexAsAashaihpiapkaNk HN2HP2-P50-540E4E Column : Shodex Asahipak NH2P-50 4E odex Asahipak NH2P-50 4E Column mM NaH2PO4 aq./CH3CN=40/60 : Shodex Asahipak NH2P-50 4E 0mL/min V (210nm) ElueCntolumn : H2:OS/hCoHd3eCxNA=s3a0h/i7p0ak NH2P-50 4E EElulueenntt : :20Hm2OM/CNHaH3C2PNO=440+/630mM H3PO4 aq. Eluent : H2O/CH3CN=25/75 ˚C FlowElruaetent : 1.0: m40Lm/mMinH3PO4 aq./CH3CN=45/55 Flow rate :/C1H.03mCLN/=m2i0n/80 Flow rate : 1.0mL/min DeteFclotowr rate : RI: 1.0mL/min FDloewtercattoer ColuDmentetcetmorp. : 25:˚CUV (254nm) : :1.R0ImL/min Detector : UV (210nm) DCeotelucmtonr temp.: :U4V0(˚2C54nm) Column temp. : 40˚C Column temp. : 30˚C Column temp. : 30˚C Fructooligosaccharide syrup LdCeLaCr/CciTyvi/dOcaTltOFdoi-zeFdMer-eMidSvxatsSartuniianzganesaladywSrlsiycsamisushtieguasoarilofn-trsaf2scon2-hlae-uaamobimnuilnessinoavobintbeaaenlmynzsioznioiscsicoafcSidtevioside Ascorbic acid and erythorbic acid of sacchaFrriduectaonoalilgysoissaucImscihindagarzidoelesdyripuepptides andAsrceobrabuidcioacsideanAd erythorbic acid ged aerosol detector appcAomaocmrloytoipmucroonleenntsrae-o.bnfcTtaihhsnsautereesgd,rlueftetdhaeremidanebignfraroocossoeSF321mocm...lraiulnoFGSmcptderluhltuupuoeocecilmctnseroteooeolnc:icsssgsnoeeitoegotelssunrlamiifmmfcricncoeihan.maanasTrtttiulhdehyreeseeassS25341cfNiyfn.....aoeerHLβH1Lsmulfcu----2fpitlpgsACMAmuPe,tlnnlaeied2eadnsri.tnsfn:i5.ehbniiteo2nc%ryTseyirs0elnah-ii,µeaaLnni2Lsssl-etlh0iµsLtidine 200µg/mL Sample : 250µ2g/mL each, 20µHS2L231S4Aau....amAmVNVNm-paiiliittapcclnaaeboolmmeIe:ttgiil2ii:nnGennµ2aidcBBL(0m1Naµ61µi2-cdLgGiedplyrcoa1511ten0000inµµµµ)gggg////mmmmLLLL Sample : 0.05% each, 20SµaLmple : 5µg/mL each, 10µL 2µg/mL 2 1. Erythorbic acid 5µg/mL 1. α-Cyclodextrin 1. Stevioside 2. L-Ascorbic acid 5µg/mL 2. γ-Cyclodextrin 2. Rebaudioside A 5µg/mL 3. β-Cyclodextrin results in providing stab4l.e1-aKnedstlooswe noise bas6e. lNinitera. te (derived from L-Anserine Nitrate) 3 * 25A. AFo:li2c-Aamcidinobenzo1i0cµagc/imd L 1 5. Nystose 2 6. Vitamin C 10µg/mL 1 O=C Silica-based amide colum6n. 1-FructSoafumrapnleo:s4y0l-µDg-/nmy1Lsteoasceh, 5µL 4 HOC O 2 (4.6mm I.D. x 150mm) HOC 2 1. Fructose 1 O=C 2. Glucose 2 2 HC 4 6 HOC 1 45 1 5 6 HCOH HOC O 2 3 CH2OH HC (S4i.li6cma-mbaI.sDe.dxa2m5i0nmo mco)lu4mn 3 5 HOCH 1 5 1 CH2OH 3 10 6 2 (N41H.62mPm-50I.D4E. x 250mm) 23 6 Migration time (min) 15 5 20 10 0 15 m5in 10 0 15 5 20 10 25 15 EClou20leunm0t n 25 : S(Ah5);o9d5e%x AC0sHa3hC1ip0Na/k0.N11%H2FPo-r41m05ic22Dacid aqm.2i0n3 40 5 50 10 5 15 10 min Shodex Asahipak NH2P-50 4E min min : min min 21SSHC00.ii2o0ll˚˚iiOrCCmcco/aanLC((NSabb/HmiHaalci3cssi2hCnaeePaNddr-bg=5aaae02smmd0e4/iidaEdn8CECDFe,oe0arllSeoomoucctillwesoloueiuidocnlmlcmuuerlattammnoncbtreonntaelsuffmerrmoodpnmm.a):::::mooHSR12ittnh.5hhI20oe˚eOoCmrrcd/LmComeECFDC/lHxuamalleoooumnn3AtillweCnuuueunsnffmcN)maaartta=chcnonttt3iretpuu0erra/mee7krrp0N. H::::: S541U200.PhV0m˚-oCm(5d2M0L1e/04xNmnEaAimnHs)a2PhOip4akaqN./HCCFD2HleooP3tlwue-C5mcECFCDrN0tallnoeooou=t4rtellwet4ueuEen0mcmmrt/ta6nopnt0re.te::: mE40L(B.5iSpn2)˚;I.Cem-5a:::::TL%rOSH1R4/gm.0FhI20rC˚OoaCimMnHdFDCCEd/LCS3illeeooeouC/Hxtnlm(lweuePuNt3nAmc;imo/Cnrtt(0salBnoaNn.at1rr%et=ih%tey4i)mp03:DFFap/0Nao6ka.%cert0:::::amNuglU14S4(apHti0cy.00trhV-0i2o˚mvoa2oCmPve(fc.d2iM5,-dPiL5dem5Feh/4x0Hmduaainnlqr3A4lbim)mnP,.MEysa3)OaMSc0h4y-irci,9aaphK5qnai%hig.nk/ierkCoNi(:2HUKH2.35ni0n2Ci-v0o2PNe0s0-ECFDCrh=m5s)lleooioui40ttitallywen5ueu4n)P/mcm5Erthta5no.ntDret.e, mp. Column : Shodex Asahipak NH2P-50 4E 30mM H3PO4 : ShodeExluAenstahipak N:H220Pm-5M0 N4aEH2PO4 + aq. : : H2O/CH3CN=25/75 /CH3CN=20/80 : 1.0mLF/lmowin rate : 1.0mL/min : UV (21D0entemc)tor : UV (254nm) 30˚C Column temp. : 30˚C Imidazole dipecCpootrmiodnpeaasrcishoanrgoefdsaaecrcohsaorliddewSeitaametnecuatrll-toysarsonilseuoubuslesinavgintaalmysiniss of dLCer/iTvAOastFci-zoMerbdSicsauangcaaildyrscaisnhdaoifne2rsy-tahmoirnboicbaecnidzoic acid G-8 1 888-226-2775Sample : 20CµL ANADIANA corona charged aerosol detector measSuarmespleef:fl2u0eµnLts as :: [email protected]:or:5rb:bµi2cigc/amacwciLdidewacwh, 1.l0iµfLSHeausmmcpailneeI:gn2GµcL(e1µ.gcparotein) 1. β1--MAleatnhinyelL-L-IhFistEidinSe 2C002IµµEgg//mmNLLCEcpoamrtipcolense. nTthsues,luttheedbfarosemlinteheis significant1ly. VaitfafemcinteBd6 by al5l 0µg/mL 2. column. T2h.eNicNoHtin2aPmisdeeries10µg/mL

HPLC/UHPLC Columns Ligand Exchange Chromatography Columns Shodex™ SUGAR - SC1011 | SC1821 | SP0810 | KS-801 to 802 Shodex™ SUGAR - DC-613 | SZ5532 | SC1211 HPLC/UHPLC Columns • Separates saccharides by combination of ligand exchange • Separates elements by combination of ligand exchange and size exclusion modes and HILIC modes • Three types of counter ions are available: Ca2+, Pb2+ and Na+ • DC-613 can analyze sugars without removing sodium salts • Only water is required for the analysis of neutral sugars Shodex™ SUGAR - SC1011-7F in the sample • Fulfills mannitol analysis requirements of JP, USP, • SZ5532 is recommended for the separation of disaccharides and EP methods or trisaccharides • Ca2+ modified ligand exchange chromatography column • SC1211 is suitable for separating sugar alcohols • Only water is required for the analysis of neutral sugars • DC-613 fulfills USP L22 and L58 requirements • Fulfills USP L19 and L22 requirements • SZ5532 fulfills USP L22 requirements Shodex™ SUGAR - KS-803 to 805 • SC1211 fulfills USP L19 and L22 requirements • Suitable for separation of polysaccharides by size exclusion mode • Can be used in combination with other columns e.g., KS-802 and KS-801 • Only water is required for the analysis of neutral sugars • Fulfills USP L22 and L58 requirements Shodex™ SUGAR Series Ligand exchange and Size Exclusion Dimensions Particle Product Manufacturer Item Base Functional Exclusion USP Size (µm) Name Item Number Material Group Limit ID x Length (mm) EP, JP, 6 SUGAR SC1011 F6378102 SHSC1011 Styrene divinylbenzene Sulfo (Ca²) (Pullulan) L19 & L22 8.0 x 300 6 SUGAR SC1011 8C F6378102A SHSC10118C Styrene divinylbenzene Sulfo (Pb²) 8.0 x 100 8 SUGAR EP SC1011-7F F6379300 SHSC1011-7F Styrene divinylbenzene Sulfo (Na) 1,000 L22 & L34 7.8 x 300 6 F6378103 SHSC1821 1000 8.0 x 300 10 SUGAR SC1821 F6700090 1,000 L22 & L58 6.0 x 50 7 SUGAR SC-LG (Guard) F6378105 SHSC-LG 10,000 8.0 x 300 6 F6378101A SHSP0810 N.A. USP 8.0 x 100 10 SUGAR SP0810 F6700081 SHSP08108C 1,000 6.0 x 50 6 SUGAR SP0810 8C F6378010 SHSP-G 1000 L22 & L58 8.0 x 300 6 SUGAR SP-G (Guard) F6378020 SHKS-801 N.A. L22 8.0 x 300 6 F6378025 SHKS-802 1,000 8.0 x 300 7 SUGAR KS-801 F6378035 SHKS-803 10,000 L19 & L22 8.0 x 300 17 SUGAR KS-802 F6378050 SHKS-804 50,000 EP & JP 8.0 x 300 17 SUGAR KS-803 F6378060 SHKS-805 400,000 8.0 x 300 10 SUGAR KS-804 F6700020 SHKS-806 5,000,000 6.0 x 50 SUGAR KS-805 SHKS-G 50,000,000 SUGAR KS-806 N.A. SUGAR KS-G (Guard) Exclusion Shodex™ SUGAR Series Ligand exchange and HILIC Limit Dimensions Particle Product Manufacturer Item Base Functional (Pullulan) Size (µm) Name Item Number Material Group ID x Length (mm) 100 6 RSpak DC-613 F7001003 SHDC-613 Styrene divinylbenzene Sulfo (Na) 6.0 x 150 10 RSpak DC-G F6700170 SHDC-G Styrene divinylbenzene Sulfo (Zn²) N.A. 4.6 x 10 6 SUGAR SZ5532 F7001300 SHSZ5532 Styrene divinylbenzene Sulfo (Ca²) 6.0 x 150 6 SUGAR SZ-G (Guard) F6700110 SHSZ-G Styrene divinylbenzene Sulfo (Ca²) 50 4.6 x 10 6 SUGAR SC1211 F7001400 SHSC1211 N.A. 6.0 x 250 10 SC-G (Guard) F6700120 SHSC-G N.A. 4.6 x 10 8 USPpak MN-431 F6379230 SHMN-431 4.0 x 250 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN G-9 LIFE SCIENCE

CFoolromnannneitsolHanPaLlyCs/isUfoHlloPwLiCng JP, USP, and EP methods Product Code Product Name Functional Group Particle Size Column Size (mm) Shipping Solvent Ligand Exchange Chromatography Columns (Counter Ion) (µm) I.D. x Length FE63l7u9t3i0o0 n volumESUPGeSACsR10oS1Cf1--7GsFa6BccharidesSualfno (aCal2y+z) ed by Shod8 ex column7s.8 (×p30a0rtial list onHly2O) (SUGAR SC-LG) Colonnes HPLC/UHPLC F6700090 Sulfo (Ca2+) 10 6.0 × 50 H2O (guard column) Sulfo (Ca2+) Elution Volume (mL) SC1011 8 4.0 × 250 NH2P-50H42EO F6379S2u3b0 stances USPpak MN-431 KS-801 SZ5532 SC1211 8.21 Base M5.a1t1erial: Styrene divinylbe6n.1z8ene copolymer 5.56 SP0810 8.16 *See page 79 foArrUabSinPo4s0e-NF35 Column Lis1t.0.42 11.28 8.91 6.27 5.90 PreparaDt-Airvabeitocl olumns *Pr1e5.8p6arative columns11.a33re made to orde7r..63 7.27 6.29 4.96 4.98 [ Ligand excDhualcintogl e and size ex2c0.l1u8 sion ] 12.76 7.40 9.46 7.45 * 4.76 meso-Erythritol 12.70 Plat1e0.N09umber Par7t.i8c6le Size Colum5.7n3Size (mm) 5.43 7.87 Product CDo(-d)-eFructose Product N1a1m.05e (TP8/c.8o5lumn) 7.(7µ1m) I.D5..3x7Length Sta6n.7d5ard Column * 204..500 × 300 * F65020D0(7+)-Fucose SUGAR KS-120.04801 ≥87.8,4000 8.0193 5.4K3S-801 * 206..406 × 300 * F65020D0(+8)-Galactose SUGAR KS-92.70402 ≥77.9,8000 7.5183 8.1K0S-802 6.77 4.07 F65020G0e9ntiobiose SUGAR KS-72.20203 ≥68.0,8000 5.7153 2100..050× 300 16.K36S-803 4.65 6.77 F6502010Glucose SUGAR KS-82.60304 ≥76.3,0000 7.1178 205..807 × 300 8.6K1S-804 * * F65020m11yo-Inositol SUGAR KS-122.07705 ≥86.8,6000 7.9198 2102..063× 300 9.9K6S-805 9.03 5.01 F650201Is2omaltose SUGAR KS-72.60806 ≥66.2,6000 5.9158 2100..057× 300 15.K18S-806 4.23 Isomaltotriose SUGAR KS-7G.098B 5.75 5.34 281..017× 50 27.55 * (SUGAR KS6-.L7G9 ) (guard column) 13.09 (guard column) 2peaks F6700002 5.75 13 20.11 3.99 1-Kestose 5.26 * * [ Ligand excKhojiabinosgee and HILIC ] 7.56 6.21 5.88 9.65 14.82 4.43 8.64 Lactitol 13.27 Plate8.0N9umber Par6t.i1c3le Size Colu1m6.n35Size (mm) 11.82 11.88 Product CoLdaectose Product N8a.m05e (TP6/c.5o1lumn) 5.(9µ9m) I.D10..x12Length Sta1n3.d2a7rd Column 4.92 6.1190 209..106 × 300 * F651401L3actulose RSpak DC-29.01133 ≥6.69,9000 10.D72C-613 * 6.0130 81.30.04× 50 8.51 F6700402Maltitol RSpak DC-1G2.283B (guar8d.2c6olumn) 5.94 8.67 (g1u1a.8r2d column) * Maltose (RSpak DC-LG) 6.34 14.24 4.78 10.16 7.85 * 4.48 Maltotriose 7.48 5.89 5.38 13.79 24.96 5.07 8.75 7.39 ElutiMoannnitvool lumes of sa15c.8c0 harides anal1y1z.10ed by Shodex7c.23olumns 5.83 7.84 [PartDia-Mlalninsotseonly; refer to o1u0.r72website for comp8.l1e7te list] 7.64 Melibiose 8E.l1u6tion Volume (mL) 6.45 5.98 11E.l6u9tion Volume (mL) 14.70 SubsNtaynsctoesse SP0810 SC1011 6.K38S-801 SZ5532 NH24PE-505.4S5C1211 Substa4n.c9e3s SP0810 SC101120.K0S5 -801 SZ5532 NH24PE-5301.9S0C1211 10.42 8.91 2pea8ks.21 5.11 6.182peaks5.56 10.72 8.172peak7s.64 5.83 7.8412.73 5.01 ArabinoPsaelatinit 15.86 7.27 6.29 6.458.16 D-Manno5s.9e0 8.16 14.7012.12 4.23 D-AraPbaitloaltinose 11.33 7.874.63 Melibiose5.89 6.45 8.085.98 11.69 DulcitolPanose 20.18 12.76 7.147.40 9.46 7.45 5.7811.28 Nystose 5.32 6.38 5.45 16.874.93 20.05 31.9025.60 * 2peaks 2peaks16.365.90 2peaks mesDo(-+E)r-yRtahfrfiitnoolse 12.70 10.09 7.147.86 5.73 5.43 5.78 6.27 Palatinit 5.29 12.7320.225peaks 11.05 8.85 7.71 5.37 6.75 5.90 Palatinos7e.37 7.84 6.45 5.89 8.08 12.12 3.99 D(-)-FRruhcatmosneose 10.48 8.84 9.778.09 4.50 5.43 8.23 4.96 Panose 7.14 5.78 3.935.32 16.87 25.605.52 * D(+)-Fucose 7.98 19.375.58 6.46 8.1013.664.98 D(+)-Raff9in.0o4se 7.14 5.78 4.825.29 16.36 D(+)-GDa(-l)a-cRtiobsoese 9.74 10.50 Rhamnos7e.42 9.77 20.255.45 * 6.08 21.651.75 16.3613.31 * 8.23 9.797.37 3.93 GentiDo(b-)i-oSsoerbitol 7.22 D(-)-Ribo7s.3e8 5.527.09 4.43 D(-)-Sorb4i.t9o7l GlucosSeorbose 8.63 7.30 9.677.17 5.87 8.61 8.03 4.76 Sorbose 19.35 13.66 5.129.04 4.82 5.457.35 8.64 12.77 8.86 6.827.99 12.63 Stachyos5e.87 21.61 13.31 — 7.42 myo-InSotascithoylose 6.26 5.95 10.57 9.96 5.57 7.87 Sucrose 8.76 8.03 7.38 9.79 7.0936.2211.88 Isomaltose 7.68 5.75 7.545.34 21.17 15.18 * α-D-Talo5s.e78 9.67 5.57 7.914.97 5.12 7.35 4.92 IsomaltSoutcriroossee 7.09 13.09 27.55 6.29 * 6.82 — 36.2211.87 * 1-Kesato-Ds-eTalose 6.79 5.75 21.353.26 Trehalos6e.10 7.54 6.29 5.695.87 20.1112.59 * Trehalulo7s.9e4 21.33 7.91 11.876.47 * Xylitol 7.62 KojibioTsreehalose 7.56 6.21 7.625.88 9.65 14.82 6.27 * Xylobios6e.40 8.92 12.59 10.858.76 5.69 6.4713.25 8.51 D(+)-Xylo7s.7e1 19.87 LactitTorel halulose 13.27 8.09 8.926.13 16.35 11.82 6.95 6.67 8.16 6.27 9.545.78 10.85 13.2511.68 * LactoseXylitol 8.05 6.51 5.99 10.12 13.27 4.07 D-Xylulo8s.e04 9.21 6.95 6.10 9.54 Lactulose 9.13 10.64 7.77 11.68 6.10 4.78 MaltitoXlylobiose 19.87 9.16 13.14 7.77 5.65 MaltoDs(e+)-Xylose 12.23 6.99 6.19 13.04 10.72 4.65 13.14 7.94 4.55 6.10 10.16 7.85 8.26 8.166.03 11.82 6.68 6.77 6.68 5.656.40 8.67 9.059.05 * 6.34 9.215.94 14.24 7.90 * 7.90 4.557.71 6.586.58 4.48 MaltoDtr-iXoysleulose 7.48 5.89 10.654.38 13.79 24.96 9.02 * 9.02 4.068.04 4.06 5.415.41 5.07 (—M) aNnontitodletected (*1)5O.8v0erla1p1w.10ith so7lv.2e3nt pea8k.75 7.39 9.03 (—) Not detected (*) Overlap with solvent peak (—) Not detected (*) Overlap with solvent peak Column : SUGAR SP0810, Column : SUGAR SC1211 Column : SUGAR SZ5532 Column : Asahipak NH2P-50 4E Eluent : H2O/CH3CN=65/35 Eluent : H2O/CH3CN=25/75 Eluent : H2O/CH3CN=25/75 SC1011, KS-801 Eluent : H2O Flow rate : 1.0mL/min Flow rate : 1.0mL/min Flow rate : 1.0mL/min Flow rate : 1.0mL/min Detector : RI Detector : RI Detector : RI Detector : RI Column temp. : 70˚C Column temp. : 60˚C Column temp. : 30˚C Column temp. : 80˚C G-10 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

10 20 minCo0lum1n0 520 m:inSh0ode1x0 S2U100GmAinR SC1011 15 20 Column Elution volume (mL) min Column : Shodex SUGAR SZ5532 lumns m1i1n DCFElleooutlweuenmcrttanotretemFDECplleoou.tlwe::::eunc80R1mrtt0.0aIo6n˚mtCmreML/CmainS:::: OR0HS.4hI26OoamdqLe./xmSinUGAR min : Shodex SUGAR SZ5532 2x SP0810 CDECleooutlleEFDCueunlmlceomoutttlwenouennrmctrtetanomtretpeCFDCE.mlleooou::::ptllweR8SHueu.n0mchIm2::::rt˚tOoaCnoH60Rntdr0.eI2t6ee˚OCmxm/LCSp/HU.m:::::3GiCn18RSHA.0NhI20R˚Oo=CmdK2Le0S//xm-88S0in0U0GsAeRrieSsP0810 Eluent : H2O/CH3CN=25/75 2 Flow rate : 1.0mL/min HPLC/UHPLC Columns Detector : RI Column temp. : 60˚C Column temp. : 85˚C Sucrose and turanose Maltose and isomaltose Ligand Exchange Chromatography Columns Ligand Exchange Chromatography Columns Acesulfame K and sucralose A32514S6cS......aGSSFAUmearucunlupus316245Secckcclc......srernatuaoouBGSFSUAcomo:lsslor5213S64sucuwnfll2eeuphuaies......eccfak0nclcmoeGCMXAGserrmnaµtoaoufOyoroeealLr:malpssuamlloosrwllfon2eelablKcaeoseml425S31isn0ncoimebinade.....aoµe:tsgfiAooRSPVSemLos5re00000seossceeutisaµ.....oKnpaeem11555KerecsfLsibcfl%%%%%stersionhoauA00000l:oyssaslacf100101.....oc0esa15155eu......coes.nm550550%%%%%s1es11u%%%%%%g%cedeAlf2Kaha3S45126ecm2......saa1ra1SUGSAFmceesu3r3cuuhrnl2upKusecc,kigccl4cserr2ndtuooauo0roa:lss1loe3µsw2fla2ee5aresL5f20nmselaµoaf36e4Lr3moislKmn5c4eeAo4700000sc5.....h651155Keo8%%%%%s6ouyl5alfbasnmeeda2K9nsS1u30534826917a..........cmSSMGFGXXAARprryyorrhlaauulaaualleralioncbba5cbtmocsn:tlcoiiionttelio0tnosotrsooo.eolle5sKossls%eeees13S42e....aeePTSFtmaarosocuprSgirahcclbS35214haae,otao.....ntao2so:f1esmGGSRms0ecs0dfeeuaµaayex.pic0cf2Lllofaalnero2i-tnccoh1I5n:oottuss%ioo0naess2sree.so1ereilate%saoiS25143Scndl.....ahebGFSLTmoue,aaurulc1upiuc1r32S1543csscho0calct.....erao,ntµooeSrSTGLFomss2:oLssr42aruosuel00seeupauyecer3ceµ.calcst5erncLo532S41tnloo%oea.....s:oass4ctseGSTmF30smee1etehera.uhly5aupaueuc2o%ecclcraern-dtihoon1Ios5n:,ssreeds3o0ee1aiiet2.s0csd1oiµhtt%4o5Le,4ul1esr0aµac5La32514Shn.....a,nTSGFLm2oauru0ldupucr3csµcalcterLotnooeots:oss4sMae10seeee.u5a%rl2ietnaocehs5, e110µ3aLn12d isomaltose MS45312.....aMGMIImssaoolaapu4315S2lmmllcltte.....taoooaaMIMIGmots:sssllrtteool0eiaaoopuosmm.llstcl5ttserooeeoei%aaots:s1llrttse0eioooeea.st5sareein%cohsd,ee2a0ciµhsL, o20mµL1S23a...aMIGmsloltapumloclteooass:slte0eoe.s5e% each, 5 4. Maltotriose Biomass sugars Saccharides related to raffinose biosynthesis Maltose and isomaltoseh 20µL LigHanPdLECxc/hUanHgePCLhCromCaotolguramphny sColumns 1% 4 5. Isomaltotriose 4 4 23 5 4 3 5 23 5 6 10 41 406 5 0 5 10 15 20 10 15 20 25 30 35 0 5 10 15 20 min min min m02iDFCECn0lleoooutllweueunmFDCECcmrttllaeooounonttllw5ereueutCDFECneECFDCmcm0llreotomoullteoaoounotllnwe5tutleulwpe1rueeuFDCECntmc0nm.emcrmtlletooroatu:::::mtnoantnolltwenu80R1Seruteptrnem.00ctehmI6.rett˚mmaoCmno:::::mntdMrpe8R0S1tLpee.0.0hI/.6xmCm:::::˚m1oC:::::1m0R08HSaSp0d1iMHSR16nLS.55hUI.e2.56h0I2/0˚OOo:::::xCC˚mmGDFECOoCm5dR80HS4llaSdeAo/oiLune5.LChIS2tae6Ul/weRe˚xu/OmoqCHOxmnmGcmd.rSSt3i4tSLaniAeoCnUCn/tUaRxremNG1q1GS052=i.SAnA01U2C1R51R05G1/S0A8S::::P10ZR0R1S105.0hI68K5mo1m1S30dm0M2L-2ei8/n02xCm0512aS0inSU+mO2GiKn04ASaR-q8.S00mC13ECFDCi11n0lleooo0u51tll1we5ueu1nmCEFDCcmrm5t0tllaeooounoDCFECnittnllwerlelueeuootounemctlmlweruetumtannomcmntrtpFCDCE1rtmea0tno0l.l2neeootouirn0e:::::mttllweueeuSH06Rnmpcmm.0rhtI2t6.a5˚nopOonCm:::::t1r.ed/t5SHR06LeC:::::e0.hI/2m61R8SHHxm˚OoCm.0hpI230Sdi/˚OCno.CLCm0Ue:::::d/N2HxmLGCEFD0e18RSH=/3llSeAox.0oiumhI22Cn01tU˚lweORo0CeSmu0iNnGd/cmUr8S5=LtteaAoG02/2Znxtm55Rre05AS/i5Rn08SFCDCEU30Zlleooo2SuG15tllwe0PueuA35n::::mc00mR31rttSH0R8a52non.1tShI2r6et0OoCem1dmm/15LC3e0i5np/Hx1m.13S:::::iCnU07RSHN2m.0hGI22065=i˚Oo0nCmA12d/0R0LCe//mHx8Sm02i3ZSn0i5CnCECDF5UN5lleooouG3=tllweueAu26nmECFDCcmR0rt3tllaeoooun/o0n4tStllwereueut0Cnemcm51rtm1ta0non2tmpre1t3.ien51:::::mSH16Rp.0hI20.˚OoCm:::::1d/0SH1R6LCe.0hI/20Hxm˚OoCm3Sdi/CnLCUe0/NHxmGCEFD1=3ll5SeAooiu2Cn1tUlweR55euNnG/cmr7S=ttaAo52ZntRre55/557S35Z25205::::3mSH1R2.hiI20n2Oom10d/0LCem/Hxmin3SiCnUNG=A21R55/7S5Z553220 min Saccharides anCdolusmungteamrp.a: l8c0o˚Chols ColumSn atemcpc.h: a60r˚Cides and taurine Column temp. : 60˚C SaMcociOhSsalatiurgcircodihszeaiasnrcigadcnehcdsaormaSsinuadpdcgeocassnhruieanganraltsicrdsooaeyhlsbc1ooealshanondlssugaSarmaplelc: 0oSr.5aha%focfeliacsnchho,a2s0reµiLdbeisosryeSnlaaMtcthaecMendhsSanaaitmsnirotpinoldeil:et0oas.1ln%aadennascddho,Sts2ra0oabµurLcibtrcoiihntloaelrides and taurine 1. Rhamnose Par1ti.aSl umcorodsiefications on the a1nalytical Sample : 25mg/mL each, 20µL 32S451.....aS15243P1EGmm.....a,trl3ePRSVSphmyos-cyeluitpaenPpaolercfyeibcflr-tr:erlinoEoeinhoan0epnl:royss.ya1eoc0esgtn%oes.hlg1yeesrl%cidyeteoociaolloecllahc,h2,02µ0LµL 21S0561238974a..........m3SMXGAFAGRXpr1yyorrhalaulaaull043298765eralioncbbacbt.........mosn:tcoiiiSGAFXGAXMontteli40tnosotryysooorralo.aeuolaaullle5ssrliolncsbbacbt%eeosnetcoiiionttelitosotsooeoelle5ssa5S4231l eec.....ahmSGGRm,uaaayp2cfllofaal0eri-nccoµIn:ottsLioo0nesse.so1eilt%oSl 781239465ea.........amXAAFXRGMGcprhyyrrhlaaulaaull,ealoincbabct2mosn:tcoii0onteli0tnsotµosoo.eolLe5ssls%eee1143S25e.....arcasUrfUDUUa2uGSFmTeemeoncSSSnearlsuqlpyfhndupuicu2354PPPocitou,claldc3ree....ler,,l3-e2itsooruiJnGTFmIdomEta7En0:sssteaiarslt-Potioµ0yeeutuubouehp4iSNo,L.sonccrr1enea-iotaitFosntn%Ioaroonnnpsm3ecstloooeed5ee21oeosffsuass)aniJretsmtmnceodPb,Pehl.aiaetPP,th2hninc2hohaa0anna0anar1nimiµmtrst4rcoLomm2.eaollr.aca0le1Nsauecoc.qtnmofoapoS325S41ufdwtpe.....epniaCerSFTmGcemiseed1aartuifoldiyhuap0uioaucvoric(al1cnrrerbeU-f(it1oovnEIro(2in:S-JsstotitesPonh7hoo0eePmPegnF.ees)l1,,,)it3%ol each,120µL 1. Mannitol 4 2. Sorbitol 41 3 5 2 5 5 4 12 5 4 34 5 12 4 2 35 1 2 10. Sorbitol 2 8 36 45 3 1 79 Resolution ≥ 4.9 2 68 3 10 (Mannitol/Sorbitol) 79 10 6 7 8 9 10 20 10 0 15 5 20 25 10 30 15 min 50 10 min5 10 15 20 min min 0 3250 mminin ECDCF0lleooouECFDC0FDCECtllwellueeouooullenoooumctlmlweurettullwetuaenunomCECDFcmnntrmctmtrlleraeototounotanentotllnwereuteumtrenetmcmertpmtamno.ntpre:::::pt.eSH40R.:::::m.0:::::hI26HSR16˚pO0R8HSoCm.5hI20.5dhI2/˚6OoCLmC:::::˚5OoeCmd//HSR16HxdLmCeL.5hIe/230SHxi/m˚OCnoxCmmU35SdiN/SCniLGCUne=U/NHAxmGCEFD60G=R3ll0SeAooiu2CnA/tUlweR04SeuNRnG/0cCmr8S=ttaKA1o02ZntS2Rre051-/518S813000Z2255+::::3HS1RK2.hI2S0Oom-5d8/LC0e1/m1Hxm0i3nSiCnUNG=1A52R0m/8Sin0ZFCDEC5ll5eooou13tl0lweueu2nmcmrttanontretemmp1i.5n::::: 0 C0olumn 5 5 : Sho10dex SUG1A5R10SC122101 2515 30 15 18RSH.0hI20˚OoCmd1Le5/xmmSininUGFDCECAlleooouRCFDECtllweueluleooounSmDCFEcmtllwretuetuCllaeoounonmncmttl1rwetreuetat0nonenmctr1rtemttano1etprmet.ep:::::m.0R7SHp:::::.0hI26.08RSH˚OoCm::::.5hI2d5/0R7H˚OLoCCme.0I/2d6Hxm˚LOCme3/Si/xmCnLCUE/NiH0mnGFDCEP=3lleAooiu6CnStlweR0euNCn/cmr4S=t1tao06Cn0tre011/124-1071F : 5 10 20 min : : Shodex SUGAR SC1211 29 : H2O/CH3CN=60/40 0.6mL/min RI MoMisotuisrtiuzrinizgincgocmompopCnooleunmnentntsetmsp. : 65˚C Mannitol and sorbCitoolulmn temp. : 70˚C Moisturizing components 1 Mannitol and sorbitol soliWfDdlaepsihhadalcssaoerytserexidoltlgraaeucwstiiaodnkned,snsaeyllreooicnttgwmioeonfir?oletfe. rs,PUUUDacUrrfsueeeonaSSSnelsqpfndricPPPoittuladieel,,lDaUrUPUUscfr3aesruiJueedmEtea7olnEasSSSnetailsqmt-PoptifndrtubicohPPPpioiSNttu,onladrieeoelne,,la3aoteastFsrnuiJdmdarEotan7lEnpsm3taictimt-Pootioetufdebe21ohpioSNio,fonfsucrass)oenenaJotartFesnasmtmndareodnPb,npm3tPectioi.oeaiaefdete2P1Potoh2iohfnfsiunccass)nhohaan0Jraenanasmtmnseanard1Pb,nitPemimtrst4ri.oaicaetPPooomthm22h.ennianocnlholhraa0.aancnaa0lesNtsanaaru1necMhiomic.qmttrstn4romocfoeaopomoSmu2fd.enaowtpellepnri.CaarUaUrUDPcsearca0leceNeetsiasueneonade1choSSnec.qntstifqondampiohndra0fioeoaicpaoSPPuovfttudrilaw(and1tpyenieree,bpneiUCla3afe(e1rruviJtcEdrem(iasietnea7liEid1Sas-JtotittaictifPonotmh7h-odaitihsa0tuPiobmPoaapiSNvognFrilee)lo(a1krynr,,,o)enlbeUafot(tF1snvtErldar(oiniFpyS-Jtmo3titctPionh7hoooefPee2o1omaPaiognFee)flfsucass),,,)lurrneasmtmneb,trPemdiaaetPPoh21hSnncnhhaao0ananassaar1nrimimltrt4rooceeoomm21.enaollsr21S.aica0l2Nts..aunabechoRc.tSMmnmofofeapoSieofdowaptpetepn1S2Carenplb2creoi..esanedn1aimtMSifrmotaihia0:ioloatevorilo2(aa1plynrbeUra(ls5n1vlbtE(eiimnSt-JettiticPonth7hoii:PoPtangognFee)ol2l,,,)l/tl5nmamLtpgie/lvameecLah1,tes2oae0cdµhL,a2S12y2..a0.MSmµoLaprnlbeniti:oto2l l5mg/mL each, 20µL 1S.a1m,3p-lePr:o0p.a1n%edeiaocl hM, 2o0µiLsturizin1 g components Samp2l.eP:r0o.p1y%leneeacghly, c2o0lµL 1. 1,33-.PErothpyalnenedeiogllycol 1 2. Pro4p. yGlelynceegrilnycol Sample : 0.1% each, 20µL 3. GEtlhy5cy.leemrnineesgol-yEcroylthritol 1. 1,3-Propanediol 4. 2. Propylene glycol 5. meso-Erythritol 3. Ethylene glycol 4. Glycerin 4 5. meso-Erythritol 4 23 5 4 fulfills the conditions required from 23 5 23 (ManRneistooll/UuStSoiorPnb,itEoPl), and≥ 4J.P9. NEXT DAY DELIVERY!5 Resolution ≥ 4.9 (Mannitol/Sorbitol) Resolution ≥ 4.9 (Mannitol/Sorbitol) 0 5 10 15 20 25 30 35 min 0 5 10 15 min 0 Column5 : S1h0odex EP15SC10112-70F 25 30 35 min 0 Column : Shode5x SUGAR SC1211 10 15 29FDCElleooutlweeunDFCEcmrttllaeoouonttlwereuemnmc1rit5ntanotrete::::m0RSHp.hI25.Oom:::: d0R8HLe.5I/25xm˚OCmEinLP/mCESloiCun0le1un0mt1n1-7F 5 min ECDFlleooutlweeunEFDCcmrttllaeoouonttlwereuenmcrttanotrete::::mHSR0p.hI26.Oom:::: d/HR04LCe.0I/26Hxm˚OCm3Si/CnLCU/NHmGCE0=3lAoiu6CnleR0uNn/m4S=t 06Cn01/24101 10 10 15 20 25 30 35 min 5 : Shodex EP SC1011-7F : H2O : Shodex SUGAR SC1211 : H2O/CH3CN=60/40 Flow rate : 0.5mL/min Flow rate : 0.6mL/min Column temp. : 40˚C Column temp. : 85˚C Detector : RI 1 888-2CD2eo6tlue-mc2tno7rt7em5p. : 4R::0I ˚C [email protected] :: www.lifescience.ca Column temp. : 85˚C CANADIAN29 G-11 : 29 LIFE SCIENCE

Colonnes HPLC/UHPLC Ion Exclusion Chromatography Columns Colonnes HPLC/UHPLC SH1011 | SH1821 KC-811 • Columns for simultaneous analysis of saccharides and • Columns suitable for the analysis of organic acids organic acids • Separates compounds by ion exclusion mode and reversed • Separates neutral sugars in size exclusion mode and organic phase mode acids in ion exclusion mode • Highly selective when used with post column method • KC-811 6E is suitable for the analysis of cyanide ions and • Suitable for the analysis of uronic and aldonic acids • Fulfills USP L17 and L22 requirements cyanogen chloride in accordance with the Japanese Water Supply Act • Fulfills USP L17 and L22 requirements Cello Maltooligosaccharides, 05 organic acids and ethanol Colu Elue Shodex™ SUGAR Series Ion Exclusion Sample : 0.05% each, 20µL Flow Dete Dimensions Particle Product Manufacturer Item Base FuGnrcot43251iu.....oMMLGMpnalaaaucalllcttttoooiolctstseraeeitocrsaideose(EPxuLclillmuusliiatonn) USP Colu Size (µm) Name Item Number Material ID x Length (mm) Hyd 6 SUGAR SH1011 F6378100 SHSH1011 6. Glycerol 1,000 8.0 x 300 6 SUGAR SH1011 8C F6378100A SHSH10118C 7. Acetic acid 1,010203 4 1 8 x 100 6 8. Methanol 8.0 x 300 10 SUGAR SH1821 9. Ethanol 15 6.0 x 50 6 SUGAR SH-G Colum 8.0 x 300 RSpak KC-811 F6378101 SHSH1821 Styrene Sulfo 10,000 6 L17 & L22 Flow r F6700080 SHSH-G divinylbenzene N.A. 5 Detec F6378030 SHKC-811 N.A. Colum 7 6F 6.0 x 250 6 RSpak KC-811 6E F6378033 SHKC-811.6E N.A. 9 5 6.0 x 50 10 RSpak KC-G F6700030 SHKC-G 8 N.A. 8.0 x 50 13 RSpak KC-LG F6700010 SHKC-LG 0 5 1N0 .A. 15 20 25 min Column : Shodex SUGAR SH1821 Eluent : 0.5mM H2SO4 aq. Flow rate : 0.6mL/min Detector : RI Column temp. : 75˚C MooMragrlagatalontnooicoMiolcirglaagaigoclactosiionddsaoisascclcicaagcahnnhocaddasirdraeieisdctdthecheaashasnn,,andoroielldtehsa,nol Cello-oligosaccharides and furfurals Common organic acids Cello-oCligeollsoa-oclcighoasriadcecshanriddefusrafunrdalfsurfuralGslyceriGnlyacnedrignClyaocnmedrmigcolyancceoidrrigcaancicidacids Ion Exclusion Chromatography Columns Sample : 0.0S5a%mpelaec:h0,.2005µ%L each, 20µL Sample : 0.1S%amepalceh:,01.01µ%L each, 10µL S21a..m12SCT..apaiGGmtlrertllipyyac:cclreaieeccrr:iiainc0dc.a1i2S1dc%..aiGGdmellpyyacclceeehrr:,iicn01.0a1µc%Lideach, 10µL Ion Exclusion Chromatography Columns 1. Maltotetra1o. sMealtotetraose 1. Cellopent1a.oCsellopentaose 2. Maltotrios2e. Maltotriose 2. Cellotetra2o.sCeellotetraose 3. Maltose 3. Maltose 3. Cellotrios3e. Cellotriose 3. Pyruvic acid 4. Glucose 4. Glucose 4. Cellobios4e. Cellobiose 4. Malic acid 5. Lactic aci5d. Lactic acid 5. Glucose 5. Glucose HOCH2C7658H....(OLSGFHauHulycOmc)CctcCiaoHciHnrl2iiacic2OccCaHaiaHdccc(iiOdiddH2)CH2OH2 6. Glycerol 6. Glycerol 6. Glyceric a6c. iGd lyceric acid 4 5 9 2 6 8 7. Acetic ac7id. MAceetthicanaoc1li2d 12 3 7. Acetic ac7id. Acetic acid 8. Methanol8. 3 4 4 4 4 8. 5-HMF 8. 5-HMF 12 5 9. Ethanol 9. Ethanol 12 9. Furfural 9. Furfural 9. Acetic acid 1 6 5 68 8 10. Levulinic acid 6 6 5 5 33 HOCH2CH(OHH111O)C231C...OHIPPOs2yroHCorboHpugi(oOtl1yunHrtiiac)cCmaOacicOciiddHacid1 7 12 13 14 77 10 7 7 14. n-Butyric acid 11 9 8 99 3 9 8 0 50 150 1150 2105 2250 205 5 010 515 1020 1525 2030 2535 3040 3455 40 45 0 05 510 1015 1520 20 min min min min 10 min 20 min 30 min Column Colu:mSnhodex S: USGhoAdReSxHS1U8G21AR SH1821 Column Colu:mSnhodex S: USGhoAdReSxHS1U8G21AR SH1821 Column Colu:mShnodeCxoSlu:UmSGhnoAdReSxHS1:U0SG1h1AoRdeSxHR1S01p1ak KC-811 x 2 Eluent Elue:nt0.5mM H:2S0O.54maMq.H2SO4 aq. Eluent Elue:nt2mM H2S:O24maMq.H2SO4 aq. Eluent Elue:n2t mM EHl2uSe:On2t4maMq.H2S:O64maqM. HClO4 aq. Flow rate Flow: r0a.t6emL/mi:n0.6mL/min Flow rate Flow: r0a.t6emL/mi:n0.6mL/min Flow rate Flow: r0a.6temLF/lmowi:n0ra.6temL/min: 1.0mL/min Detector Dete:cRtoIr : RI Detector Dete:cRtoIr : RI Detector Dete:cRtoI r Dete: cRtIor : VIS (430nm) Column temCopl.u:m7n5˚tCemp. : 75˚C Column temCopl.u:m6n0˚tCemp. : 60˚C Column temCopl.u:m6n0˚Ctemp. : 60˚C post column method Column temp. : 50˚C CommoCnomormgaonicoragcaindisc acids HydropHhyodbriocpohrogbaincicoragcaindisc acids GlucronGolulaccrtoonnoOelaragcnatodnniocergaaacnniddicsoraigncaidsnasickeacids Sample : Sample : 1 888-226-2775 :: [email protected] :: www.lifescience.caSample : Sample : S11S.a.aPmCmhpioptlresliecp:h:a1o2c00ri0diS1µcµ.aLLaCmciptidrliece:tac2c0.0i.d0µ1L% 1. Citric acid1. Citric acid 1. Succinic 1a.ciSduccinic acid 0.01% 2. Tartaric a2c.idTartaric acid 2. Lactic aci2d. Lactic acid 22..CMitarilcicaaccidid2. Malic ac0i.d01% 0.01% 3. Pyruvic a3c.idPyruvic acid 3. Formic ac3i.dFormic acid 33..PGylruucvriocnaoc3liad.cGtolunceron0o.0la1c%tone Fin00..e0011ri%%ce wine 44..MGalylicearcinid4. Glycerin0.01% 4. Malic acid4. Malic acid 4. Acetic ac4id. Acetic acid 5. SGulycccoinlicica65ac..cidiSGdulycccoinlicicaa2cci4did 2 94 11 5. Propionic5a. cPirdopionic acid 55..SEutchcainnoicl a5c.idEthanol0.05% 0.05% 6. 5 68 59 Eluent = 2mMElHueCnltO=4 2aqm.M HClO64. aIsqo. butyric6.aIcsiodbutyric acid 6. Lactic acid 5 5 68 7. n-Butyric7a.cnid-Butyric acid 7. Fumaric acid 5 7. Lactic aci7d. Lactic acid G-12 23 4 23 4 8. Isovaleric8a. cIsidovaleric acid 8. Acetic acid 8. Fumaric a8c.iFdumaric acid 56 1 5 9. n-Valeric 9a.cnid-Valeric acid 9. Pyroglutamic acid CANADIAN9. Acetic ac9id. Acetic a1cid 7 68 7 33 10. Levulinic10a.cLidevulinic aciLd IFE SCIENCE 89 9 6 4

HPLC/UHPLC Columns Ion ChromatogrAanpiohnyanCaolysluismusninsg N(AI-4n2i4oanndAI-n5a24lyAs(nison)-suppressor methods) HIonPLC/UHPLChromatographyC ColuColumnsmns(Anion Analysis) S•S•hh ooddCNpeehoIxx-ol4™™us2mpII4oohnpnnasrt--foeoSNvirIoiId-a-n94ens02sio44sniE|ma|Iun-S5latI2la-y54ns0Aeiso41wu2Esit3ahn4na5olyns-Ni6ssIu-4op2f4pfrl7eusosroidremaentdh243S1567o.......adFCNHSBNm-OrIO2Op--P432leO2---4:-201µ5551105Lmmmmmmmggggggg///////SS••LLLLLLL hh ooddCmPineerooxxeol™™rutvgh1mi,da2oIIoo3nend4nniscf5os--6iiroSSmnIIt--hus53el752tIa-a54n2nE4eaAolyussisaonfaolyxsyishaoW[n(p(12Fuel))efiitmrEwsEraPahdefeonnstroebsutoppdaelwroxerlvaebmeFldsriiyruccld,s-eaeaiteehaNstiwfownoeislinflIctnanhy-hwseNice,i4ecbhltdtriI2ithheca-eh.shd44eartoewpw2Isemps-s4eeepe5ea]rsurpde2rprepoana4atpadevhtrAraieaaiieopn.fdltdklfoniieprosdcrtoes,neeuoftaaliaogtscHnIkft-asdesh2o5ClPioa2ngplO-r4lhreaea4Aetn-err.dal • Columns for anion analysis with suppressor method • Columns for rapid analysis with suNpOp2-riseimssproovredm. ethod • Suitable for the quantitative analysis of fluoride ion • SI-35 4D provides rapid analysis of oxyhalides and general • SI-50 separates target inorganic anions from organic acids inorganic ions • Not interfered by the system peak derived from carbonate • SI-35 2B provides rapid analysis of general inorganic ions 0 5 10 15 min 0 5 10 15 min Dimensions Column : Shodex™Shodex IC NI-424 2I.o8mnMCBhisr-Torims atographEClyouleuCnmtonlumn:: S2s.h5(omAdMenxPiIhoCthnI-a5liA2c4anAcaidlysis) Eluent : ID x Length (mm) 8mM 4-Hydroxybenzoic acid + 4.6 x 100 Particle Flow rate Pro::d+1Nu.o02cnmmt-sLMuN/mpPapihnrmeensyselebdorcoonnicduMacctidiavin+tyuI0t.f0ea0m5cmtMur*eCyrDTA aqN. uItmemberFDleotwecrtaotre M:: +1N.Boa22n.mat3-emsLsu/reMmpiapiTnrlreiss(sheyddrcooxnydmuecFtthuivyintl)yacmtiinoomneatlhaGneroaqu. p Separation Size (µm) Detector Mode Column temp. : 40˚C Column temp. : 40˚C 5 IC*CNyID-4TA24: trans-1,2-DiaminocyclFoh6e9x9an5e2-4N3,N,N',N'-tetra aceSticHaNcIid-424 4.6 x 10 Anion a1n5A(2sanulyipospnisreausnsaiolnyrgsmiNseIICIu-Ct4Ihs-N52ioI2n-4G4dgA)aSnId-9I0-542E4AFF(66n7909o95n6214-60su(AspnupiporpenrseasSsnoSHsHarI-oNl5myI2r-4GseAmistehutohsdiosnPd)og)lyhSyId-ro5x0yme4thEacrylate Oxyhalides and anion Aannioanlaynsailyssis 4.6 x 100 using SI-52 4E (supnporne-ssupsroesrsomr meetthhoodd) Ion Chromatography Columns (Anion Analysis) 4.6 x 10 12 Sample : 20µL IC IA-G 2S1..aFHm-2pPlFFeO664:79-2090051µ1042Lmm0404gg//LLaAbTSnhecI-dtee5wt0Bciecare4-arnbEcpoFiedi-nSsa,aakHfSaotnseSHrd.hmIsI-CiAyg9icl-s0h-Gt.a4epcEmiedr,pfoaernamdkamanIpe-cp5tehe2aat4cyrArpsyebliceotafwcSeidIe-n9el0uNtO4eEd2-. SI-52 4E is a high resolution column offering 14,000 4.0 x 250 1. F- npWueitmrhfobtwrotasemeinrrimcm,iaeohNupnniligItecns-ahrce4.naer2eectIrut4oaorustmeihssepeapdraortoatner4vhreaceie5tldoydio˚cCmesraties.smoltiacoepI-afnhl5alodi2tgpxee4lhyadAehtnear.utlomidbesseerta. ntIhdt eisnucoporgpluaomnrtincs 4.6 x 10 2. Cl- 2mg/L 4.0 x 250 ([(12F))eEEwaNsrPaeennstrOesQuoppdalo2rlva1S1ebue-Fldi11296703854rucaalds-eiae...........mistteastiefSCFDNBCPBNCowoeispil-rniOOmflrrlOllOtcnhyOO-ln-OhweseNh44,32ipa23ecb3h23ld--:tioI-----rrthha-e.5roshyo4ert031141evwapw2aIµ21005111050epsc-4eemLemmmmmmmmmmm5edea]rrte2p.remigggggggggggcpna4a///////////deLLLLLLLLLLLoatAraicaaino.fli1tdklfinuiiposcmo,neufaalotHn4kftds2oCPalO-rea4n- sduApnr9eiosnsoarnmaleysthiso1d1 4.6 x 10 9 3. NBr3O- 2- 3mNgI/-L4I2C4SI-90 4E 4.0 x 250 9 4. 4.6 x 10 5 5mg/L 4.0 x 150 5 5. SPHNOOOC44O323-3--4- 10mg/L IC SI-90G 3. CNBNSOrOIO--423FFF2---66679709095955155626mmmmm242055ggggg/////LLLLL S1.aFm-pleS:H2S0µI-L19,20G (PEEK) SBNPOOrO-44323--- 6. 10mg/L 4. F6995260 72. 5. 2mg/L 7. 10mg/L 8. 30105mmgg//LLIC SI-50 4E 6. 2. MNCAFoclOe-retm2ht-aiciccrayaclSSciScidiHHdHacSSSidII3I---55540211044553002GmmmmmEE6ggggg/////LLLLL 8. 10mg/L 8 7. 3. 9. 15mg/L 15mg/L 4. 10. 15mg/L 46 IC S7I-50G 5. 11. Oxalic acid 15mg/L 1 5 6. 5 2 5 IC SI-52 4E 1 7 Polyv1in0yl alcohol 91 IC SI-92G F6709626 SHSI-925G (PEE7 K8) 11 3.5 3 IC SI-3574D F6995290 SHSI-3654D 9 4.6 x 10 9 IC SI-95G F6709627 SHSI-95G 56 23 10 2.0 x 50 3.5 IC6 SI-35 2B F6995291 SH4SI-352B 23 7 8 0 5 10 15 min 05 10 15 min Holder + o0ne filter 5 IC SI-2GF 10 1F56709720 SHSI-2GF Guard Filter for Anion analysis using NI-424 and I-524A Anion analysis using SI-50 4E Rapid analysis of anions usingSI-35 2B Column : Shodex IC NI-424 min 0 C5 olumn10 :1S5hodex20IC I-5224N5A.A. 30 min N.A0. 5 10 15 20N.A. 25 30 min El3ueFnilttCeroslumn: 8mM:4S-HhIoyCdreSoxIx-y2ICbGeSFnIz-Fo9ili0tce4arEcid + 2.8mM BiFs6-T7r0is9730 DCEFCaclleooouidtllweueunmcmrtStanonHtFEDCretlleoSeoutlmweIue-n2mcprttGa.not:::::Fret32SS0eF.5.muh27I˚poLmCmpTpd.MLEre::::e/Rxm+N42N1ss0..Iaoi252Cne˚2n.CmmdC3-SmsMLOcIu/-3oMm5pPn+0pihdTnr1t4ureh.iEc0ssatm(slhiivecMyidtdayNrccooiadxHnydCmuOec3tthiavyqitl).yaminomethanECFDCelleooouatllweueuqnmcm.rttanontretemp. : Shodex IC SI-52 4E Eluent + 2m:M1P.8hmeMnyNlbao2rCoOni3c+ac1i.d7m+M0.N00a5HmCMO3*aCqy.DTA aq. : 3.6mM Na2CO3 aq. Flow raFtleow rate: 1.0mL: /1m.5inmL/min : 0.8mL/min DetectDoretector: Non-s: uSpupprpersessesdedcocnodnudcuticvtiitvyity : Suppressed conductivity ColumCn otelummpn. :te4m0p˚C. : Room temp. (25˚C) : 45˚C *CyDTA : trans-1,2-Diaminocyclohexane-N,N,N',N'-tetra acetic Anion(naonna-lyssuipspurseisn(AssgonurNipomIpn-r4eea2tsnuRh4sasaooilapnydringdssdmiS)asIneI--3aut5l5hsy2sio4n4iDdsgA)o(sSf(unoIp-xo9pynrh0e-assl4siudEoeprspmareentdshsoadon)ironm(A(sssneuuitpophpnpordreaessn(Ts)ssarsuoilocyprrsapmirmsrbeeoeustxthsshyioonlodrigcd)m)SaeIc-ti5hd0osd4a)Enalysis uOsxiynhgaSSlIidI--3RSe55Isa2-p32a4i5nBdEd2(a(sasBnuunap(pislopypunsrrpeeiaspssnrssoaeooflsyrrassmmnoisiereotmtnhhsoeodtudh)s)oindg) Ion Chromatography Columns (Anion Analysis) Sample : 20µ12S3541L.....a3205CFBCNmmmmm-rlOlpO-ggggO2l////2e3-LLLL--:12211050mmmmmµgggggL/////231SLLLLL...aFCHm-I2p-1Pl06789eO.....4:SBCNP-2OOrlO0O-144µ3323-011L---mmm4113ggg05010///LLLmmmmmggggg/////LLLLL 4aASbT564231SnhecI......a5-dteeMCNFFAm5wt-oc6lOe0Bcip-ecretam2lhrete4--aaircnibEc:ccpra2oFiyeadci10l-nscia,ciµd7aiakdfLaaIotns-cerd.53142Sih5mds....2aCiygiCtcIm4cs6rlsih-a11isoAptt.an530202-rcelipAcesmcmmmmmimt-icerd7:aAggggggiorc2c,p//////cfnLLLLLL0oiaao8editµcrnniacmLiiddktia11acmac01789naip.....deccSONBPpteihdOOreOx-aaat4439cy23l-r5212i--crps0000yemmmmablicc1eggggW(pn[(oi120Fdt////aufeLLLL)w)eictmrENaEwrsSPa11111heief1ednns05550trIoOeebs1u-topmmmmmpdalnwr19eoe2rlvaebmegggggl-0Fldri2iuNruccld,/////s-eiaeatLLLLL3isteO4eeaNstifownoeEisdil2inmflIctnnhy-.-hwseNce,i4pecbhdtriI2rthheca-e.osh44eartoev4wpw2Ismeps-4eeepe5dea]rrpde2rp.repoana4atdevhtrAraieatosSaaiieo1S1.fedlitdnkrlfoIn12197603854maim-ieposicr...........m5otoheus,neSDFCNBCPBCNupo2npftila-aliOOrrgtlOlOleiacotOO-ls-OcH4aneIkhhr44f32t-.aEn32d3sha32l2--oe:o5C-----lePtiI5rrai2gpuotlsoO0-31114r4arlhuetµaa21050111005eaic4hAessLmmmmmmmmmmmten-heear.tdiagggggggggggiocrtg///////////ner4LLLLLLLLLLLaheacc5tlroi1ydi˚ecCmssai.osml luoe1p4tfnliaoodtnxee2ycdhona3lutulomimdbesn9see4orta.ffnetIhdtr5ienisngucop1or4721S3645gp6lu,.......aao01SCFNPNBmmnr10-OOrtOlOip-n0-cs4423le32--7--: 2µL 1. F- 10 1mg/L NI-24. 2C4l- 1,2 2mg/L NBrO- 2- 3mg/L 3 3. SPHNOOCO44O323-3--- 4NSNBOrOO-4322---8 5mg/L 4 4. 5mg/L 8mg/L 2 5. 10mg/L 4. 5mg/L 3 6mg/L 15 6. 300mg/L 5. 5mg/L 7. 6. 5mg/L8 8. 15mg/L 7. 5mg/L 15mg/L 7 64 25 1 1 6 3 75 9 23 7 56 0 65 23 10 4 5 10 15 20 25 30 10 15 20 0 23 78 5 10 0 5 10 15 min 0 min 5 10 15 min min min Column : 1SN84+.m0*ho0C2˚onCmMmy-dDsLMTe4u/Ax-mpPCDFCEH0:IpillhCetoonyourretadlleweueunNnrsnmcsomysrIt-ta-xle1nobn4ty,droe22tb-er4ceDomoninanpzmicod.iFCDECniu:::::acollceoocou1RS1Scat5lilwe..yudiuheouc85vcnmcpoomimiml+rdttotpmadynohMnLt0r+eeree/t.txxme0Nse2ams0m.Inai8Cne5e2ppmd-CmN.S.MOc:::::,MI(N2-o304S4S29,5BnN*+.5..0uh˚C650di'C˚s,p1oC1mmmN4uy-0)pd.'DETc7LMM-rettrmeT/eiixvmsstANNMrisatIiaaCynaeaN2HqdcCSa.CecHIOtO-iocC33n3a5Od+cai34udqmDc1a.it5nqiv. iCFDCEtylleoooutllweueunmcmrttanontreteCEFDC0mlleooouptllwe.ueun:::::mcmrt+t4S21Nanont0..ho52r25et˚on.Cemm3-dmmsLMepu/Mxmp.PECDCFI:::::pi1hCTnllr0eo3S2S0otourehit.l5.Ilwuehssu2e7u-a˚n(pos5mmCcmlhmirtep2dctayMnoLdnr4edtaer/e1AtxrmcNcse5ooisIamdixCnen2ypdCdmS.uOcI:::::ec-3ot25tS940Shni+0v0.5.uhyd06i˚1tplo4Cumm)y.apdEc0mMLrtmeei/vximMsn2Nits5IoiyaCneNm2daCSeHcItO-hCo33an3O5n0da3eq4umaD.caqitnq.iv.ity 0 Co5lumn 10 :1S5 hode20x IC S2I5-35 23B0 Eluent : Eluent : 1.0mM Na2CO3 min Flow rate : Column : Shodex IC SI+-522.04mEM NaHCO3 aq. Detector : Column temp. : Eluent Fl:ow3.6ramteM Na2C: O0.32maqL./min Flow rate De: t0e.c8tmorL/min : Suppressed conductivity Detector Co: lSumupnptreemsspe.d: c3o0n˚Cductivity Column temp. : 45˚C 33 Anion analysis usinRgapSidI-a9n0al4ysEis of oxyhalidAensioanndaannaiolnyssis usinTgricSaI-r5b0ox4yElic acids aOnxaylyhsailsides and anioRnaapnidalyasniaslysis of anions using G-13 (suppressor1m8e8t8h-o2ud2s)i6n-g2S7I-7355 4D::(suipnpfroe@ss(oslirufempsepctrhieeosnds)coer.cma et:h:o(dsw)uwppwr.elisfseoscrimenecteh.ocda)using SI-52 4E (suppSrI-e3s5so2rBm(estuhpCopdrA)esNsoAr DmeIAthNod) a high resolution column offering 14,00L0 IFE SCSaIEmpNle :C2µEL Sample : 20µL S1.aFm-ple : 20µL 6. Br- SI-50 4E is faorhmigichapciedr,foarnmdamnectSehaatmcyprpyleelic:o2af0cSµidLI-9el0ut4eEd. SI-52 4E is 1. F- 2mg/L 10mAgc/eLtic acid, or higher theoretical plate number. It supports 1mg/L

Colonnes HPLC/UHPLC Ion Chromatography Columns (Cation Analysis) Common cations (YS-50 and YK-421) Colonnes HPLC/UHPLC YS-50 YK-521 YS-50 10µL inj. • High performance type of YK-421 • Applicable to both suppressor and non-suppressor methods Sample : • Provides sharp peaks; more significant for divalent cation 1. Li+ • Column for cation analysis with non-s2u3 ppressor method 2. Na+ 2mg analysis NK+H4+ 10mg • Separates monovalent cations or div1alent cations 3. 10mg 4. 20mg 5. Mg2+ 10mg 6. Ca2+ 20mg • Fulfills USP L17 and L22 requirements 4 5 6 • Supports the analysis of alkylamines and transition metals YK-421 T-521 • Column for cation analysis with non-suppressor method • Column for transition metal ion analysis • Simultaneous analysis of monovalent and divalent cations • Highly sensitive analysis achieva0ble usin5g post c1o0 lumn c1o5 lor 20 min reaction method • Suitable separating of alkylamines Column : Shodex IC YS-50 • Fulfills USP L76 requirements Eluent : 4mM Methanesulfonic acid aq. Flow rate : 1.0mL/min Detector : Non-suppressed conductivity Column temp. : 40˚C CommCoonmcDImDaixtmoiLoneennngcstshai(t(omYionmSns)-s50(YaSSnP-izd5aer0Yt(iµKacmln-e4d)2Y1K) -42P1r)oduct Name Shodex™ Ion Chromatography Columns (Cation Analysis) Manufacturer Item Base EFfufenccttsioonfaladded croSwepnaertahtieornin the eluent Item Number Material Group Ion Chromatography Columns (Cation Analysis) Mode Crown ether forms complex with cations. The elution of cations (particu Ion Chromatography Columns (Cation Analysis) 4.6 x 1Y25S-50 10µL5 inj. IC YS-50 YK-4F27112201050µL inj.WpsinhriotathhvpeiedtpswersiceScSipWsoSSsneHahrmHeHHiotaYtinhYnphhvYYpcKeciiaSeSKgdet-rrpsw-4ehee--o5GGrae2sdRicef0csr1oesheteamoseipdgoinenphYhlcutrciaKhgefNtrroi-eeheoao4roaedn(Rm+f2Nrsreh1etacaeos.itp+nodgioTceYcanhlhautrnePtKhfNeeltdooi-enopaw4rqloNtnym+l2YuiarviHt1esSatahciSe.n4tn-noai+5Tiycticlnlnm0iis)lhactetuoaaeelapmtlnpwicriqmotobloYuianivtephsSat2hYereroo.n-,aoKd55fltilnYv-m0isNt4eupSoap2Hdmet-1iri.5ma4oob+0knvepYerro,oKdf2Yv-.N4e1pS2Hde-1.5a4+0kweCll acorbnotrx6oymllleMd 15Fµ6L7i0nj0. 530 by the difference in complex formation rate. F7120012 2 6 4.6 YSx-50 1010µL inj. 5 Sample : Sample :IC Y2mS-gG/L YK-421 F6709608 S 2 1. Li+ 1 3 Cation ana5lysis 6 1 234561211.....02000NNKMCmmmmm+Haagggggg2+42/////+++LLLLLICICY11221Y00000KmmmmmK-4-gggggG2/////LLLLL1 2 non-supressor m4 ethod 2 24.6 x3 125 5 1. Li+ 3 2. Na+ 4 31 NK+H4+ 2 5 10 5 3. 13 5 6 1 4.6 x 12 4. 4 4.6 4 x 4 5. Mg2+ 2 5 150 6. Ca2+ 20mg/L IC Y-521 1 F6995210 SHY-52(1Na+and NH4+) 2.5 2.1 18-Crown 6-ether conc. 3mM Cation analysis 3 4.6 x 10 5 12 6 IC Y-G 1 SHY-G StyrTePne divinylbYeSn-z5e0ne 2 non-supressor method F6700230 SHT-521 TP Mg2c+YoSp-o5l0ymer6,Y9K00-421 3 6 3 SHT-G YK- 421 1 3,000 46 5 3,000 4 56 4.6 x 150 12 IC T-521 4 6 F6995250 Mg2+ Ca2+6,900 6,630,0000 Cation analysis for 5 1mM 2 transition metal ions 4.6 x 10 12 IC T-G F6700412 Ca2+ 6,600 3,000 13 0Line Filters f5or IC Holder + one IC FL-1 F8500630 SHFL-1 N.A. N.A.0mM 4 56 filter 20 min 0 5 10 15 20 min N.A. 10 15 0 5 10 5 1F5ilters 20 min IC F0L-1 Filter 5 10 F8500640 15 SHF20L-m1inFILTER 0 5 10 15 20 min Column : Shodex IC YS-50 Column : Shodex IC YK-421 Column : Shodex IC YS-50 Column CDFElleooutlweuenmcr::::ttanoN4S1trem.hto0eonmMm-dsLpeMu/.xmpe::::IptiC414Nnhr0.meao0Y˚snnCmMSse-esLs-Md5uu/m0plefcoptionhnrneaicdsnuseaecscdtuiidvlfciotaoynqni.cduacctiidvitayq. CFEDlleooutlweeuncmrttaontreEDFClleooutlweuenmcr::::ttano15NStre.mhto0eonmMm-dsLpeTu/.xmap::::rIpitC415Nnar0.mero0Yi˚scnCmMKs-aesL-Tcdu4/imap2dcr1pito+narner1idscmusaecMcdtiivdDcitoi+ypni1cdmoulcMintiivcDitaiypcicidol+in1ic.5agc/iLd + 1.5g/L Boric acid aq. Eluent : 4mM Methanesulfonic acid + 18-Crown 6-ether aq Eluent Boric acid aq. Flow rate Flow rate : 1.0mL/min Detector Detector : Non-suppressed conductivity Column temp. : 40˚C Column temp. : 40˚C Column temp. : 40˚C EfEfeffcetcstosfoafdaddeddecdrocwronwentheetrhienrtihnetehleueenlut ent SiSaminmudlutSealinttmhaeuonyluletesaonnaueensodauailaysnsmaaisnliynaoslefyiscsiaostfioocfnacstaiatoniondnsestahnydleentehdyilaemniendeiamAAimnmeininooalaclocohohlosls Alky Effects of added crown ether in the eluent Crown ether forms complex with cations. The elution of cations (particularly K+) can be Sample : 10µL Sample : 20µL Crown ethweerlflocromnstrcoollemdpbleyxthweithdicffaetrieonncse. Tinhecoemluptiloenx ofofrcmaatiotionns (rpaater.ticularly K+) can be 112376450.......µNNLECKMLit+Haa+gh+242y+++lene12112d000200iammmmmmmggggggi//////nLLLLLLe 1. Monoethanolamine in2complex 12 Sample : 2mg/L 2. Diethanolamine 10µg/mL well controlled by the difference1 3 formation rate. 3 1. Li+ 10mg/L 3. N-Methylethanolamine 20µg/mL 2 5 Sample : 10µL 12 5 5 2. Na+ 10mg/L 4. Triethanolamine 20µg/mL 112365411210......02000µNLNCMKmmmmmLi+aHa+gggggg2+42/////+++LLLLL 3 20mg/L 5. N-Methyldiethanolamine 30µg/mL 1 3 4 6 Sample : 2mg/L 3. NK+H4+ 10mg/L 6. N,N-Diethylethanolamine 30µg/mL 6mM 5 6 6 1. Li+ 10mg/L 4. 20mg/L 7. N-(2-Aminoethyl)ethanolamine 30µg/mL 4 2. Na+ 10mg/L 5. Mg2+ 50mg/L 30µg/mL 20mg/L 6 3 2 NK+H4+ 10mg/L 6mM 13 3. 20mg/L 46 6. Ca2+ 25 4. 4 13 4 5. Mg2+ 7. Ethylenediamine 50mg/L 18-Crown 6-ether conc. 3mM 5 6 6. Ca2+ 20mg/L 18-Crown 6-ether conc. 4 22 3mM 13 15 2 7 4 13 4 56 7 4 56 6 1mM 1mM 1 23 7 4 1 23 56 4 56 0 5 10 15 20 25 30 35 5 10 0mM 0 5 10 15 20 25 30 35 min min 0mM 0 5 10 15 20 min 0 15 20 min Column : Shodex IC YS-50 0 Co0lumn 5: Shodex IC10YS-50 15 20 min Column Eluen:t Shodex:IC4mYMS-H50NO3 + 1.5mM 18-Crown 6-ether aq. Column : Shodex IC YK-421 Colum EFllouwenrtateDFleotwecr::tao41/treCm.0HmM3LCH/NmN::=iON1n/9C.3o00Hn+/m1-310sLCu./5Nmpm=pin9Mre0s/1s18e0-dCcroowndnu6c-teivthiteyr aq. Eluen Column Eluen:t Shodex:IC4mYMS-M50ethanesulfonic acid + 18-Crown 6-ether aq. Detector Colum: nNtoenm-spu.p: p4r0e˚sCsed conductivity Eluent : 4mM HNO3 aq. Flow Eluent Flow r:a4temM Me: t1h.a0nmeLsu/mlfoinnic acid + 18-Crown 6-ether aq. Column temp. : 40˚C Detec Flow rateDetec:to1r.0mL/m: iNn on-suppressed conductivity Flow rate : 1.0mL/min Colum Detector Colum: nNtoenm-spu.p: p4r0e˚sCsed conductivity Detector : Non-suppressed conductivity Column temp. : 40˚C Column temp. : 40˚C Amino alcohols Alkylamines Alkaline earth metal ions Amino alcohols Alkylamines Alkaline earth metal ions Sample : 20µL Sample : 50µL Sample : 10µL S142356......aNMEDPTmrtriHeiphmo1mt4ylphee+leyaytt:hlmlhaa5yym1243567mi0lnla.......aµieimnNPTDMEBnmLeretruiHieihminomntt4yepyehe+ellyaaytthlmlmha112ayym050505miilnlnammmmmmaieimennmggggggeei//////innLLLLLLee 113242550....000µNMMCmmmLiang2ggg2+22///+++LLL CANADIAN5643S12......aMNDNTNmri--,oipeNMMentlt-ehheeoDatta:eihhnent2yyho4156273to0hllal.......delaµaynDTNNMNNtimLelmhorei,---otieaNil(MMethina2nhtnnt-ahem-heeoaeoDnAattaneliihhaonnmenotmyyholetoalihllaalnedmlaiamynnotimelmheioeenitnailtthienahhnneaemayeonlnli)aonLeomletalhamiIamnFneini233312one000000Eelaµµµµµµmggggggi//////nSmmmmmmeLLLLLLC13223330000000IEµµµµµµµggggggg///////NmmmmmmmLLLLLLLCE 5mg/L min Sample : 50mg/L 50mg/L 5mg/L 20mg/L 7. N-(2-Aminoethyl)ethanolamine 30µg/mL 5mg/L min NZCCFMenouin222222++++++,,FPeb3+3C432+dM2g+NZCCCFM2enouai+n2222222+++++++,,FPeb3+3C+dM2g+2+ 1. Ni2+ 50mg/L 20mg/L 2 2. Mg2+ 50mg/L 10mg/L MCan122++ G-14 10mg/L 3 3. 10mg/L 4. 1 888-226-2775 :: [email protected] ::1 1 www.lifescience.ca 4 7. Butylamine 10mg/L 43

HPLC/UHPLC Columns Column Selection for Size Exclusion Chromatography (SEC) Application Solvent Column HPLC/UHPLC Columns Biological macromolecules Buffer etc. KW-800 series (proteins, peptides, nucleic acids, etc.) LW-803 - High performance KW400 series - High performance/solvent-saving Aqueous SEC Biological macromolecules Buffer etc. (GFC) (high MW range) SB-800 HQ series Water, Buffer, Aqueous LB-800 series Water-soluble polymers solution, etc. (polyacrylamide, polyethylenimine, etc.) SB-800 HQ series Water, Aqueous LB-800 series Polysaccharides solution, etc. KS-800 series GS-HQ series Oligosaccharide, polysaccharides KF-800 series General polymers THF KF-600 series - Rapid analysis (solvent-saving) Chloroform KF-400HQ series - High performance (solvent-saving) HK-400 series - Ultra-rapid Analysis (solvent-saving) Organic SEC Polar polymers DMF (GPC) (polyimides, polyvinylpyrrolidones etc.) LF series - High-linear calibration curves K-800 series Analysis at high temperature ODCB etc. KD-800 series (polyethylene, polypropylene etc.) HK-400 series - Ultra-rapid Analysis (solvent-saving) Engineering resin analysis HFIP LF series - High-linear calibration curves at room temperature SB-800 HQ series LB-800 series [polyamide (Nylon), polyethylene HT-800 series terephthalate (PET) etc.] UT-800 series AT-806MS Aqueous/Organic SEC HFIP-800 series Solvent usability guideline for the Shodex SEC columns HFIP-600 series - Rapid analysis (solvent-saving) HK-HFIP404L - Ultra-rapid Analysis (solvent-saving) Polarity of solvent LF series - High-linear calibration curves High GF-HQ series Low KW-800 series, LW-803, KW400 series KF, K, HK, LF series G-15 SB-800 HQ series, LB-800 series GS-HQ series CANADIAN GF-HQ series KD series LIFE SCIENCE 1 888-226-2775 :: [email protected] :: www.lifescience.ca

Colonnes HPLC/UHPLC Colonnes HPLC/UHPLC Solvent Replacement Applicability of SolveSnEtCRe(pGlaPceCm) eCnot Alupmplincasbility of SEC (GPC) Columns Product Name Shipping Solvent: THF Shipping Solvent: DMF KF-801 KF-802 KF-803 KF-804 KF-601 KF-603 LF-804 KD-801 KD-803 KD-804 KF-802.5 KF-805 KF-602 KF-604 LF-604 KD-802 KD-805 KF-803L KF-806 KF-602.5 KF-605 LF-404 KD-802.5 KD-806 KF-804L KF-807 KF-606 KD-807 KF-806M KF-607 KD-806M KF-805L KF-606M KF-806L KF-807L Solvent Shipping Solvent: Chloroform Shipping Solvent: THF K-801 K-802 K-803 K-804 KF-401HQ KF-403HQ K-802.5 K-805 KF-402HQ KF-404HQ K-803L K-806 KF-402.5HQ KF-405LHQ K-804L K-807 KF-406LHQ K-806M K-805L K-806L K-807L Tetrahydrofuran (THF) Chloroform Carbon tetrachloride Benzene Toluene p-Xylene o-Dichlorobenzene (ODCB) Trichlorobenzene (TCB) Dioxane Diethyl ether Ethyl acetate Acetone Methyl ethyl ketone Dimethylformamide (DMF) Dimethylacetamide (DMAc) Hexafluoroisopropanol (HFIP) m-Cresol o-Chlorophenol Quinolin N-Methylpyrrolidone (NMP) Dimethylsulfoxide (DMSO) 30% m-Cresol/Chloroform 30% o-Chlorophenol/Chloroform 30% HFIP/Chloroform Hexane Acetonitrile Methanol Water : Solvent replacement possible : Solvent replacement possible, but this may cause column performance to deteriorate slightly : Usable at 40˚C or higher 68 : Solvent replacement not possible G-16 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

HPLC/UHPLC Columns Precautions for Polar Polymer Analysis HPLC/UHPLC Columns Unexpected interactions in the column can affect the size exclusion chromatography analysis of polar polymers. These interactions may change elution patterns and results in an invalid molecular weight calculation. It is important to reduce these interfering interactions in order to obtain the accurate molecular weight distribution. Interfering interactions likely to be observed Exclusion limit Elution will be Interactions between the analyte and the packing materials: molecular weight retarded Hydrophobic interaction The analyte is adsorbed on the packing material. This delays the analyte (B) elution and results in under estimating the analyte’s molecular weight. Permeation See (B) and (D). limit volume log MW Elution will be (D) accelerated Ionic interaction (A) • (1) Ion Exclusion Exclusion The analyte is repelled from the packing material. This accelerates limit volume the analyte elution and results in over estimating the analyte’s molecular weight. See (A) and (C). (C) • (2) Ion Exchange The analyte is adsorbed on the packing material. This delays the analyte elution and results in under estimating the analyte’s molecular weight. See (B) and (D). Interaction within and between the analyte: • Ionic repulsion effects observed within the multivalent macromolecules causes structure expansion This accelerates the analyte elution and results in over estimating the analyte’s molecular weight. See (A). • Association between the molecules This accelerates the analyte elution and results in over estimating the analyte’s molecular weight. See (A). Interactions between the analyte and the solvent: • The multivalent ion in the solvent works as a bridge to bind ionic molecules (analyte). Methods to reduce interactions Aqueous SEC (GFC) Organic solvent SEC (GPC) Ionic Interaction Ionic Interaction • Add salt • Add salt (Example) Add LiBr to DMF • Add CF3COONa to HFIP Hydrophobic Interaction Hydrophobic interaction • Increase the analyte dissociation • Lower the eluent polarity Cationic polymer -> Lower the pH (Example) Change the eluent Anionic polymer -> Higher the pH from DMF to THF • Lower the eluent polarity (Example) Add acetonitrile or methanol Hydrophillic interaction • Increase the eluent polarity (Example). Change the eluent from THF to DMF 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN G-17 LIFE SCIENCE

Colonnes HPLC/UHPLC Aqueous SEC (GFC) Shodex™ PROTEIN Columns: Silica-based Colonnes HPLC/UHPLC Shodex™ PROTEIN - KW-800 Shodex™ PROTEIN - LW-803 • Silica-based packed columns for aqueous SEC (GFC) analysis • Pore size specifically controlled for analyzing proteins with • Suitable for the analysis of proteins and enzymes • Fulfills USP L20, L33, and L59 requirements molecular weights of several hundred thousand Daltons; Shodex™ PROTEIN - KW400 optimized for light scattering detection • Reduced packing material particle size enhances column • High performance analysis of antibody drugs and various proteins performance • High lot-to-lot reproducibility • Three to four-fold higher sensitivity than KW-800 series • Fulfills USP L20, L33, and L59 requirements • KW405-4F is applicable analyzing samples with molecular weight above 1,000,000 • Fulfills USP L20, L33, and L59 requirements Dimensions Shodex™ PROTEIN ID x Length (mm) Particle Product Name Manufacturer Item Base Target MW Range Pore Size Separation Size (µm) Item Number Material (Å) Mode 8.0 x 300 KW-802.5 5,000 − 100,000 8.0 x 300 5 KW-803 F6989000 SHKW-802.5 10,000 − 700,000 400 GFC 8.0 x 300 5 KW-804 F6989103 30,000 − *(4,000,000) 1,000 8.0 x 50 7 KW-LG F6989104 SHKW-803 1,500 6.0 x 50 7 KW-G F6709556 N.A. N.A. 8.0 x 300 7 LW-803 F6700131 SHKW-804 N.A. N.A. 6.0 x 50 3 LW-G 6B F6989303 10,000 − 700,000 1,000 4.6 x 300 3 KW402.5-4F F6700133 SHKW-LG N.A. N.A. 4.6 x 300 3 KW403-4F F6989201 5,000 − 70,000 400 4.6 x 300 3 KW404-4F F6989202 SHKW-G 10,000 − 500,000 800 4.6 x 300 5 KW405-4F F6989203 30,000 − *(4,000,000) 1,500 4.6 x 10 5 KW400G-4A F6989204 SHLW-803 200,000 − *(20,000,000 2,000 20.0 x 300 5 KW-2002.5 F6700132 N.A. N.A. 20.0 x 300 5 KW-2003 F6505020 SHLW-G6B 5,000 − 100,000 400 20.0 x 300 5 KW-2004 F6505021 10,000 − 700,000 1,000 7 F6505022 SHKW402.5-4F Silica 30,000 − *(4,000,000) 1,500 SHKW403-4F SHKW404-4F SHKW405-4F SHKW400G-4A SHKW-2002.5 SHKW-2003 SHKW-2004 CoCmompaprairsiosonnoof fLLWW-8-80033,,ccoonnvveennttiioonnaall ccoolluummn, aannddootthheerrmmaannuuffaacctuturreerr’s’scocolulummnn Aqueous SEC (GFC) Columns: Silica-based PROTEIN LW-803 is suitable for analyzing proteins with molecular weight of several hundreds of thousands. Compared to our conventional columns and other manufacturer's columns, LW-803 has improved separation performance in the molecular weight range around 160,000 (about the size of γ-Globulin). This improvement is advantageous for the separation of monomer and dimer of IgG which is a mainstream antibody drug. Sample : 5µL 4 Sample : 5µL Resolution(Monomer/Dimer) 3 IgG from human serum 10mg/mL 1. Thyroglobulin (MW : 670,000) 7mg/mL 1 2 1. Aggregates 3 LW-803 2.2 2. Dimer 2. γ-Globulin (MW : 160,000) 6mg/mL 5 3. Monomer 12 3 3. Ovalbumin (MW : 44,300) 4.8mg/mL LW-803 KW-803 1.6 4. Ribonuclease A (MW : 13,700) 7mg/mL 5. Uridine (MW : 244) 0.1mg/mL Company A 1.9 LW-803 13 4 2 5 (conventional type) 4 (conventional type) 12 KW-803 1 35 KW-803 3 2 12 Company A Company A 0 5 10 15 min 05 10 15 min Column : Shodex PROTEIN LW-803, Shodex PROTEIN KW-803, Silica-based SEC column from other manufacturer Eluent : 50mM Sodium phosphate buffer (pH7.0) + 0.3M NaCl Flow rate : 1.0mL/min Detector : UV (280nm) Column temp. : Room temp. Monitoring papain digestion of humanized monoclonal IgG G-18 CANADIA6 N 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE Sample : 10µL Papain digestion of humanized monoclonal IgG was monitored Humanized monoclonal IgG

HPLC/UHPLC Columns Aqueous SEC (GFC) Shodex™ OHpak Columns: Polymer-based Shodex™ OHpak - SB-800 HQ HPLC/UHPLC ColumnsShodex™ OHpak - LB-800 • Polymer-based packed columns for aqueous SEC (GFC) • Polymer-based packed columns for aqueous SEC (GFC) Aqueous SEC (GFC) Columns: Polymer-based analysis analysis • Supports a wide range of molecular weight sample analysis LB-805• Low column bleeding allows its use with light scattering • The eluent can be replaced with DMF (except SB-802 HQ LB-806M detectors and SB-807 HQ), enabling the analysis of polar polymers LB-8L0B5-806M• The eluent can be replaced with DMF enabling the analysis • Fulfills USP L38 and L39 requirements • SB-802 and 802.5 HQ fulfill USP L25 requirements of polar polymers • SB-803 HQ fulfills USP L37 requirements • LB-805 (exclusion limit: about 4,000,000) newly added to the series • Fulfills USP L38 and L39 requirements Dimensions Shodex™ OHpak CopoIDvxiLdenogtnhe(msm) Particle Product CalibrMatainonufcauctruveresrfor LB-I8te0m0 series BCaasleibration curvTeasrgfeotrMLBW-800 sPeroireesSize Separation Size (µm) Name using pulluItleamn (eluent: HN2uOm) ber MautseirnigalPEG/PEO (eRluaenngte: DMF) (Å) Mode Sam8pl.e0 : 100µxL 300 8 SB-802 HQ F6429100 SHSB-802HQ 200 - 1,000 100 GFC SHSB-802.5HQ Poly(1-vinylpyrrolidone-co-vinyl acetate) 0.1% each 200 8.0 x 300 6 SB-802.5 HQ 107 F6429101 107 500 - 10,000 8.0 x 300 6 SB-803 HQ F6429102 SHSB-803HQ 1,000 - 100,000 800 SHSB-804HQ 8.0 x 300 10 SB-804 HQ 106 106 5,000 - 400,000 2,000 300 13 SB-805 HQ Copolymer 7:3 300 13 SB-806 HQ F6429103 Molecular weight (Pullulan) M8n .:0 2,000x 105 F6429104 Molecular weight (PEG/PEO)SHSB-805HQ 105 100,000 - 1,000,000 7,000 SHSB-806HQ 15,000 Mw : 14,400 F64291L0B-5803 SHSB-806MHQ 104 100,00 - 20,000,000 15,000 F6429106 SHSB-G6B LB-805300 - 20,000,000 N.A. M8w./0Mn : 7.40x SHSB-807HQ Polyhydroxymethacrylate 30,000 SHSB-807G N.A. Cop8o.l0ymer 3:7x 300 13 SB-806M HQ 104 103 400 50 10 SB-G 6B 500,000 - 500,00,000 Mn : 6,400 300 35 SB-807 HQ 103 F6709430 102 F6429108 N.A. MM6ww./:0Mn28: ,49.0530x 102 F6709431 8.0 x 8.0 x 50 35 20 SB-807G 5 10 15 25 8.0 x 300 6 4 F654292601 7 8 9SHL10B-80131 12 4 5 6 1,7000 -81009,00010 11 12 800 *Molecular weight was determined from min LB-803 Elution volume (mL) LB-805 Elution volume (mL) the8c.0alibratioxn curve30of0PEG/PEO. 13 F6429203 SHLB-805 100,000 - 1,000,000 7,000 CElou8le.u0nmt n x : S2300hm0odMexLiOBrHipnaD1kM3SFB-806M HQ x 2 LB-806M Column F6429::2HS02h2Oodex OHpaSkHLLBB--880060Mseries Column : SDhM5o0Fd0e-x2O0,H0p0a0,k00L0B-800 serie1s5,000 : Eluent Eluent : DFleo6twe.0crtaotre x : 1R5.00I mL/min 13 LB-G 6B FDleotwecrtaotreF6709::4R13.4I0mL/min SHLB-G6B Flow rate : 1R.I0mL/mNin.A. N.A. : Detector : Column temp. : 40˚C Column temp. : 30˚C Column temp. : 40˚C PuPlululllualnandedteetcetcitoionnbbyyLLBB--880066MMaanndd mmuullttiiaannggllee lliigghhtt ssccaattteterirninggddeetetectcotror The new OHpak LB-800 series is able to detect low molecular weight substances owing to its improved 250 LB-806M (8.0mm I.D. x 300mm) low baseline noise level while using it with a multiangle light scattering detector. This cannot be achieved 200 SB-806M HQ (8.0mm I.D. x 300mm) with other manufacturer's SEC column. SEC column from other manufacturer (7.8mm I.D. x 300mm) Sample : Pullulan (MW : 12,000) LB-806M (8.0mm I.D. x 300mm) 0.5%, 10µL Signal to noise ratio (S/N) 150 SB-806M HQ (8.0mm I.D. x 300mm) 100 50 SEC column from other manufacturer 0 5,300 12,000 20,800 (7.8mm I.D. x 300mm) 1,420 0 5 10 Molecular weight (Pullulan) Column : Shodex OHpak LB-806M Shodex OHpak SB-806M HQ SEC column from other manufacturer Eluent : 0.1M NaNO3 aq. Flow rate : 1.0mL/min 15 min Detector : MALS (Multi angle light scattering) (90°) Column temp. : 30˚C Sodium alginate Sodium heparin 1 888-226-2775 Sample : Sodium alginate 0.1%, 100µL www.lifescience.ca Sample : Sodium heparin 0.1%, 100µL G-19 1.0x108 :: [email protected] :: 1.0x108 CANADIAN LIFE SCIENCE

Colonnes HPLC/UHPLC106 106 107 GbsmoaaseennfuSoppddtc-daaHobiaeorrllaaaQsusn.tstomiiicionccBngnouiynpsaasGmobslnumt.eeennfuhdSecompppddtyoGreca-daaadtnHdrorbiaieSorcrdesellaaaQsom-ustnfei.tst3upowmtoisiiucihon2lchcB.nlolnya0gnoutiisyrlnpistilnmkcumst.ceHhwdecmeoapnyoGQreapalndadtoendrsasmGboarsieScedrectseesnnefuspoSm-otnfteeppddothi3uitpacw-tdoonsriauanoh2lHdnhoibav.neltgoorrlylwa0etaeillyaaaQssrlausnitislmsk.tsttcvyaosmicHiuihw,cioncasescBoaneeQngnpaioiulindsloydesxnpsaslenaeeeuccmtet.sebhspdrewclcenmtrepuotyhloiGtreaaeoilonhriadetlcnoSnddrnrevinStgecndurelwwsEeeaenydorma-ttfleeCslitasi,3utpavywttosuh,urhh2lasrhspt.nllnhoeel(yyyah0iiptiGseoslydsxrlitaeismakredctecsFecfHybhwferwolcereorCoautnlpeoQrpeaoillhrpndelc)oeSrapmesenerenuacwtrmEshtnospdraatynclteeCooitahv,itaaottpnionriibidnrhodrnddovptcetglh(ylwiiyheaeGyneeeccsoyaessls,trdtvyaFfyuhh,feoasrsoCneepeoriiprpsl)dsxrapmaareecaermhtborwalacyecruotlvotepnoilihelcibidSdedocenenuwiiE3nneeeccsdrtleCita,,at4rhrptlh(yyhGeoyesrdtFfyhfeoro231S4Cpeor....rap)rapmAGGAmrarm3htorrllaaycpguygovot-pnli---4eibidHAAPddoceii:lirsneeeccsasop2-,--0LGL21S34µyylu....sLasGAAGm-Prrllpgugyr-lo---eHAPA:lirs3as0000op2--....-40L0000GLµy2225ylusL555%s%%%-P4S132ro....aAGGAmrrll0000puygg....-l---0000eHAPA2522:lisr555%asop2%%%---0LGLµyylusLs-Pro Multimode Columns0.025% 107 107 0.05% Multimode Columns0.025% Multimode Columns0.025% 106 Colonnes HPLC/UHPLC 111000453GS-2G2GS0-SG3H-25QS02-6H02QH0QGHSQ111-2G0002GS4350-SG3H-25QS02-6H02QH0QHQ GS-2G2GS0-SG3H-25QS02-6H02QH0QHQ Molecular weight (Pullulan)105 MW pl MW Σf pl MΣWf pl Σf Molecular weight (Pullulan) Molecular weight (Pullulan)Multimode Columns104 Glu-Ala-GluGlu-Ala-3G4lu7 G3.lu13-2A4l7a-G0l.u339.12 304.739 3.12 0.39 2 2 Arg-Asp Arg-Asp289 A6r.g725-A8s9p 0.668.75 208.968 6.75 0.68 Shodex™Asahipak - GS-HQ103 Gly-His-LysGly-His-3L4y0s G9.ly9-35H4i0s-L0y.s29.95 304.029 9.95 02.29 Arg-Pro-LysA-Prgro-Pro-4L9y7s-Pro1A1r.g44-P9r7o-L3y.1s21-4P.4ro4 439.724 11.44 3.24 •• SWEiCthisththeecmhoaiicnesoefpealruaetinotn, tmheodceolumn provides multimode features of reversed phase, HILIC, and ion exchange modes to SEC102 102 102 Σf: IHsyoderleocpthrpioΣcfbl::picIHosyiopndeatrlreoacpmthreioctbepircopΣipnflat::rIHasmyodeerlteoecprthriocbpicoipnat rameter p l: • Suita4ble5 ffoo6rr4Edtluhte7ioe5sn avso8lelut6mipEnelau9(gmt7ri4oLans) 1vta0oi8mlo5umn1pe19(l6moeLEf1)sl2u1pt07iooenrpv1o1s8tluuimdb1e2e9(smstLi)ot10urtni1nEC1ulogucleu1lnbm2etuincffaeECcloruileudi::nnm3(tSsp0nhHpmwo6rdM.7oiet)xAthmAe::CEsmsi3(Slopaun0iohlHhemumnoni6ampidMtu.ai7nemnlk)xAaaaGmArlcSysmema-tso3ahin::2tiosepi0(3Supalb0mhHeHkumoQ6fcaGdfM.ec7ueSre)xA-lt3aamA2tersm0abowHhuniQfpiefueam1irkgaGhcSet-ts3a2te0bH1uQffer 1 • Suitable GS-HQFsleorwiersate Flow: r0a.5temL/mi:nF0lo.5wmraLt/emin : 0.5mL/min Column Colu: mShnodex A:CsSoahhluoipmdaenkx GASsa-Hh:iQpSashkeorGdieeSsx-HAQsasheirpiaeks DIDECFDillxeomoutlLweueenemcnrttangnottreshtei(moECFDmllpneooum.tlwesue)::::nmcHr30Rttano0.2I6tOr˚etCmemL/Ppm.ai::::nEDFCrH03Rlleotou.02Iitl6weueO˚cCmnmclrtteaLnot/remteimn p. : H2O DCeotluemctnortemCDpeo.tlue::mc3Utno0Vr˚tC(e2m2S0pn.hm::CDo3U)eo0dVtlue˚Cemc(2txn2o0r™tnemmA)ps.a:: hU30Vi˚pC(2a2k0nGm)S-HQ : 0.6mL/min : RI Manufacturer 0 NuItmemb05er 510 0 MBaates10r1e5ia5l 152010 TarRgae2n02t5g1M5e W 25302m0Pinor(eÅS3)0izm2e5in SepM3a0ormadinteion : Item 30˚CProduct Size (µm) Name An7a.5lysAisxnoafl3yp0s0uisrinoAfenpabula6yrssineises oibnfapbsuerseirnGineS-2bb2e0aHesQres in beer F7600005 SHGS-220HQ 300 − 3,000 150 7.5 x 300 6 GS-320 HQ F7600006 SHGS-320HQ 300 − 20,000 400 TaPnhu77der..55infnoeellupotrwreaxxisPTanlienhzugnaderdittnfniai33ooenet00nlalupf00o.otriwTrnoeahdisdnleieizgcinsaeadtxttdaPTieaiaonenhutmnttdaerfhe.iopniafcnT77nooletteehddelgluepoibdcutirwseraeaalxitdsonsnleaieewizgnimnttahesedsttpacihaipwolntteotuneaagwfbr.dsouiiTensnoadalheddotnseehiwbiccniieGGstearaesesxaSSstdhaepawne--eos56muatatfe22wherolspyid00acrnssldmtteeHHaietesghnbQQdbcauoedeafraaftelasxeonspanearwiusniantsferesoltsiaydnhrhpwmsmeionaiuaspwniernsaliodenswfdrfteexpetaephagrbscueenusarripFFetlniaasanh77aacmnerei66rsnraabfpe00eieolntyeal00dierwoses00mraienepr00asngd78arsaioednunfbifptclndxaeypalcaurrburgrndabseerutitiaeaennhiamoesrgeinnnert:paierdanhieslSSnenwoeabrHHcde.pmtyalGGegursbgodeduSSeiugplni--weanae56acrrgin22nrtrtab:hea00irztheHaHesgiaooeesaQQtun.ermtioaedainnodnnba,gcdwfsyelrueibnegtdhiee(uzaiezngaanergntuite:aodarnhesnnryzoeaa,iy.mtfsnermegeod,ee(gawhzetneyhintdaehdizotnrgaldyzytuiyeiznoamgagnnrt,ea,aiohfsdtrnyheeedawse(otazigldntey1hue5ze0da,g7an0,nr00rtyz0iai0%noiy0dn0enmge−p−tws,eoe2h8igt0rtxy0hchu0ad0aha,n70,otln0o0t0ldh0iyr%n0ei0izcnegaepartt)aoiec.odrinxdcea,hwsnloigtthrhuii27cna7,,ne000a)i00%c.n00iedp,toerxcahnlothriicnea)c. id, 7.5 x Puri5n0e baPsuersinine b9beaesresPinurbineeerbasGesS-i2nGb7eBer FN6o71rm00a1l9beNeorrmal bSeHeGrSN-2oGr7mBal beer Guanase GtrueanteadsebNet.reAer.aGteudanbaeseer treatNed.A.beer 4.6 x 150adenine ad6enine adeninGeS320A-4D F7750312 SHGS320A-4D 300 − 20,000 400 GS320A-4E 300 − 20,000 4.6 x 250 6 Fg7u7a5n0in3e11 guanine SHGS3g2u0aAni-n4eE Polyvinyl alcohol 300 − 3,000 400 Reversed-phase, 300 − 20,000 HILIC, xanthine 20.0 x 300 13 GS-220 20F F6810017 SHGS-22020F 150 Ion-Exchange, 20.0 x 300 SEC 20.0 x 300 guanin1e3 guanine guanine F6810018 SHGS-32020F 400 20.0 x 500 20.0 x 500 GS-320 20F hy1p3oxanthinehypoxanthinGeS-5h2y0p2ox0aFnthine F6810019 SHGS-52020F 5,000x−an2th0in0e,000xanthine 2,000xanthine 300 − 3,000 150 13 xanthine xanGthSin-2e20 20G xanthine F6810034 SHGS-22020G F6810035 1u3ric acid uric acidGS-320u2r0icGacid xanthine xanthine 300 − 20,000 400 SHGS-32020G 20.0 x 500 13 GS-520 20G F6810036 SHGS-52020G 5,000 − 200,000 2,000 7.5 0 x 10 500 2010 2300020 140030 250G04S0m-i2n0G3075B0 m0in40 10 500Fm67in210010021 30020 S14H003G0S-20G250074Bm0 in 3050 m0in 40 10 050 mi2n010 30020 N.14A00.30 25004m0 in 30N5.0Am. in 40 50 min Column Colu: mShnodex A:CsSoahhluoipmdaenkx GASsa-3h2:ip0SahHkoQGdeSx-3A2s0aHhiQpak GS-320 HQ Data providDedatbaypKroiyvoidkeodKbaDynaeKtkiayoopPkroohv.KDida.,endekboy PKhiy.Dok.,o Kaneko Ph.D., Eluent Elue:n1t 50mM S:oE1dlu5iue0nmmt MphSosopdhiua:mt1e5pb0humoffsMeprhS(paotHed2ibu.5um)ffperho(psHp2h.a5t)e buffer (pH2.5) Faculty of PFhaacrumltaycoefutPichaalrmSFcaaicecenuucltteyicsoa, flTPSehickaiyeronmcUaecnsei,vuTetericsikiatyyl oScUineinvceerssi,tyTeikyo University Flow rate Flow: r0a.6temL/mi:nF0lo.6wmraLt/emin : 0.6mL/min Detector Dete:cUtoVr (260nm:DU)eVtec(2t6o0r nm) : UV (260nm) Column temCpo.lu:m3n5˚tCemp. :C3o5lu˚Cmn temp. : 35˚C dLLwoioewatwatmermyro-LdflsoieoioblecweeltuucarlmburayrlloeafwliredbecweidLiuegroieltehawaittrgarwhmyrytaeoftfiilegbibrhce-etusrrlowalarutbwelre-isgohltubwlaet“eUr-smoalumb“UliUe”mmaammii” “Umami” LignosLuilgfonnoiscualfcLoLiiindgginncooasscuuilldffoonniiccaaccidid ttBwdTthhhhiayseeeitaseuaicnqrsrs-cdruesiohinpoagwagalenruroistdttwBTbtahhtnihhhiletifayseeebieieitsotaschleduai,encnqGearsrisa-cedrctmuesnciSothiionpaoaghdowaa-mgralren2nkruysoroispet2bdtuamftniohos0liegtifebbiafnietsaotcehlHthde,elrnttTdwBtorGeaohheniha.QaghiecaytmseewtncSeltmriiot,casahafdoeuaai-rmocnmerqmrmr2asrnksyso-chdrtupece2si)hooumhooi.fnoptosoag0iwognailblgafosanlenedatruoeHthrnoeislrtccobdtarsopetnni.hQagu(letifaeriwtbinilenmrtselo,ccchafladd,efrnoecmeGemamariailehcthcrtmucncS)howtaooia.oattahdooanbe-iltlmerosrree2dnkloiysoaeinddpecc2gusmfpfoosaeftu(0igbahrboieafnnnsealtycterrHtahed,flroecreoern.iQalgchruwtlwamra,actafbetroermemmealihaetiddc)hogoof.teftobnhilloeossedyotrrn,ccspau(arinnelcadfecerilchruwaaatbetereliaeiddgfeftbhoesytrr, 2 3 Sample : 50µSga/mpLlea:c5h0,µ2g0/µmLLSaemacphle, 2:05µ0Lµg/mL each, 20µL Sample : 10S0µaLmple : 100µL Sample : 100µL salt 0.1% 1 1. IMP LignosulfoniLcigancoidsuslofodniuicmascaiLdlitgs0no.o1ds%iuumlfosnaiclta0c.1id%sodium 23. GMP 1. IMP3 1. IMP 2. GMP 2. GMP 2 3. AMP 3. A2MP 3. AMP 4. Inosine 4. Inosine 4. Inosine 5 5. Hyp5oxant5h.inHeypoxan5thine 5. Hypoxanthine 6. Guanosin6e. Guanosine 6. Guanosine 7. Guanine 7. Guanine 7. Guanine 8. Adenosin8e. Adenosine 8. Adenosine 1 9. Adenine 9.1Adenine 9. Adenine 4 47 87 4 8 78 6 69 69 9 2300 10 2535 15 3040 20 3455 25 4500 30 45 3550 040 455 05100 5 15 10200 15255 203100 253155 3m04i20n0 35 25 40 030 535 01m04i0n 515 1020 0 15255 203010 253515 3m40i0n20 35 25 40 30 35 40 min HQ min min 10 15 1200 1255 min min min Column Colu: mShnodex A:CsSoahhluoipmdaenkx GASsa-3h2:ip0SahHkoQGdeSx-3A2s0aHhiQpak GS-320 CDFCElleoooutllweueunmcmrttanontretemDCFECllpeooou.tllweueu:::::nmcmr60RSHttano.0hnI25tr˚eOotCmedmLe/pxm.Ai:::::nDFCCEs0R6HSlleooaou.0hI2tlh5lweueu˚OoCminmcpmdrttaLanoent/krxemteGAimnSspa-2.h2:::::ip0R06HSa0.hIH25k˚OoCmQGdLexS/xm-22Ai2ns0aHhiQpaxk2GSDFCEl-leoou2tlweue2nmc0rttanoHtreQtemxEFDCllpeo2ou.tlweue::::nmcr14U1=ttan0o10.V0tm0r˚etCm0(eM20mL6/N/30pm1an.Him::::nCFDE214U1=ll)Peoou01.0OVtl0wemu0e˚C4mn0mc(M2rt0ataLn6oq/tN/30r.emt/1ane1Hi0mmn2m)PpMO. ::::4N1U41=aa01.0q2V0m0.H˚C/m0(1PM200LO6/mN/304m1ManaHimqnN2.)PaO2H4PaOq4./1a0qm.ECFDClMleoooutllweueuNnmcmartta2nonHtretPeOmCEDFC4llpeoooua.tllqweueu:::::.nmcmrS204Uttano0.0hnV6trm˚eotCm(ed2MmL5e/4pxNmn.aAim:::::nECFCD2sHS20U4ll)eooaou0.0hPVtlh6lweueum˚oCOminmc(pmd2rMtt4aLan5oent/ka4rxeNmtqneGaAi.mmn2SsH)pa-5.Ph2:::::Oip0S20U44a0.0hHV6kam˚oCmQq(Gd2M.L5exS/4xNm-2n5aAim2n2s0H)aHPhOiQp4axka2qG. S-520 HQ x 2 47 47 47 G-20 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

HPLC/UHPLC Columns Aqueous/Organic SEC Shodex™Asahipak GF-HQ Columns Shodex™ Asahipak - GF-HQ HPLC/UHPLC Columns • Polymer-based SEC columns with high solvent durability • Works well with both aqueous and organic solvents Dimensions Shodex™ Asahipak GF-HQ ID x Length (mm) Particle Product Manufacturer Item Base Target MW Pore Size Separation Size (µm) Name Item Number Material Range (Å) Mode 7.5 x 300 7.5 x 300 5 GF-210 HQ F7600000 SHGF-210HQ 100 − 2,000 180 SEC 7.5 x 300 5 GF-310 HQ 200 − 4,000 400 7.5 x 300 5 GF-510 HQ F7600001 SHGF-310HQ 2,000 − 200,000 2,000 7.5 x 300 9 GF-710 HQ 20,000 − 10,000,000 10,000 7.5 x 50 9 GF-7M HQ F7600002 SHGF-510HQ 200 − 10,000,000 10,000 4.6 x 150 9 GF-1G 7B N.A. 20.0 x 300 5 GF-210 4D F7600003 SHGF-710HQ N.A. 180 20.0 x 300 13 GS-310 20F 100 − 2,000 400 20.0 x 500 13 GS-510 20F F7600004 SHGF-7MHQ 200 − 4,000 2,000 20.0 x 500 13 GS-310 20G 2,000 − 200,000 400 7.5 x 50 13 GS-510 20G F6710018 SHGF-1G 7B Polyvinyl alcohol 200 − 4,000 2,000 20 GS-10G 7B F7600200 SHGF-2104D 2,000 − 200,000 N.A. F6810030 SHGS-31020F N.A. F6810031 SHGS-51020F F6810038 SHGS-31020G F6810039 SHGS-51020G F6710020 SHGS-10G7B Dimensions Particle UPsroadbulectsolventsManufacturer Shodex™ MSpak SoTdairugemt MpoWlystyProereneSizseulfoSneaptaersation Size (µm) Name IteGmF-310 Item Base PolyRmaenrsgehaving both h(yÅd)rophobic andMhyoddroephilic functional gro ID x Length (mm) 5 GF-S3o10lv4eBnt GF-210 F760G0F10-0510 *WNhuenmrebpelarcing acetonMitrialet,eerthiayll ex2h0ib0it−h4y,d0r0o0phobic inte4ra0c0tions with packing materials. 4.6 x 50 5 GF-710 4.6 x 150 5 acetate or chloroform with water, When analyzing such polymers, addition of organic solvents to th 4.6 x 250 5 reSpHlGaFc-e31w0i4thB methanol first and 2.0 x 150 GF-310 4D F760G0F11-07M thSeHnGFre-3p1la04cDe with water. ca2n0s0u−pp4r,0e0s0s the hydrop4h0o0bic interaction. SEC *When replacing watePr owlyitvhinyeltahlyclohol GF-3W10a4tEer F7600024 aScHeGtaFt-e31o0r4cEhloroform, replace 200 − 4,000 400 2 Sample : 0.2% each G0cFo--3n0c1.e50nMt2rsaDotidoinum F7600120 with methanol first and then Sodium poly(styren rSepHlGaFc-e31w0i2thD the required eluent Methanol condition. 200 − 4,000 400 3 CH2 CH Ethanol 1 UUssablee ssoollvveennttss **taarWWheccpehhUeenleettaaasnncArtteUaeeSerrcApeeWoebwocsolppDaTtlrervlialloacSMHtaaectehctenWoccobeFhnFhiiimnlwrtlnnstvllaoroeeggieeitroltreoethnowahlrfstfcovwaaoeornetrametmoloGtnrev,lnFwrfrwtei.iet-rsirGistp2ntihlthel1Fatae,-0wcsnte2ehdat1hyte0lyrlGGGG, FFFF----GGGG53771M11FFFFS----0003775oeWPcM111dxao000hhnliyeiubs**craU(TamnraatNWWeuirnomhhteseccapceodhlpeeehhreunepoty**srnleetamteraarat2WWmueodpaeahennhlc)cr0cqsrfytsntpemaohhoeeGeauzrrGssnpvlpeetitbaiel,nwoitaSraohlnnpponyhcarlenagtreoteMrigllfeeceddetaasrrrbcphsceeeGes.ccheb-wiothuolpphc7oayiidmoFwywrlnncrillld0olcittoaa-vhnggcrawhheicr0r7etccretoohetthhpeo1awhhiiemh2npwlnnfrlo0ofncyerwo0ahataoggeildsrenotcaFnyrHteroamthroetwatmbmnohfoootfQiorofocieod,wla2pacneostrn,rwerhrfwnthrira.immieus2Gterpsenmooirotistp0,rttwirerSel,hlbletnheGelafwrfstarwii-riat.icpedh,oeta7orwhcirniistedapac1satilenhlpvdathttnirel0ntaiyhaeataoaioe,deowlcycn2tnntelitrnelk.hh0tv.da,tesiyyhFenotdelsygfrrlomo, rpagShtaeionlSSriecPWciiaodacSxaomdhlfMMMhnslisuioyeupi.uwwwboPcWesnmmnldexuailcomt:::vhehanp:tpli841ehyeirin0puoo4,8bsynsm6n.alr,9nu2diytp60emthl,se(%apar000ysshaoornl00ptztsysyvpoe0gairdrlnpiteahehrlnyhrtygcosnoaohgoehzsseubvpes,ihblpnitsituh5cnyheyuogsyc0ogdellitsfµuhnbrmhosrLhbetoitenupceahyonpaycrodynittthahnerhldrocy)etorpetmbhpoironoyiha2pcesldnocyheriusrstnmbooi,otwilb2pceesanfiirhrtcdiousasnhodc,tawnlbpetianftiiiaroatcidodaohcndctanknh.ptienityinaooaiddosgcfntrnkho.moeiynropagdsgfhtareoimonlSSrirpciiagoaachmdtalfesisuinlupSS.rioncimilaoeaclcmvdlf:tpssueiiup0.ooonnml.len2ylctvs(%a:tpsei0ltootnyo.eSgln2rytaeOrs(%atcsonh3lth Solvent GF-210 GF-310 Aqueous/Organic SEC Columns GF-510 Water GF-710 GF-7M c0o-n0c.e5nMtrsaotidoinum cwreoiptnhldamc0cCitoMei-ehon0ctwlne.ohec05.tnoiMaMr-thtnohnr0acsaef.ooet5tnoitnhdMolhortinfeurmaislamrotrsnideotoinqualmunidretdheenluent withwmithetmhaentohlafnirosltfairnsdt atnhden3then 0 5 10 3 3 15 20 2 Methanol replarecpelawciethwthithe rtheqeureirqeduireeludeenltuent ColuCmHn2 CH: Shodex Asahipak GF-510 HQ CH2 CH2CH condcoitinodni.tion. Eluent : 50mM LiCl aq./CH3CN=60/40 Ethylacetate Ethanol EthaEnthoal nol 1 Flow rate : 0.6mL/m1 in 1 T(Nhoeteu)AsacDbeAltMeocSnseoiOtolrvinleeintrtislefor preparat0iv~e50% (Not(eN)ote) CDeotluemctnortempS.O::3NU30aV˚C(254nnm) SO3 columns of GF-710 HQ, GS-710 20F MwTcoh: 8leu,cT6mu0ohs0nleuasmbuolsnefasGsboolFefl-vG7se1oFn0l-tvs7He1fnQo0t,rsHGpfQorSe,r-pG7pa1rSer0-ap72tai10vr0Fea2ti0vFe Acetonitrile Mw :M8w,60: 08,600 THF aarUernscedeor2meouC0qfsmaGuGilien,SriDTenbagMdMdHrre.e-aFpFD7Tdwtu0MHiaw0olFtFlhe2nuer0lnaFcanounodtrrh(mv2ee0erelGussthoeiafslvnoneotrn:l.tGsHF2-OH)Q seMrwraUiene:sc4deso8arU2,meo6ns0cf0dmeG0oG2meo,S0nfamMGdGree-,S7ndwauCM0drawe0sae-t7hiedw2ln0ier0abw0gnaFtrhne2ooaPerd0trtnhaFEm2ienoooG0rdetnGrhst/mh2oePica0slrevEnGusteohOornilaslv.tvns(eeoensll.tusfeonr tG:MFDw-MH:M4QFw8,)6:s040e8,6r0ie0 s Polyacrylonitrile DMF Mwar:e14ra9er,qe00ur0eirqedu.ired. Mw :M1w49:,010409,000 Sample : Polyacrylonitrile Acetone Ac1e0A7tocneetone 107 0 5 10 15 020 0 525 m5 in 10 10 15 15 20 20 2 Chloroform ChloCrholfoorromform Column : S50hmodMexL1iAC06sl aahqi.p/CaHk3GCFN-=56100/H40Q ColuCmonlumn : Sho: dSehxodAesxahAispaahkipGaFk-5G1F0-5H1Q0 HQ Eluent : 106 EluenEtluent : 500.6m::m50ML0.6/mLmmiCMiLnl/LmaiqCin./l CaHq.3/CCNH=3C60N/=4600/40 FlowFrloatwe rate : Ethylacetate Molecular weight (Pullulan)EthyEltahcyelatacteetateGF-510 HQ G0F-~7150 0HQ~%50%DFCleootlwuemcrtanotretemp. : 0.6mL/min Molecular weight (PEG/PEO) D1M05SDOMSO : U30V˚C(254n10m5 ) DMSO 0~50% : GF-510 HQ DeteDcteoter ctor : UV:(2U5V4n(2m54) nm) GF-7G10FH-7QM HQ ColuCmonlutmemnpte. m: 3p0. ˚:C30˚C GF-7M HQ GF-310 HQ uCsailuCni11b00sga43rilnaPibgPtEirooGaPnlt/GEyiFPo-cGa21Enu0c/HOPrQrcvEyu(eelOrsoSlvaun(efmeoisptlnrluerftGi:eo:lPnreFDolt-yGM:HacFDQrFy-Ml)HosnQFietr)irlesie0e.s1r%ie, s100µL GF-210 Calibration curves for GF-HQ series uCsailCuni1b0sga4rilnapibguCtirsolaaplinlutnuiiblgolcalrnuunaPlrtcaE(vieounGelnrus/(vePceflEnouustrOre:fvGnoH(eetrFs2:l-GOuHHfeFo)2Qn-rOHtGs):QeFDr-siMHeeQsFri)esseries GF-310 HQ PolPyoalcyrayclorynliotnriilterile using pullulan (eluent: H2O) 103 HQ SampSlaem: pPloely: aPcorlyylaocnrityrliolen 107 [email protected] 107 107 102 1 888-226-2775 :: :: www.lifescience.ca G-21 CANADIAN 106 106 1036 4106 5 6 7 8 9 10 11 106 1036 4 5 6 7 8 9 1L0 IF11E SCIENC0 E 5 10 15 20 25 30 G GElution volume (mL) Elution volume (mL) n) n) O) ) ) O)

Colonnes HPLC/UHPLC Shodex™ GPC Columns (General Analysis): THF Shodex™ GPC KF - KF-800 • Standard organic solvent SEC (GPC) column • Supports a wide range of applications from low to high molecular weight compounds • Fulfills USP L21 requirements • Shipping solvent Tetrahydrofuran (THF) Colonnes HPLC/UHPLC Dimensions Shodex™ GPC KF Molecular weight (Polystyrene) Molecular weight (Polystyrene)ID x Length (mm)ParticleProductManufacturer Item Base Target MW Pore Size Separation Size (µm) Name Item Number Material Range (Å) Mode 8.0 x 300 6 GPC KF-801 F6028010 SHKF-801 100 − 700 50 8.0 x 300 6 GPC KF-802 F6028020 SHKF-802 300 − 3,000 150 Calibration curves for KF-800 series Calibration curves for KF-800L 300 8.0 usx ing30p0olystyre6ne GPC KF-802.5 (lineFa6r02t8y0p25e) seriesSuHsKiFn-8g02p.5olystyrene Fat-solub3l0e0 −v3i,t0a00mins Organic SEC (GPC) Columns (General Analysis): THF 8.0 x 300 6 GPC KF-803 F6028030 SHKF-803 1,000 − 50,000 Sample : 1005µL00 GPC KF-803L 10F76027030 SHKF-803L 1. Vitamin A palmitate 8.0 x 103700 6 KF-806 GPC KF-804 KF-806L SHKF-804 100 − 50,3000 KF-805 GPC KF-804L F6028040 SHKF-804L 505000µg/mL 8.0 x 300 GPC KF-805 SHKF-805 2. Vitamin E 50µg/mL KF-807 GPC KF-805L 106 SHKF-805L 106 7 GPC KF-806 SHKF-806 7,000 − 300,0003. Vitamin D31,50500µg/mL KF-801470 GPC KF-806M F6027040 SHKF-806M 8.0 x 300 GPC KF-806L SHKF-806L 4. Vitamin K3 50µg/mL GPC KF-807 10F56028050 SHKF-807 8.0 x 103500 KF-805L KF-807L 100 − 300,000 1,500 F6027050 10F46028060 KF-80K4FL-803L Styrene divinylbenzene 50,000 − 2,000,000 5,000 copolymer KF1-8003 10F36028090 8.0 x 300 KF-806M F6027060 300 − 2,000,000 5,000 GPC KF-802 10F26028070 10,000 104 11K00F-802.5 4 10,000 10,000 8.0 x 300 150,000 − 120,000,000 8.0 x 103300 8.0 x 300 KF-801 10 1,000 − 202,000,000 300 − 20,000,000 8.0 x 103200 18 300,000 − 200,000,000 20,000 8.0 x 3005 6 718 8 9 10 11GPC12KF1-8307L F602570706 7 8 SH9KF-18007L11 12 13 300 − 20,000,000 20,000 F6700300 Elution volume (mL) Elution volume (mL) 5 10 15 20 25 min 4.6 x 10 8 GPC KF-G SHKF-G N.A. N.A. Column : 1TS1.Hh00oFmdLe/xmGinPCGKPFC-88K00F06-L8s,0e80r0iDe6sMKi,t:8K0F7-L805L, Column : Shodex GPC KF-800L series CFEllooulweunmrtasnteepSaorlavteion:::nt-S1Tpc.Hh0eooFmaludkmLe/xnmGinPC 1K,F5-0800, 110x,0200, : 20,000 8.0 x Elue1n0t0 : ElFu6e7n0t 9350 : THF SHKF-800D Flow rate : 1.0mL/min Flow rate Detector : RI Detector : RI Detector : UV (280nm) Column temp. : 40˚C Column temp. : 40˚C Column temp. : 40˚C PolystyProelnyestsytraenndeasrtdasndards 7 12 Sample : 50µL Sample : 50µL 1. Polystyrene (Mw : 133,000) 0.1% 6 1. Polystyrene (Mw : 19,825,000) 0.05% 2. Polystyrene (Mw : 55,100) 0.1% 4 2. Polystyrene (Mw : 1,320,000) 0.1% 3 3. Polystyrene (Mw : 19,600) 0.1% 3. Polystyrene (Mw : 133,000) 0.1% 5 3 4. Polystyrene (Mw : 7,210) 0.1% 2 4. Polystyrene (Mw : 7,210) 0.1% 5. Polystyrene (Mw : 3,070) 0.1% 5. Polystyrene (Mw : 580) 0.1% 6. Polystyrene (Mw : 580) 0.1% 6. Toluene (Mw : 92) 0.1% 7. Toluene (Mw: 92) 0.15% 4 5 6 1 0 5 10 15 20 25 30 min 0 5 10 15 20 25 30 min Column : Shodex GPC KF-803L x 2 Column : Shodex GPC KF-807L x 2 Eluent : THF Eluent : THF Flow rate : 1.0mL/min Flow rate : 1.0mL/min Detector : UV (254nm) Detector : UV (254nm) Column temp. : 40˚C Column temp. : 40˚C Styrene isoprene ABA block copolymer Polycarbonate resin Raw rubber Sample : Styrene isoprene ABA block copolymer Sample : Polycarbonate resin 0.1%, 100µL Sample : Rubber 0.1%, 300µL G-22 CANADIAN CH3 LIFE SCIENCE 1 8O88-22CC6H3-27O75CO n :: [email protected] :: www.lifescience.ca

HPLC/UHPLC Columns Organic SEC (GPC) Columns (General Analysis): Chloroform HPLC/UHPLC Columns Shodex™ GPC - K-800 • Standard organic solvent SEC (GPC) column • Supports a wide range of applications from low to high molecular weight compounds • Fulfills USP L21 requirements • Shipping solvent Chloroform Dimensions Shodex™ GPC K ID x Length (mm) Particle Product Manufacturer Item Base Target MW Pore Size Separation Size (µm) Name Item Number Material Range (Å) Mode 8.0 x 300 8.0 x 300 6 GPC K-801 F6028110 SHK-801 100 − 700 50 GPC 8.0 x 300 6 GPC K-802 F6028120 300 − 3,000 150 8.0 x 300 6 GPC K-802.5 F6028125 SHK-802 300 − 8,000 300 8.0 x 300 6 GPC K-803 F6028130 1,000 − 50,000 500 8.0 x 300 6 GPC K-803L F6028194 SHK-802.5 100 − 50,000 500 8.0 x 300 7 GPC K-804 F6028140 7,000 − 300,000 1,500 8.0 x 300 7 GPC K-804L F6028195 SHK-803 100 − 300,000 1,500 8.0 x 300 10 GPC K-805 F6028150 50,000 − 2,000,000 5,000 8.0 x 300 10 GPC K-805L F6028196 SHK-803L 300 − 2,000,000 5,000 8.0 x 300 10 GPC K-806 F6028160 150,000 − 20,000,000 10,000 8.0 x 300 10 GPC K-806M F6028190 SHK-804 1,000 − 20,000,000 10,000 8.0 x 300 10 GPC K-806L F6028197 300 − 20,000,000 10,000 4.6 x 10 18 GPC K-807L F6028198 SHK-804L 300 − 200,000,000 20,000 8 GPC K-G F6700401 N.A. 8.0 x 100 GPC K-800D Kit: K-805L, SHK-805 Styrene divinylbenzene N.A. 1,500, 10,000, 10 806L, 806M, 807L F6709450 SHK-805L copolymer Solvent-peak 20,000 separation column SHK-806 SHK-806M SHK-806L SHK-807L SHK-G SHK-800D EpEopxoyxyrerseisninEpoxy resin Low moleculLaor Lwpoowmlyomdliemocleeuctlhaurylalpsroipllooyxdlayidnmiemestehtyhlsyillsoilxoaxnaenses Organic SEC (GPC) Columns (General Analysis): Chloroform Organic SEC (GPC) Columns (General Analysis): Chloroform Sample : Epikote 1001 0.1%, 100µL 3 3 Sample : Epikote 1001 0.1%, 100µL Sample : 0.1% each, 100µL 2 1. PolydimethylsiloxaneSam(MpWle:7: 700.1) % each, 1020µL 2. Polydimethylsiloxane1. P(MoWlyd:2im37e)thylsiloxane (MW:770) 3. Hexamethyldisiloxan2e. P(MoWlyd:1im62e)thylsiloxane (MW:237) 3. Hexamethyldisiloxane (MW:162) 1 1 10 15 20 min 20 min 0 5 10 15 20 15 25 25 10 15 0 5 10 min 20 min Column : SChholodCroeofxolurGmmPnC K-803: LShxo2dex GPC K-803L x 2 Column : Shodex GPC K-801 x 2 Eluent : : ChloCroofolurmmn : Shodex GPC K-801 x 2 : 1.0mELl/umenint : Chloroform Eluent Flow rate : 1.0mELl/umenint : Chloroform : UV (2F5lo4wnmra)te : 1.0mL/min Flow rate Detector : RI (pFolloawrityra:te-) : 1.0mL/min Column temp. : RoomDetteemctpo.r : UV (254nm) Detector Column temp. : 40˚CDetector : RI (polarity : -) Column temp. : Room temp. Column temp. : 40˚C Polylactic acPidolylactic acid Silicone oil Silicone oil Sample : Polylactic acid 0.2%, 50µL Sample : Silicone oil 0.1%, 200µL G-23 Sample : Polylactic acid 0.2%, 50µL Sample : Silicone oil 0.1%, 200µL 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN LIFE SCIENCE

Colonnes HPLC/UHPLC Organic SEC (GPC) Columns (General Analysis): DMF Colonnes HPLC/UHPLC KD-800 Calibration curves for KD-800 series Polyvinylpyrrolidone • Standard organic solvent SEC (GPC) column using PEG/PEO Sample : Polyvinylpyrrolidone 0.2% • Supports a wide range of applications from low to high molecular weight compounds (A) K-30 400µL (B) K-60 500µL • Fulfills USP L21 requirements 107 (C) K-90 500µL Dimensions Shodex™ GPC KD 106 KD-807 (A) KD-806 ID x Length (mm) Particle Product Manufacturer Item Base Molecular weight (PEG/PEO) KD-804TarRgaeKnDt-g8M0e5 W Pore Size Separation Size (µm) Name Item Number Mate1r0i5al (Å) Mode 8.0 x 300 6 GPC KD-801 F6028210 SHKD-801 104 KD-8013 00 − 1,500KD-806M 50 (B) 8.0 x 300 6 GPC KD-802 F6028220 SHKD-802 200 − 4,000 150 8.0 x 300 6 GPC KD-802.5 F6028225 SHKD-802.5 103 KD-802400 − 10,000 300 KD-801 KD-802.5 8.0 x 300 6 GPC KD-803CalibrationF6c02u8r2v30es for KDS-H8K0D0-80s3eries Polyvinylpyrro1,l0i0d0o− n50e,0s00 500 8.0 x 300 7 using PEG/PEO Mela(Cm) ine formalde 8.0 x 300 10 8.0 x 300 10 GPC KD-804 F6028240 SHKD-804 Styrene divSian1my0l2bpelen:zPeonleyvinylpyrr4o,l0id0o0ne− 200,000 1,500 GPC Sample Melamin 0.2% each 0 copo(Aly)mKe-3r0 5 4006µL 730,0800 −94,00100,00101 12 135,000 20 GPC KD-805 F6028250 SHKD-805 (B) K-60 500µL Elution volume (mL) 10 GPC KD-806 107 F6028260 SHKD-806 (C) K-90 500µL 30,000 − 40,000,000 10,000 8.0 x 300 10 GPC KD-806M 106 F6028290 SHKD-806M CElouleunm(tA)n : SD1h,M0o0Fd0e−x 4G0P,0C00K,0D0-0800 series10,000 Column : Shodex GP : Eluent : 10mM LiBr 8.0 x 300 Molecular weight (PEG/PEO) KD-807 PolyvinylDFCpleooytlwuermcrrtanootretleimdpo. n:::514R0e.0,I00˚sCm00L/−mN2i.n0A0.,000,000 20N,.0A0M.0 elaminFDCeleootlwfueomcrtarnotmretemapl.d::: eR15.0Ih0˚CmyLd/meinr 4.6 x 10 Molecular weight (PEG/PEO) KD-806 18 GuCGPsPaCCilnKiKbDgDr-8-aPG0t7EioGn/1Pc0E5uOrvesFF66f70o02KrD08-42K8017410D-80KD0-80s5 eSrSHieHKKsDD-8-G07 8 M10e4 lamine fKoD-r80m3 aldehyde resin KD-806M Sample : Polyvinylpyrrolidone 0.2% each Sample : 30µL Melamine-formaldehy PMo10le3ylvaimnyilnpeyKrfDro-8o0r2lmidaolndeshyde resin (A) K-30 400µL C5500e00CMµµleLLleulllluao(Blm)soesinsees Sample : 100µL ries CuCsePsaairlolniiibeblgyrsravPautiEtniisoGoyinn/lnPpgcEcyuPurOrErvroGevlse/idsPfooEfronOrKeDKsD-8-08000series 107 (B) K-60 formaldehyde resin Cellulose ca. 0. (C) K-90 106 KD-802.5 KD-807 (A) 107 Organic SEC (GPC) Columns (General Analysis): DMF Solvent-peak Separation Columns for KF-806L+ KD-801 KD-806 Sample : Polyvinylpyrrolidone 0.2% each Sample : PolyvinylpyrrolidoSnaem0p.2le%: 3e0aµcLh Sample : 30µL Organic SEC (GPC) Columns (General Analysis): DMF Solvent-peak Separation Columns for (A) K-30 400µL (A) K-30 400µL Melamine-formaldehyde resin 1% (C) Melamine-formaldehyde resin 1% ((CB)1) 0KK7--6900 500µL 105 ((CB))1KK02--K69D00-804 550000µµLLKD-805 106 Cellulose is 500µL 10 1ais5nrdeqreupireead2te0tod 0 106 (A) 104 K(DA5-)803 6 KD-806M7 8 9 10 11 12 13 (B) 10 20 30 min solution. Th Elution volume (mL) Molecular mass Molecular weight (PEG/PEO) KD-807 FCEllooulweKunDmr-t8a0nt2e : Shodex GPC KD-800 series EC10lou5leunmt n : Shodex GPC KD-806M x 2 Column c o:mShpol edteexl yGP KD-806 : DMF : 10mM LiBr in DMF CFEDlleooutlweuenmcrttanotretempd6co.r0fe::::ytpdsh1R15ate0.0eIa0ym˚nClmscldiM.enLsli/ltLmuyoilBioannr 105 KD-804 KD-805 KD-802.5: 1.0mL/min 104 (B) KD-803 103 KD-801 Flow rate : 1.0mL/min KD-806M Detector : RI (C) Detector : RI 102 Colum(Bn) temp. : 40˚C Column temp. : 50˚C 104 103 KD-802 KD-802.5 5 6 7 8 9 10 11 12 13 KD-801 0 10 20 30 min 10 Ph1e5noxy 2r0esin 25 mi CellulEolutsionevsolume (mL) 103 (C) (C) 102 Column 10::7 Shodex GPC KD-800 series Column : 6Shodex GPC7KD-806M x 28 9 Column10 : Shod1e1x GPC KD-802 Eluent DMF Eluent Eluent : 10mM LiBr in DMF : 10mM LiBSraimn pDleM:F100µL Elution volume (mL) : 1.0mL/minCellulose ca. 0.05% each 13 5 6 7 8 9 10 11 12 13 Flow rate : 1.0mL/min Flow rate C:1o0RluI mn 15 : Shod2e0x GPC KD25-8m0i6nM Flow rate : 1.0mL/min 0 10 Elution volu2m0 e (mL) 30 min Detector 0: 1R0I 1015 2200 2350 mmiinn Detector : 1% LiCl in *DMI Detector : RI Column temp.E:lu5e0n˚Ct Column temp. : 40˚C Column temp. : 50˚C 106 Flow rate Cel:lu0l.o5mseL/ims idnif ficult to dissolve s CCoolulummnn : :SShhooddeexxGGPPCCKKDD-8-8006sMerxie2s CCoolulummnn : :SShhooddeexxGGPPCCKKDD-8-80062Mxx22 CDoelutemcntor an:d:SrRheoIp,deMeaAxteLGdSPs(CMoluKvleDtin-at8nr0ge2lpexlali2gchetmsecnattering) Data provided by Dr. Masah EElulueennt t : :D1M0FmM LiBr in DMF Molecular mass EElulueennt t : :1100mmMMLLiBiBr rininDDMMFF ElCuoenlutmn temisp:.re:1q06um0i˚rMCedLitBorpinreDpMarFe the cellulose Isogai group, FFlolowwraratete : :11.0.0mmLL/m/minin CellulosesFFlolowwraratete : :11.0.0mmLL/m/minin Flow rate s o: l1u.t0imo nL/.mTinh e t i m e r e quired stPoe henoxy rGerasdiunate School of Agricult DDeetetecctotor r : :RRI I CD1CD0eo5eotluetluemcmctnotnortretemmpp. .:: :RRI I D*eDteMcIto1r,3-dimc oe:tmhRyIpl-l2e-time liydadzoi slisdoinlovnee cellulo Tokyo CCoolulummnntetemmpp. .: :4500˚C˚C :5500˚C˚C The University of 107 Column tempd. e: p50e˚nCd s o n t h e s o l v e n t t y p e , PotatSCoaemllusploltesae: 1rc0ac0.c6ohµ0r0fL.y0tdsh5at%eaylsclei.enaliclthuyloansed. molecular weight This can be 1 to Sample : Celluloses Ph10e4 noxy resin Phenoxy resin Effects of solvPehennotx-yp 106 SampClee: l1lu00loµLse is dif ficult to dissolve Sample : Poly(vinyl chloride) 103 PotatoanstdarrcehpineaDtMedSOso0l.v1e%nt replacement 107 Sample : 100µL Molecular mass Sample : 100µL Sample : 250µL *solveids arte8q0u°iCred to prepare the ceSllaumlopsle : 250µL Cellulose ca. 0.05% each Cellulose ca. 0.05%Pheeancohxy resin 0.2% s o l u t i o n . T h e t i m e r e q u i rPehdenotoxy resin 0.2% 105 678 9 10 c o m p l e1t1e l y d i s s o l ve c e l l u l o s e KF-806L15 20 106 Cellulose is dif ficult to dissolve Cellulose is dif fEicluutioltn tvooludmises(moLlv) e depends on the solvent type, crystallinity and molecular weight and repeated solvent replacement Column and: rSehpoedaetexdGsPoClveKnDt -r8e0p6laMcement FEDClleooutlweuenmcrttanotretemccdsisprooeyr.lmepsu::::qte10R6tpauin%.0Illo5i,ler˚diCmneMntLsd.ieLtAiCyl/TotLymolhaSniindpnen(trdMi*ehstDiumpsemMlaotoisIrelleaveonrectleghvuleqceelaeucnlrileigtlrwluheltuetlydolisogpcstsheaoeett,tering) of the cellulose. This can be 1 to is required to prepare the cellulose *DMI 1,3-dim6o0fettdhhayeyl-sc2.e-ilmluildoaszeo.lidTihniosncean be 1 to Molecular mass 60 days. Column : Shodex G solution. The time required to 104 completely dissolve cellulose Data provided by Dr. Masahiko Yanagisawa, Eluent : 10mM LiB 105 Isogai group, depends on the solvent type, Graduate School of Agricultural and Life Sciences, Flow rate : 1.0mL/min The University of Tokyo crystallinity and molecular weight De0tector : R5I Column temp. : 50˚C of the cellulose. This can be 1 to 103 60 days. 104 6 7 8 9 10 11 Elution volume (mL) 15 20 2 ColuPmontato :sSthaodrecxhGPC KD-806M Effects of solvent-peak separation columnKF-806L + KF-800D 0 5 10 15 Eluent : 1% LiCl in *DMI min Column : Shodex GPC KD-806 103 10 6 1 888-226-2775 :: [email protected] :: www.lifescience.caFCDleootlwuemcr1taSP*no0staoroetmtleavmpteoldepsa.:tat:::1r80c0R600h.0I°5µ,˚CiCLmnM1151DLA/MLmSinO(M0u.1lt%i a2n0gle 9 11 789 light scattering) GDTIsharoaetgadaUupinargiotFCEvrevoleloouiSurdlwesSupcCeinath,mdrytomKoalnbooFtpueyfl-lme8ToD0of:nr6kAP.L1yMog5o:::lryai1S1c(sv.0uha0inlmoht:myuidMklSrLeoach/hlxLmYoalioGaBdninrndeirPda2xieCLng0)iGifsDKePaMDSwCc-Sa8iK,eO0nD/6cD-Me8Ms0D(,DF26O=5iMoP7cm5txyi/nl22p5hthalatCEFDell)eooutlweuenmcrttanot1ret0e6m0p. : 10mM LiBr in DMF e (mL) Elution volume (mL) 25 min : 1.0mL/min : RI G-24 Column : SChodAexNGPCAKDD-8I0A6MN *DMI 1,3-dimethyl-2-imidazolidinone tyrene) : 50˚C Eluent : 1%LILFiCEl inS*DCMIIENCE Column : Shodex GPC KD-806M x 2 5

HPLC/UHPLC Columns Organic SEC (GPC) Columns: Rapid Analysis, High Performance Analysis Shodex™ GPC Rapid analysis - KF-600 High performance - KF-400HQ HPLC/UHPLC Columns • Achieves approximately half the analysis time compared • Achieves approximately 1.5 times better separation Organic SEC (GPC) Columns: Rapid Analysis, High Performance Analysis with standard columns performance than standard columns, obtains higher • The amount of solvent used is reduced to about a third resolution • Improved applicability of solvent replacement • It was approximately 4 times better sensitivity than that of • Fulfills USP L21 requirements standard columns, and supports high sensitivity analysis • The amount of solvent used is reduced to about a third • Improved applicability of solvent replacement • Fulfills USP L21 requirements Dimensions Shodex™ GPC Rapid analysis KF-600 and High performance KF-400 HQ ID x Length (mm) Particle Product Manufacturer Item Base Target MW Pore Size Separation Size (µm) Name Item Number Material Range (Å) Mode 6.0 x 150 3 GPC KF-601 F6028091 SHKF-601 100 − 700 50 GPC Calibra6t.0ion cx urv1e50s for KF3-600 seriesGPuCsKiFn-g602polystyrenF6e028092 CalibratSiHoKnF-6c0u2rves for KF-400HQ series u2s00in−g1,5p0o0lystyrene 150 6.0 x 150 3 GPC KF-602.5 F6028093 SHKF-602.5 300 − 10,000 300 6.0 x 107 150 3 GPC KF-603 F6028094 SHKF-610037 KF-405LHQ 600 − 50,000 500 6.0 x 150 F6028095 SHKF-604 7,000 − 500,000 1,500 6.0 x 106 150 KFK-6F0-6706 F6028096 SHKF-610056 50,000 − 2,000,000 5,000 KF-604 F6028097 150,000 − 20,000,000 10,000 6.0 x 150 3 GPC KF-604 F6028098 SHKF-606 1,000 − 20,000,000 10,000 105 F6700300 105 N.A. 10 KF-605 GPC KF-605 KF-404HQ N.A. 6.0 x 150 10 GPC KF-606 SHKF-606M Molecular weight (Polystyrene) KF-406LHQ 4.6 x 104 10 Molecular weight (Polystyrene) SHKF-1G04 10 GPC KF-606M KF-606M Styrene divinylbenzene copolymer KKFF-6-60032.5 KF-K4F0-34H0Q2.5KHFQ-401HQ 8 GPC KF-G 4.6 x 250 KF-6023 GPC KF-401HQ F6028111 SHKF-401HQ KF-402HQ 100 − 700 50 KF-6013 GPC KF-402HQ F6028112 200 − 1,500 150 103 103 4.6 x 250 SHKF-402HQ 4.6 x 102 250 3 GPC KF-402.5HQ F6028114 SHKF-4021.052HQ 300 − 10,000 300 F6028116 500 4.6 x 2510.0 1.5 3 2.0 2.5 G3.P0 C KF3-.5403HQ F6028118 SHKF-403HQ 1.0 1.5 2.0 2.5 3.0 3.6500 − 50,000 1,500 F6028119 5,000 4.6 x 250 El3ution volume (mL) GPC KF-404HQ F6028122 SHKF-404HQ Elution volume (mL) 7,000 − 500,000 10,000 4.6 x ECloule2un5mt0n : STHh1o0Fdex GPC KF-G60P0CsKeFri-e4s05LHQ SHKF-405LCEHlouQleunmt n : Shodex GPC KF-400HQ30s0er−ie2s,000,000 : : THF 4.6 x DFleotwe2c5rt0aotre : R0.I15(0msmL/amll icnell volumGeP)C KF-406LHQ SHKF-406LDFHleoQtwecrtaotre : 0.3mL/min 300 − 20,000,000 : : RI (small cell volume) Column temp. : 40˚C Column temp. : 40˚C Comparison of standard, rapid analysis, and high performance type columns Comparison of standard, rapid analysis, and high performance type columns Sample : EPON1001 0.2% Standard type 21mL KF-602.5 provides rapid analysis by reducing the analysis KF-802.5 x 2 5.7mL time; less than half of the analysis time of KF-802.5. Having 50µL injection 1.5 times more theoretical plate number than standard column, KF-402.5HQ provides improved resolution especially for the High performance type separation of small to medium molecular weight substances. KF-402.5HQ x 2 Rapid analysis and high performance type columns use less 10µL injection than one third of solvent per analysis compared to standard type columns do. Rapid analysis type KF-602.5 x 2 Column : Shodex GPC KF-802.5 x 2 10µL injection Shodex GPC KF-402.5HQ x 2 05 Shodex GPC KF-602.5 x 2 6.0mL Eluent : THF 10 Flow rate : 1.0mL/min (KF-802.5) 0.3mL/min (KF-402.5HQ) 0.6mL/min (KF-602.5) Detector : RI (conventional type) (KF-802.5) RI (small cell volume) (KF-402.5HQ, KF-602.5) Column temp. : 40˚C 15 20 25 min Styrene acrylonitrile copolymer Liquid paraffin Phthalates 1 888-226-2775 :: [email protected] :: www.lifescience.ca Sample : 10µL CANADIAN G-25 1. Dioctyl phthalate 0.1% Sample : Styrene-Acrylonitrile (30:70) copolymer Sample : Liquid paraffin 1%, 5µL LIFE SCIENCE

Product Code Product Name Plate Number Particle Size Pore Size Column Size (mm) (TP/column) (µm) (Å) I.D. x Length Colonnes HPLC/UHPLCCalibration curvesF60f2o6r14H0 K-400 sGePrCiHeKs-HFIP404LCalibra≥ti9o,0n00 curves for3.H5 K-400 seri8e00s using polystyrene (eluent: THF) using PEG/PEO (eluent: DMF) Calib4.r6a× t1i5o0 n curve f using PMMA (eluen *The column with ‘L’ at the end of column names is mixed-gel column capable of Base Material: Styrene divinylbenzene copolymer analyzing samples over a wide range of molecular weight distribution. *See page 66 for details of other columns filled with HFIP. 1O07 rganic SEC (GPC) Columns: Ultra-Rapid A1n07alysis 107 Colonnes HPLC/UHPLC Molecular weight (Polystyrene) Molecular weight (PEG/PEO) Molecular weight (PMMA) Shodex™ GPC UltGrau-Raarpdidfialtnearlyfsoisr- HHKK-4s0e0ries 106 1•06 NpaecwkliyngdemvaetleoPrpireaodlduscttyCroednee divinylbePnrozdeuncteNcaompeolymer mo1n06o-dCisopneternstesd particle HK-405 105 HK-404L 104 HK-405 *Allows direct attachment to the analytical column HK-404L 1•05 Analysis time isF6re70d0u2c0e0d to about oGnPeCsHixKth-Gof a convenOt1ino0e5nhaolldceorluanmdno’nseafinltaerlysis time 103 • Low column prFe6s7s0u0r1e00even under hGiPghC fHlKo-wG rfailtteer- does not req3ufiilrteersa UHPLC system 1•04 The amount of solvent used is reduced to about ainssoilxutbhle1c0o4mponents • HK-HFIP404L is filled with HFIP in the sample Removes • Fulfills USP LH2K1-40r1equirements 103 HK-401 103 102 Target molecular weight range and exclusion limit Measured with polystyrene (eluent: TSHhFo)de1x0™2 GPC Ultra-RapidManeaalsyusirseHdKw-4it0h0*PMMA (eluent: HFIP) 102 Dimensions E1luPtiorSoHnPidz1Kaveu.r-2oct34(ltiuµ0cNmml1eae1m).(4me L) 1T.6argePt1NrM.o8adomlueecc2tu.l0ar WeighMt RaannuIgtfeeamctuErexcrlu0si.o6nNLuIitmm0e.mi8bt er E1lutionH1Pv.Kr2ooM-lduHBmuaFcate1IetsP.(4Nrem4iaa0Lml4) e1L.6 T1a.Tr8gaerRgtaeM2nt.og0MleecWular WePigohr(etÅRS)aiznege SeE0pMx.ca62olru0ads0teiio,0o0n.0n8L0imitE1lution1v.2o ID0x.6Length0.(8mm) GPC HK1-04001− 1,500 2,0S0H0HK-401 4.6 x 150 F6025010 1005−,01,05000− 200,000 50 ::::111555T1RS000.HhI0*w(oPFmslhdemLeaenHH/saxmeslKKleGu--i33cln3s44e..P55eec00ltCl45tihnvLegHoaclKuboolm-uv4mee0n)t0GasP.bsGGClePePH1CrfC0Koi1He,-Hr0H0KKrs0F0-e-4I40fP−0e044−5r1L0e,42n0L,c05e00,p00u,00r0p0o0seFFFs666000o222n656l001y454CFDE000lleooutlweeu41nc,,mr00tta00onSt00reH,,S00HSH00HKH00-HHKKF--4I4P0::::0445L0RSD14.hILM0(omsFd*mrsPLeeeSlf/aeltexemyalrrclseeGtincennincePceougdeplsCilovcepilvonyuHtmyolhurlbepleKmueronam-nszb4seeoe.ns0ev)0oenstlaye1bw0r15le,0i,h00e00ef0os0−0nr−−1,202,005000,,000,0000000 Colum4.6n x *P2M,0M00A: PColoymluemthynlmethacry:laStehodex Eluent4.6 x DFleotwecr4ta.o6tre x 5,000 Eluent : 5mM C Flow rGaPteC : 0.3mL/m 800 Detector : RI (sma ColumnGtueamrd Fpil.te:r 40˚CHolder + one filter GPC HK-G F670020C0 olumn teSmHHpK.-G: 40˚C N.A. N.A. Column temp. : 40˚C for HK series 3 Filters GPC HK-G Filter F6700100 SHHK-G Filter N.A. N.A. (CKoFm-Cc8poo0lmau5mrpiaL5nsr8i)(osKoFnn-8o0of5fHL)KH-4K04-L4a0nd4cLonavenndtioncaol nventional column Poly(butyl methacrylate) HK-404L HK-404L keeps low column pressure even at high Sample flow rates using a conventional HPLC instrument. Poly(n-b This allows it to achieve ultra-rapid analysis; reducing its analysis time to about 1/6 of conventional analysis method's analysis time. Also, its elution volume per column is about 2.0mL which is about 1/6 of the conventional column's elution volume. Elution volume: 2.0mL Sample : 5µL Poly(isobutyl methacrylate) 0.2% (Conventional type) Elution volume: 12.0mL KF-805L 0123 0 5 10 15 min Column : Shodex GPC HK-404L, KF-805L Column : Shodex GPC HK-404L x 2 Eluent : THF Eluent : THF Flow rate : 1.0mL/min Flow rate : 1.0mL/min Detector : RI (small cell volume) Detector : RI (small cell volume) Column temp. : 40˚C Column temp. : 40˚C Styrene butyl methacrylate Polyamide (Nylon 6/9) Polyamide (Nylon copolymer G-26 Sample : 5µL CANADIAN 1 888-226-2775 :: info@Sliafmespcleie:n5cµeL.ca :: www.lifescience.ca Styrene butyl mLeIFthEacSryClaItEe NcoCpEolymer 0.2% Nylon 6/9 0.23%

0.3mL/min (LF-404) F6709621 DeGtePCctLoF-rG : RI (small ce(llguvaorldumcoelu)mn) HPLC/UHPLC Columns6 − 4.6 × 10 page 68 for replacement. Target Molecular WBeaigshetMRaantegreial: Styrene divinylbeEnxzcelunseiocnopLoimlyimt er tector : RI (small cell volume) applicability ofCSoEClu(mGPnC)tecomlupm. n:s4to0˚sColvent Product Name ation Type lumn temp. : *See HPLC/UHPLC Columns300 − 2,0S0h0ip,0p0in0g Solvent: Tetrahydrofuran 2(T,0H0F0) ,000 40˚C LF-804 amide (Nylon6/6) Target molecular weight range and exclusion limit LF-604 300 − 2,000,000 2,000,000 LF-404 300 − 2,000,000 2,000,000 Measured with polPysotyrleynme (eelutehnyt:lTHmF) ethacrylate Organic SEC (GPC) Columns: Linear Calibration TypeProduct Name E*xPclluesaisoenuLsime tithe above table for reference purposes only when selecting columns. Target Molecular Weight Range Sample : Nylon 6/6 0.1%, 20LµF-L804 300 − 2,000,000 SPoamlympleeth: y1l0m0µSeLtc22hh,,a00ce00r00my,,lS00aa00cte00thicemdiaatgircadmiaogrfalimneoafrlcinaeliabrractailoibnratytipoenptaycpkeinpgacking 300 − 2,000,000 Shodex™ GPC - LF LF-604 • Packed with unique mLFu-4l0t4i-pore gels with3a00w− i2d,0e00p,0o0r0e-size distribution 2,000,C00o0nnecting linear calibration type columns (LF series) The linea • Highly linear ca*liPbleraasetiuosne tcheuarbvoevewtaibtlheofour treifnerfelneccetpiournpopseosionntlyswhen selecting columns. of mole • Achieves highly precise molecular weight distribution • Enables analysiSscohveemr aatbicrodaiadgrraanmgeoof flimneoalerccuallaibrrwateiiognhttsype packing • Rcoalpuimd nan(aLFly-s4i0s4c)oaluremanClos(noLnFae-v6cat0iin4lag)blailnneedarhcigalhibpraetriofonrtmypaenccoeluamnnasly(LsFisseries) CoTnhneelcintienagr mcailxiberda-tgioenl ctyopluemconlsum(KnF-c8o0v4erLs, aetbcr.o) ad range Connectin • LF-604 and LF-404 enables reduction of solvent use of molecular weights with only one kind of packing material. (KF-804 + • Fulfills USP L21 requirements 5 10 15 20 25 mPrixoeddu0-gctel colu5mnsM(K1aF0n-8u0f4aLc,t1ue5trce.r) Shodex™ GPC CLoFnnecting different single pore-size columns 6220 Item25 m(K3in0F-804Ba+sKeF-803 + KFT-a8r0g2e,teMtcW.) Pore Size Dimensions ParticleComninnecting Number (Å) Separation Size (µm) Name Item Material Range* Mode ID x Length (mm) GPC mn : Sho8d.0ex GxPC 3L0F0-404 6 GPC LCF-o8l0u4mn : ShFo60d2e10x41GPC LF-8S0H4LFx-8204 300 − 2,000,000 3,000 300 − 2,000,000 3,000 : 5mM6.0CF3xCOO1N50a in HFIP 6 GPC LEFl-u60e4nt : MFe6th02y1l0e42thyl ketoneSHLF-604 Styrene divinylbenzene 300 − 2,000,000 3,000 copolymer N.A. ate : R0.I1(54s.mm6 La/llmcxienll v62o52l0ume) 6 GPC LDFFl-eo4t0we4crtaotre : 1R.I0F6m02L1/0m43in SHLF-404 N.A. tor : : mn temp. : 40˚C4.6 x 10 6 GPCCLFo-Glumn temp. : 40F˚6C709621 SHLF-G *Please use the above table for reference purposes only when selecting columns. Effects of using multiple LF-404 columns for the separation of poElyffsecttysroefnuesinsg multiple LF-404 columns for the separation of polystyrenes 4 Sample : 10µL 5 1. Polystyrene (Mw : 1,030,000) 36 7 2. Polystyrene (Mw : 152,000) 2 3. Polystyrene (Mw : 66,000) 1 4. Polystyrene (Mw : 22,000) LF-404 x 1 5. Polystyrene (Mw : 5,050) 6. Polystyrene (Mw : 580) 7. Ethylbenzene 4 Column : Shodex GPC LF-404 x n 35 7 Eluent : THF 26 Flow rate : 0.3mL/min Detector : RI (small cell volume) 1 Column temp. : 40˚C LF-404 x 2 4 35 7 26 LF-404 x 3 1 05 10 15 20 25 30 min 63 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN G-27 LIFE SCIENCE

Colonnes HPLC/UHPLC Organic SEC (GPC) Columns: High Temperature/Ultra High Temperature Analysis Colonnes HPLC/UHPLC Shodex™ GPC - HT-800 Shodex™ GPC - UT-800 • Wide product lineup to support a broad range of molecular • Dedicated to SEC analysis at high/ultra high temperatures weight analysis with a maximum usable temperature of 210°C • Fulfills USP L21 requirements • Suitable for the analysis of ultra high molecular weight polymer containing samples • Fulfills USP L21 requirements HCTa-li8b0rDID0aixmtsLieoeennngrtsiheci(omsunmrus)vseisngfoSPpirzaoerlt(yiµcsmltey)rene Shodex™ GPC HT and UT ProduCctalibratMioannucfuacrtvuerserfor Item BCaasleibration curvTaergfoetr MW Pore SizeOrganic SEC (GPC) Columns: High Temperature/Ultra High Temperature Analysis Separation NamUeT-800 seriIetesmusing poNlyusmtybreerne MaAtTe-r8ia0l 6MS using Rpaonlygset*yrene (Å) Mode 8.0 x 300 13 GPC HT-803 F6208700 SHHT-803 1,000 − 50,000 500 GPC 1078.0 x 300 13 GPC HT-804 107 F6208710 SHHT-804 107 7,000 − 300,000 1500 UT-80U7T-806M 8.0 HHT-T8-08076 GPC HT-805 F6208720 SHHT-805 50,000 − 2,000,000 5000 x 300 13 GPC HT-806 106 F6208730 SHHT-806 150,000 − *(20,000,000) 10000 106 13 F6208740 SHHT-806M 1,000 − *(20,000,000) 10000 Molecular weight (Polystyrene) x 300HT-805 13 GPC HT-806M 105 Molecular weight (Polystyrene) F6208770 SHHT-807 106Molecular weight (Polystyrene) 300,000 − *(200,000,000) 20000 8.0 HT-806M 18 GPC HT-807 F6709410 SHHT-G N.A. HxxT-803HT-804 300 13 GPC HT-G 104 F6208600 SHUT-802.5 105 300 − 10,000 300 1058.0 300 30 F6208610 SHUT-806M 1,000 − *(20,000,000) 10000 30 GPC UT-802.5 103 F6208620UT-802.5 SHUT-807 Styrene divinyl1b0e4nzene 500,000 − *(200,000,000) 20000 8.0 x 50 30 GPC UT-806M copolymer 1048.0 200,000,000) x 300 GPC UT-807 102 103 1038.0 8.0 x 300 102 1028.0 x 300 8.05 6x 7 508 9 10 3011 12 13 GPC UT-G 5 6F677094080 9 10 1S1HU1T-2G 13 4 5 6 7 8N.A.9 10 11 12 N.A. 10000 Elution volume (mL) F6208E3lu9ti0on volume (mSL)HAT-806MS Elutio(2n0v0o,lu0m00e ,(0m0L0) ) N.A. 8.0 x 250 12 GPC AT-806MS Column : Shodex GPC HT-800 series Column : Shodex GPC UT-800 series Column : Shodex GPC AT-806MS Elue8n.0t x : 0.15%0 BHT in ODC15B GPC AT-G Eluent F67:000.218%0 BHT in ODCSBHAT-G Eluent : 0.1% BHTN.iAn.ODCB Flow rate : 1.0mL/min Flow rate : 1.0mL/min Flow rate : 1.0mL/min D*e(t)ecEtsotrimate: dRIvalue Detector : RI Detector : RI Column temp. : 140˚C Column temp. : 140˚C Column temp. : 140˚C EffeEcfftescotsf ogfegl eplapratirctlieclesisziezeininhhigighhtteemmppeerraattuurree GGPPCC ccoolluummnnss Sample : 1. Polystyrene (MW : 20,000,000) High temperature GPC columns are suitable for the analysis of high molecular weight polymers that are difficult to be 2. High density polyethylene (HDPE-A) dissolved in ambient temperature solvents; examples of such polymers are polyethylene and polypropylene. The GPC UT-800 series packed with large particle size (30µm) are recommended for the analysis of macromolecules. The large particle size prevents potential molecular shear degradation of the sample. Column : UT-806M x 3 Column : AT-806MS x 2 Column : HT-806M x 2 (Particle size : 30µm) (Particle size : 12µm) (Particle size : 13µm) 2 2 2 1 1 1 Vo Vo Shear degradation Vo Shear degradation 25 min 15 20 25 30 35 40 min 10 15 20 min 10 15 20 Column : Shodex GPC UT-806M Shodex GPC HT-806M Shodex GPC AT-806MS Eluent : 0.1% BHT in ODCB Flow rate : 1.0mL/min Detector : RI Column temp. : 140˚C High density polyethylene Low density polyethylene Sample : High density polyethylene (HDPE-B) Sample : Low density polyethylene (LDPE-C) 108 G-28 lar weight 107 LCIFAENSACDIEINACRNIE 1 888-226-2775 :: [email protected] :: www.lifescience.ca 6

HPLC/UHPLC Columns Organic SEC (GPC) Columns: HFIP Shodex™ GPC HFIP - HFIP-800 Shodex™ GPC HFIP - HFIP-600 HPLC/UHPLC Columns • Columns exclusively used with hexafluoroisopropanol (HFIP) • Rapid analysis, solvent saving type Organic SEC (GPC) Columns: HFIP • Fulfills USP L21 requirements • Fulfills USP L21 requirements Organic SEC (GPC) Columns: HFIP Dimensions Shodex™ GPC HFIP ID x Length (mm) Particle Product Manufacturer Item Base Target MW Pore Size Separation CHFalIiPb-r8a08t.i00onsecxruiervs3e0u0sHCsfiFanolIgriPSbi-Prz8aeM01t(0i0MµomnAs)ecruiervseusGsPfiNCnoHCHagraFFmIPlPIieP-bM8-0r63Ma0tAi0onsecruieFr6vIst0ee2u8sm5CHs3fi0FanolIgriPb-Pr6aM0ti0MoSNnAHsuHecmFrIuPibe-r8evs0r3eussfinoPgrolPyMMetMahtyeArleianl e terepPhotlhRyaealntahgteye*le(PneETte) rep(hÅt)halate (PMEoTd)e 1,000 − 30,000 500 8.0 x 300 7 GPC HFIP-804 F6028540 SHHFIP-804 Sample : Polyethylene tere2p0h,0th0a0Slaa−tme20p0.l2e0%,:0P,0o20l0yµeLthylene te1re,5p0h0thalate 0.2%, 20µL 107 8.0 x 300 107 10 GPC HFIP1-08705 F6028550 107 SHHFIP-805 20,000 − 600,000 5,000 F6028560 106 106 8.0 x HHFIFPI-P833-000860005HFIP-801706 10 HHFIFPI-P8-0860G5GHPPFCIPC-8H0H7FFIPIP-18-0806066M HFIP-6FFF04666007220H880HF555FIPIP970--600060056M105HFIP-607SHHFIP-806HFIP-607 70,000 − **(8,000,000) 10,000 8.0 x 10 HFIP-606 SSSHHHHHHFHFFFIIPPIIP-P-68-0-840L06G7MHHFFIPIP--660056MStyrenceodpiovilnymylbeer nzeneHFIP-606 Molecular weight (PMMA) 104 1,000 − **(8,000,000) 10,000 Molecular weight (PMMA)1058.0HFIP-xx803 HF3I5P0-0800410518HFIP-803HFIP-8G0G4PPCC HFIP1-08507 HFIP-603 HFIP-603 GPC Molecular weight (PMMA)1048.010415HFIP-LG F6021030 Mw=19,300 Mw=19,300 Molecular weight (PMMA)HFIP-806M104HFIP-806M 70,000 − **(50,000,000) 20 N.A. N.A. 6.0 x 150 3 GPC HFIP-603 SHHFIP-603 1,000 − 30,000 500 103 6.0 x 150 103 3 GPC HFIP1-06304 F6021040 103 SHHFIP-604 20,000 − 200,000 1,500 6.0 x 150 10 GPC HFIP-605 F6021050 SHHFIP-605 20,000 − 600,000 5,000 102 6.0 GPC HFIP-16002 6M F6021080 102 SHHFIP-606M 10,00010 x 150 102 10 0 5 1,0000 1−0**(8,000,0005) 15 N.A. 15 44.6 5 3.5 min min 6x Elu7tio1n0vo8lume9(mL)104 6 115 126 7 vo8GluPmCe9(HmFL)I1P0-G 111.0 12 1.5 ElFu6t2io.70n00vo5lu1m21.e5 (mL) 31.0.0 S31H.5.5HFEIPlu-t2Gio.0n 2.5 3.0 N.A. Elution volume (mL) Column : Shodex GPCCHoFluIPm-6n00 seri:eSshodex GPC HFIP-600 series CFEDlleooutlweeuncmCH**rttaoPPntFareMlelIaiPMbs-erA6::::a:uSH1R0Pts.hIF0ie0ooIomPltdynLhsem/exmeceGairntuPbiheCroyEFCDvslvHmlleooeueFtlweueeuItsnPcmatsrtt-habof8nitarenlo0ec0grsrsyfeloParir::::teMe1RSHrse.hIF0Mfo*ImPed*LrAe(e/xm)nGicEnPestCpimHuEFDrFllaeoupIttwePeoen-csrdt8taeo0tPvres0aoosleunlryeliyee:::swHR00t..IhF35h(ImmsePymLLnl//aemmslleniinncleee((HHlclFFvFEDttIIioPPlleenoul--tuweg66ermn00certc53teaoo,,p)tre66lhu0064mt,)h6n0as:::6.HMR00la..IF35, (Immt6sP0emLL7//a)mm(llPiinnceE((HHllFFTvIIoPP)l--u66m0053eECDF,,)ll66eoou00tlweeu64nc,)mrtt6aon0tre6M, : Shodex GPCCHoFluIPm-6n06M x :2Shodex GPC HFIP-606M x 2 : 5mM CF3COOElNuaenint HFIP : 5mM CF3COONa in HFIP 60:7)0.6mL/min Flow rate : 0.6mL/min : RI (small cell vDoeltuemcteo)r : RI (small cell volume) Organic SEC (GPC) Columns: HFIP Column temp. : 40˚C Column temp. : 40˚C Column temp. : 40˚C Column temp. : 40˚C Column temp. : 40˚C Organic SEC (GPC) Columns: HFIP Column temp. : 40˚C Sample : Polyethylene terephthalate 0.2%, 20µL r PMPMoAlyaPmoild1y0ae7 m(eidHCffeaFelIc(iPebts-fPrf6aeo0tcfli0tyoasansdomedcfrieudaiedrdevsdse(eeuasdfslftfie)snoacgrlttsP) MofMaAdded salt)PoPlyoelytehtyhleynleenetetreerpehpthhtahlaaltPaetoe(lPy(bEPuETtT)y)lene terepPhoPtlhyoablyluabttuyeltey(PnleeBnTtee) treerpehpthhtahlaaltaete(P(BPTB)T) g HFIP-607 HFIP-606 Molecular weight (PMMA) 106 1H0F7IP-604 H5HFmFIPIPM--6600C56MF3COONa in HFIP Sample : Polycaprolactum (NylSonaSma6m)plpele: P: oPloyleytchaypleronelacteturemph(Nthyalolante6)0.2%,S2a0mµLple : Polybutylene terephthaSlaatme p0.le05:%Po, l5y0b0uµtyLlene terephthalate 0.05%, 500µL Molecular weight (PMMA)105 106 HFIP-6H04FIP HHFFIPIP--660056M Mw=19,300 10H4FIP 105 103 HFIP-607 So5mmeM sCaFm3CpOleOsNaaninaHlyFzIePd unSdoemr eSEsCammpoledse awniathlyzed under SEC mode with HFIP-606 HFIP solvent may show abnoHrmFIaPl spoelaveksntremsauyltisnhgow abnormal peaks resulting fsruopmprtehsesieodnibcyinatderdaincgtiosno.dTiuhsfmirusopmitnpritrfteelhurseaoscrieootdianocinbceyctinaaattndeerdbatioencgtiosnMo.dwTiu=h1mis9,it3nr0itfe0luraocrotiaocnectaatne HFIP-603 be to the HFIP eluent. the HFIP eluent. HFIP-806M 104 HFIP-603 102 0 5 10 15 min 2 1.0 11.503 2.0 2.5 3.0 3.5 Elution volume (mL) s Column : SH1hF0oI2Pdex GPC HFIP-600 series Column : 5SmhoMdeCxFG3CPOC5OHNFaIPin-6H0F6IMP x 210 Eluent : Eluent : 0 15 Flow rate : 0.3mL/min (HFIP-603, 604) min 10 11 12 10 15 0.5mL/1m.02in0 (HF11IP.05-605,2265.006,165026.M5 , 360073m).0in20 3.5 F2l5ow rate 30 :m0in.6mL/min 10 20 10 30 min 20 30 min mL) Detector : RI (small cell volumEelu)tion volume (mL) Detector : RI (small cell volume) Column tempC. o: l4u0m˚Cn : Shodex GPC HFIP-600 series Column temp. : 40˚C FIP-800 seriesColumn Elu: eSnhtodex GP:CHCHFoFIlPuIPm-8n06M x :2Shodex GPC HFIP-806M x 2 Column : Shodex GPC HFIP-606MCoxl2umn : Shodex GPC CHoFlIuPm-8n05 + HFI:PS-h80o3dex GPC HFIP-805 + HFIP-803 Eluent Flo: wHFraIPte(solid :lin0Ee.l3)u,me5nLmt/mMinC(HF3FCIP:O-H6O0FN3IP,a6i(n0s4oH)liFdIPlin(eb)r,o5kmenMlinCeF)3COONEaluinenHtFIP (brok:e5nmlinMe)CF3COONa in HFIPEluent : 5mM CF3COOElNuaenint HFIP : 5mM CF3COONa in HFIP salt) Flow rate : 1.0mL/min : 0F.l5omwLr/amtein (HFIP:-160.05m, 6L0/m6,i6n06M, 6P07o) lybutyleFDnleoetwecrttaoetrereph:: 0Rt.hI6(msamLl/aamllticneell(vPolBumTe)) Flow rate : 1.0mL/min Flow rate : 1.0mL/min Detector De: tRecI tor RDIe(tsemctaollr cell vo:luRmI e) Detector : RI Detector : RI Column tempC. o: l4u0m˚Cn temp. : 4C0o˚Clumn temp. : 40˚C Column temp. : 40˚C Column temp. : 40˚C Column temp. : 40˚C Sample : Polycaprolactum (Nylon 6) Sample : Polybutylene terephthalate 0.05%, 500µL addPeodlysaamlt)ides (NylonP6o/l1ya0mainddesN(yNloynlo6n)6/10 and NylonPo6l)ybutylene terephthalatPeo(lPyaBcTe)tal Polyacetal ONa in HFIP Some samples analyzed under SEC mode with Sample : Polyacetal 0.2%, 20µLSample : Polyacetal 0.2%, 20µL HFIP solvent may show abnormal peaks resulting from the ioniScaimntpeSlreaa:mcPtpioolelync:.aNTpyhrlooislnaic6nt/ut1em0ra(0Nc.ty2ilo%onn, 6c2)0aµnLSbaemple : Nylon 6/10 0.2%,S2a0mµpLle S: Namylponle6: P0o.2ly%bu,t2y0leµnLe teSraemphptlhea:laNteylo0.n056%0,.25%00,µ2L0µL suppressed by adding sodium trifluoroacetate to the HFIP eluent. 5mM CF3COONa in HFIP Some samples analyzed under SEC mode with HFIP solvent may show abnormal peaks resulting from the ionic interaction. This interaction can be Mw=38,100 Mw=38,100 Mw=176,000 Mw=176,000 suppressed Mbyw=a2d9d,3in0g0 sodium trifluoroacMewta=t2e9,t3o00 the HFIP eluent. 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN G-29 LIFE SCIENCE

ColonnesGHPPCLCC/UleHaPnLC-up Columns GPCFeCaletuarnes-up Columns EV • Suitable for fractionation of residual pesticides in foods Colonnes HPLC/UHPLC Shodex™ GPC C•leEaVn-2-0u0p0-AECVis used in Shoku-An No. 1003001 (October 3rd,S2h0o0d6,eJxa™paGn)PoCf tChleeaPhna-rumpa-cePuAtEical and fAoCr•fiiFEsrnoVauLo2cisdt0veie0Sods0antAfoiaenCcttk-iyS1oa2hBnnFuodroikseMufau-ruasAee,rsniMdnideiNHnuPLoSaWr.hol1,odpSk0ueeu0csc-t3tAtsii0”ocn.0inNd12eo(.s“O0Sii2ncm2tfo6uolb(toFaedenrbse3rourudasr,yGC26/Mth•S, 2(L0C1bS/5Mul,oiJStoa)apdAbanlanean)lofdyofsrbethsoceoltetfPoaAhnmagirrnmiscgeuadlucteuipmurahteilcingCahhtl ae-mnmdiociasltsure • Suitable samples such as • EV-2000 2006, Japan)Fooof dthSeafPethyaBrumreaacue,uMtiHcaLWl a,nSedcFtiooond2 “SLaCf/eMtySBAunraelyasues, of A•g ricuHltiugrhallyCeheffmecictaivlseinfoLrivfersatcotcikoannadtion of endocrine disruptors in MHLW, SectiMonar2in“eSPimroudultcatns”e.ous GC/MS (LC/MS) Analyses of environmental samples Agricultural Chemicals in Livestock and Marine Products”. • E2V0P12A50E,0J0aApCa-n••1)2SHouFigfitihtsalhbyueleesffePfoedhcraitcnirvlmeeSahafnocoirnekgfuuruat-icpActinahoilngNahaont-im.do0noF2ioos2tfou6edrne(dSFsoeaacfbmerritpnuyleaeBrsdyuissur2recu6hapttuahos,,rbslionoednavnirdonbmotetonmtalsseadmimpelenst MHLW, Section 2 “LC/MS Analyses of Agricultural Chemicals in Livestock and Marine Products”. Appropriate columns Does the sample Eluent Column for GPC Clean-up contain water? No Ethylacetate/Cyclohexane EV-2000, EV-200 EV-2000 AC, EV2000AC-12F Acetone/Cyclohexane PAE-2000, PAE-800 Acetonitrile PAE-2000 AC, PAE-800 AC Yes Acetone Shodex™ GPC Clean-up ordering information for pesticides in foods DIDixmLeenngGtshiP(omCnms)CleanP-aurpticfloer residuaPlropdeustcitcides inMfoanoudfsa,cetutrce.r Item Base Functional Pore Size Shipping Size (µm) Name PaIrttieclme Size NuPomrebSeizre MaCtoelurmianlSize (mmG) roup (Å) Solvent 12.0 Pxrodu3c0t0Code 16 CPrLoNdpuacktENVa2m00e0AC-12F F609(µ00m0)6 SHEV-200(0ÅA)C12F I.D. x Length 30Shipping SolAvceentotne/Cyclohexane (3:7) 12.0 x F6019000006 16 CLNpakCELVN2p0a0k0EAVC-G-1A2CF12C F609010607 SHEV-GA3C012C 12.0 × 300 N.A. AcetNo.nAe. /CycloheAxacenteon=e3//C7yclohexane (3:7) 20.0 x 300 16 CLNpak EV-2000 AC F6090003 SHEV-2000AC divinSytylbreenn1ze2e.n0e× 100 30 Acetone/Cyclohexane (3:7) 20.0 x F6019000007 16 CLNpak ECVL-GNpAaCk1E2VC-G AC F609010604 (gSuHaErdV-cGoAluCmn) copolymer AcetNo.nAe. /CycloheAxacenteon=e3//C7yclohexane (3:7) 20.0 x F6039000003 16 CLNpak EVC-L2N0p0a0k EAVC-2000 F609010601 SHEV-230000 20.0 × 300 20.0 x 100 16 CLNpak EV-G F6090002 SHEV-G Aceto30ne/CyclohEethxyalnacee=ta3t/e7/Cyclohexane (3:7) 2.0 x F6019500004 16 CLNpak EVC-LGNApaCk EV-200 F609010605 20.0 × 100 N.A. Ethylacetate/Cyclohexane (3:7) (gSuHarEdV-c2o0l0umn) Aceto30ne/CyclohEethxyalnacee=ta3t/e7/Cyclohexane (3:7) F6090001 CLNpak EV-2000 16 30 20.0 × 300 Ethylacetate/Cyclohexane=3/7 F6090002 ShoCdLeNxp™ak GEVP-GC Clean-up ordering in1f6ormation(gufoarrdpcohlutmhna)lic acid es2t0e.0rs× 1in00sedimats, bEtihoylloacgeitcaatel/sCaycmlophelexasn,eb=l3o/7od, etc. DIDixmLeenngtshFi6(om0nm9s0) 005 ParticleCLNpak EV-2P0r0oduct Manufa1c6turer Item30 Base2.0 × 150Functional EthPyolarceetSaitzee/CyclohexaneS=h3i/p7ping Size (µm) Name Item Number Material BaGsreoMupaterial: Styr(eÅn)e divinylbenzeneSocolvpeonlytmer 20.0 x 300 5 CLNpak PAE-2000 F6810022 SHPAE-2000 400 Acetonitrile 8.0 xGPC50Clean-up9 for phthaClLicNpaakcPidAEe-Gsters in seF6d7i1m400e7nts, bioloSHgPiAcEa-Gl samples, blood, etc. N.A. Acetonitrile 8.0 x 300 5 CLNpak PAE-800 F7600025 SHPAE-800 PolyviCvoylluamlconhSolize (mm) N.A. 400 Acetonitrile 20.0 Pxrodu3c0t0Code 5 PCroLdNupcatkNPAaEm-e2000 AC PFa6r8ti1(cµ0le0m2S)3ize SHPAPEor-2e(0ÅS0)i0zAeC I.D. x Length 40S0hipping Solvent Acetone 8.0 x 50 9 CLNpak PAE-G AC F6714008 SHPAE-GAC 20.0 × 300 N.A. Acetone F6810022 CLNpak PAE-2000 5 400 Acetonitrile Acetone 8.0 x 300 5 CLNpak PAE-800 AC F7600026 SHPAE-800AC 400 F6714007 CLNpak PAE-G 9 (guard column) 8.0 × 50 Acetonitrile F7600025 CLNpak PAE-800 5 400 8.0 × 300 Acetonitrile F6810023 CLNpak PAE-2000 AC 5 400 20.0 × 300 Acetone F6714008 CLNpak PAE-G AC 9 (guard column) 8.0 × 50 Acetone F7600026 CLNpak PAE-800 AC 5 400 8.0 × 300 Acetone Base Material: Polyvinyl alcohol 76 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca G-30 LIFE SCIENCE

HPLC/UHPLC Columns oSoSSoSfafafaamamamagmggppprrrllilpieiececcluupueppllrltrtrtepueueuprprrpraaaeaaalrlrlprSoacacacfaathththimiarioeoeoeagoSnmpnSomnmrtfalfaiioSoieomicaoiocmcafcauuuguapangamtptrltlrlllrtlsgilislesipouicinenrcnpiluriueipneuencapnalrtltulfrflptefullolieaouilcoiivrpvtrnrvptrrehrueaaeieaaesopessrlsrssliraniamtictmtamfcmolortohotoiihacucucioeuruotkehlkalknmlittnmtsoelaalaaasaiioinmnnonicmnnncuieduaeoidendatcoultoulolsmflaimlumsuliontuilntvslisasresaiinaaeennrrGsrGinGsifeilnifniolniCtnCmoeCivoerfvele/re/oo/iceuMsMvMpsprspkuslietrtSimrSrtsSosmosaaooictandumnadaGcduokneulndunkultcuCdotcdacdackalmaut/nttntLnsLnasLMasseadCeCndCn(or(G(po/pem/ipSd/uMmnMauCMaoasaemrasruS/arSStrtMGtnsrpaiG1ain1a1aCdrSnGCn)eno)in)/enaC/adLMapMelnCplu/lyyrSyMdrScsp/ossotiMardSiiLsadssosnuCnuad(Sdcpdc/nutMatLadscLsrCntSC(tLs(p/apC/1aMEPa(PEMPElapn)/yrrVSVrMrrVaatSese-te--rl2p1aSi2py2p1atsn0a)s0a0na)1aari0r0ra0sn)ala0a0ly0aiyiiosolosAAyAinninssCsCCirrrsaaanPEnngrVggee-ee2pPEoPEo0aoVrffVrEPf0e-eaa-2arVp0aP2pieg-g0agor0a2pArr0rneir0iaCic0capc0riuuiouaaoA0llAnlitrtntoCuuaCAgurnrrteCaraaiarnolnolalgcnfgcncehehaghreoegeaomfmrmnfoiaciigfaiccgcuegaaaralrgtlillosicussrcufriuuucualasltuslstuigiulicnntrnrruhgagigacrellaumccllhhitcceuehamrmelasimiclcuaiacsllsaisnlusgussuiinsngigng o[[[OOfOuuuatttlglilininnreeei]c]] ultura[Ol ucthl[i[[OneOOe[umuOu]ttltuilliniitncnelieaen]]]els] in livestock and marine products (pt 1) chemicals using EV-2000 AC GGGGPPPPCCCCHPLC/CCCClllleeeeaaaannnn----uuuuppppUHPLC ColumnsCCCCoooolllluuuummmmnnnnssss LLLiivivveeerr,r,,KKKiididdnnneeeyyy LMMiMvueuusrss,cLccLKLlilevlieievLvde,,,eeirFnvF,Frrae,,aKatyKrKtt,,i,d,iiFKdFdFnininsiedsseheyhnhyyeyMuscMlMeMu,MuusFMsMscMuacclitsielill,klecek,kF,,l,F,eiEFFEsaE,gahagtgF,tgtgag,,FtFFi,siisFshhihsh HMHHooiolnknne,eeMyEyyMMgilMiigkllkk,i,l,EkEEg,ggEggggg HoneHyHHoooHnnneoeeynyyey AAAcccrrriininnaaattthhhrrriininn((5(55mmmggg///ALLL)c))rinA(a(Aa(acatgchAgrgrrirrcnriiiincTincTracTiuarurnturi(tihlci5lcatlhctturymuyturyihrcnircrcnagarlalal(ila/lan5l(zLc5zczcmo)h(omohh5lelgeeleemgem/mm/(L((g5(La5i5)ici/mc)gcmmLaaar)glgilglcT(/m/ma(/mLurLaLiga)lca()gta)arruyrirkgckTirkccTeareureluiarrilrclTcri)t)lzcc)utryouyihlrctlrcaeeulyaallmarclz(ca5zlcioahlcomhlzceaeleoehgmlm(le/m5e(iL5cmimca)(ma5airglcmkgl/mae/mLglLra))/ma)rLrka)kererkr)e) r) GPC Clean-up Columns EEExtxxrttrraaactccittiiooonnn Extraction ((a(aagggrrriiciccuuulltlttuuurrraaalllccchhheeemmm(aiicicgcaaarlillc(mma(muagala(gtaarrurirkgckirkceareueuirlrclr)t)lc)utuhlrtraeualmrlcacihlchceaehmlmemicmicaaairlcklmaemlra)marrkakererkr)e) r) GGGPPPCCCCCClleleeaaannn---uuupppCCCooolluluummmnnnsss EEEExxxxttttrrrraaaaccccttttiiiioooonnnn AAAccceeetttooonnneee///nnn---HHHeeexxxaaannneeeA((1(11c///2e22t))o)AnAAcecceA/eentcott-oeonHtnneoeee/nxn//enan-/n-H-nHHee-eeHx(x1xaea/anx2nnea)een(1(e(11/2/(/122)/))2) AAAccceeetttooonnniitittrrriililelee AcetoAnAAcictceAreeticlotteoeontnniotiirtntirrliietllereile SSSaaalltlttiininnggg---ooouuuttt SaltinSgSSa-aaolStlluitatniitnlngtgig-n-o-goou-uutottut GGGPPPCCC GPC GGGPPPGCCCPC GGGPPPCCC GPC GGGPPPGCCCPC PPPuruuirrfiiiffiicccataaittiiooonnn FFFrraraacccttitioioonnn---111 FFFrraraacccttitioioonnFn--r-22a2c[*t1ioF]nFFra-rrA1aFacA[cAcc*[cctrg[gh*f1iag*thftohfr1ri1ricre]o[raroeinae*i]cat]inmcnc-1cmicmFouc1--ut]u1trin1tliicaliitocli-toctouca1unauantrnlrilrsalosaFsalnFlFrla-rr2aFaccctriattoiicoontnn-io2--2n2Ac-g2hfrreaicmcAuAAtcAcciAlicggcgtohfhfghfhgufrrraArhrfreneraraceiiraerilcaciegmcmasacichcmfcmcucurmruclttuetaiiiutliliicccltiitotocmliitcoclitouucaautonanutanurniarlllirnlcrsastalosralsauasallnllrllsalPurificationAcghfrreaicmcuAtcAiAlicgctohfggurhfaArhfnearcirrrelceagimasaichfccmurmcrclteuaiiulitcctitomiliclicuctoautonutauiarnllincstarolrlsuaasalnrlllsal 000mfmffmiisissuuhuhhss,s,,ccmcmml5le5l5eeii,lil,kl,kkff,fa,a,aetetet,g,,gg1g11g0g00 0 mfisuh11s015,5050cmfcmcfmicl05sihehsuhihmfue,lehiseks,asmfamu,camahmcg2g2mlsge25it,e0ilcri05,cr50ceigcrim,liiacika1lc,la5gcekf0lu,liufaslus,l,salkelttlfetf,tfu,gafur,urg2r1ae2rgta2ra15r01ag5,ac5g0ac0cl1ltgltt0i5ioioocnnnh3e1331051a0m055cg12ci5h0crhiceacehamlmuammsmge323li3gi2in5t20aimcr5nifn50u0crirga2c2iariac05crluacsliuasclttlfilutosfru2rlarn2t52arafcu55arcl23atrl5ti0acoioltnino3n3300m03i0n5 mm3mi335niimn55n3i5n [[*[**111]]] PPPPuuuurrrriiiiffffiiiiccccaaaattttiiiioooonnnn [*1] [*[[*1*11][*]]1] llilivivveeerrr,,,kkkiididdnnneeeyyy liver,lilfkfvifrrvriaeladaeicrvcncr,et,tetikiroikoyo,idninnkd-n-i-n2d2e2enyyey fractfiofrranafcr-cat2ticoiotnino--2n2-2 [[*[**222]]] [*2] [*[[*2*22][*][][*[2**11]1]]] [*1] [*[[*1*11][*]]1] [[*[**111]]] fffrrraaaccctttiioioonnn---111 fractfiofrranafcr-cat1ticoiotnino--1n1-1 TTTeeessstttsssaaammmpppllelee Test sTaTTemeesTsstpettsslsesataamsmmappmplellepele EFCIDCICFEDCnCICFEDnnlleoollojueloolojueoeoojuetlelwetlulwteeclulwueecuuecunmcntmnmctmmcrtitmritotriattoantooannonnotnnntrnterteretvteveveomomomll.lp.p.p...:::::::::::::::::: 54A5US5A45USA554US0m.chVm0.ch0m.0Vch0V˚0eo˚CemLo˚eComL(FCCDEImLt(d2nt(dto2d2lolLeoooLo5jueL5nee5en/tln/l4wex/mu4eecxu4mexmennm/nctmnC/i/CrCECFIDimtiCnCtmoinCanICFEDCmICDCFEnnoLllnneyoLnoojutLy)llyele)loorNoeejouo)ctFICDCEojluNtlweceNenucectuvletlwellllwelupencuoouoecopljmuuctoompmnoenrimcttatmhlcmtlwteoamlharuiaecthurin.ottopkatenonanktenomctknoemnrnnet.xrintttxrtoEexraveeEtan::::::otEanveanvteoVmnVre45A5SUnVomntoml-eve.-m.0eplch-eVlG0.G=o.pmGp=˚e.o=CmLl1.(.1t.::::::A1dp2Ao/A::::::::::::L//45A5SU45.eC4nC4455AUSC/45A5SU0.m4::::::xchmVe0.m0chm0.+V˚chneV0o+545ASU/0C+mLC˚ei˚o(CemCotmLnC0m.dm2LchE(Vo(t0ELtd2LEd2y˚o5eeoo)CLVnmLLNV5/ec(5Vent4xnd2m/e-/o4lx-4mLxpen-ome25/e2Cnn2inC//ma/h0nC4xCi0mCemi0CmnLnke0yn0)L/0LCyNyicxC)0m)n0NE0cNcalLpyoAlV)lpAnopNAocah-CeahCalhkCepGo=kekexahE1xxaAEkeEa/Van4xCVVnnE-ea-Ge-e=V+nGG==1-eA1E1G/A=A4/C/V41C4CA-/+24C++0EE0+EV0VVE--2-AV220C-002000000AA0ACCCAC G**G***G*212121PPPPPPPCPPCCuuuuuurrcrrcrrciiiioffiioffiioffiiccliiccluccluaauaamaamttmttttiiiiooniioonoonnnnnnn:::wwSwwSwwShiihiitthiittotthhohhohhddsedse*G*eseeite12itlixthlixhlPixhcicyPPcyCCayCalCaluueleLegLLnrrgc*G*gnNnii21**GNe**GNeoffeee21P21iielpccdllpPPPPdlpG**udCmaPPaam12iPPamCiauuaCmiPakttauukiuukrrcmiiPPnmiooCnmiinrrcnErrcoffEiiiuuEiinni-offioffi-ccVnl:i-iVrrncciiuVncclcciilaaeww-uSoffoue-meaao-2aaiiott-2mcc-mh2llii-ttlNuutt0oolNnu0iiaaNuiio0hhoonoomm0nnn-m0tt-m0d:-nnpiinn0sep0oo:pnn0:wweSnrintwwrSnnlwwAroSxhiAohii:AoctthpiiyChiiwwophhCSttpaCttlohhyohhdeyhyiiLse+ldgttd+lnse+eslohhsseNitseeleiexhiEtidiltElicllExhpyesixlhdyiVcyeCcVamliytVaylielClaxC-heaaiel-kLl-cdeGgiedGynmLndGLgCNagnenEleNisNeesAie-eLlpseAVdngAinclpillpdmiNCadlieeCi-lieCmocaamicai2kic-lpaidaalmknakNu0iamimaEnminiam0gEi--kEgiVgnii-pmc0ie-nVneVnnce-Ecorlie-l2ei--Ao-oloVnlm2c2-mNu0-mlpCleN-u0Nou0mi-2yi-nm0imnl-0p-n+Nlu0nips0pi0-rin-m0n-AiocrErclAcpo0yAoopCnVoolrpCpCleyAo-luluy+yuldGpCsm+lm+lmssiyEslAinyEi+lnEinlVsylyCVieVilc-Elee-ydG-aVdGdGles-gAsdGsiAAelCiilcClsCiiAccamilaCaicgingageiee-lgcllmemomlilnuiminnim-ii-c-nnccoi-oolculluoummmlunnmn n SLCa/mMpSleapnraelpysairsaotifoangoriuctullitnuerafol rchsiemmuicltaalns einous cPhreepmaircaatlisounsriannggEeVo2f0a0g0rAicCu-1lt2uFral aGnPdC bCeleeafnta-ullpowof fatty tunaSamSmaSamnanaanaaamaamramrlrilyilpniypnypnslselseelieeiesispspppppororrorrofroefoefeddpadpapauugaugagacrrccrrrrtaitaictaiscstcstutiuiu(oi(olp(olptlnptntaunauauramSrorrorrotantauatauaul2amlt2l2trtlc)llci)ilcy)pinnhinhnhsaSmleeeeeamSieeaSmnasmamnapfnmaampfaSmafaoraomoriamloirricnriaroypclfnrelicariypayasnmpdnlaseparssessllileluiliesesglyaipiensmiipsmcpsmrrplepiopretpiaurniouroncossrufnretrplooflpdueftiellpatol(odrtialdprulaipapaviogatfvnuenvugacnaeugandrrepceaecrrtairesorreuscstgaisotaaittoucsotccustitrroult2o(uoutoiutuaiilpc(solc(s)otsnlpctislpakutnuhtkinkLau(aouLrorLleepaCrtrotarnCoruaCmtauantaulfn/2unt/r/olrM2dl2ltciMd)ttMdaicrlu)lcnh)iSli2aShntSnhseelcl)eeieesmmhnfmmofeeifuonocrimicrlfcartsloaailassicvsrlmlnisiesauPmmuPsiPuelusniiissrounsmurtnlsrteolulieliieiatliutnnlcvsniapnianpvlpvekntglnLeegaegiasaeavaeCosstnroenEoroturt/EeEaousoMdaucsaoVctsVcksiVioSuLikok2oL2ocLsa2CnaCkan0Cnn0/L0nn/Md/aC0Md0rMd0rnrS/a0aS0MSda0nAnnASAPuggCgCsCreee-i--n11po1oPuog2Pu2af2fsfrFsrFPurEeaFiaaeinsgprVnggipgeiora2grnrapiinri0cEgcrcEaua0VuruirVEiola02allot2tVtnuiA0unuo02gr0Crrn0aeraa0-a0ll1nrlAonAca0c2gcfCghnCAhehFae-egeC-e1go1memom-2rf21fiioFiiccaF2ccafuagaFagallrllstrgsisuicrcruiuaclltutuuclrthruaabGGbeGblrlaemePcePPcleheCiehCcCeffefhamCtmCetlCtasaiamlilclelcleellaillaoacoaloalsanwsnwnwl-s--uuuGbpppePeooCobGffbGffePCbGetfPffeaaaCealPCftlettfeltCttoaCtyfCytyanwalCtltlet-telauulluoaoaelnnlpwnnwoaaa-an-wouuaa-fapupnnnfpdoaddoftfotfyffaafttauttytnytayttuutanunnanadaannadndd livestock and marine products (pt 2)[[[OOOuuutttllilininneee]]] [ Outl[i[[OnOOe[uuOu]ttltuillniitnnelieen]]]e ] HoneHy(HH(a(oaaoogHnggnnreorrieeiycincAcyyAAueuuccylcltlrttruruiuininrnrraaaaaaltltlthhchccrhrrhihinienneemm(m(5((55aimicimcmgcaagargglil/lc/(m/ALmaL(muLa)cg)al)a(gtararruriirkngckirkAceaareuAeuicrltrclrc)thA)lrc)utrirucnhilrintnraraeuaialntmr(lth5caahcrihmltcrihhniceangerhml(im/n5(emL5imcmi)(mca5agairmglck/lma/LegmLl)r/a))maLrrk)akererkr)e) r) 1F2BS1BSF2BFS21..aae..aae..aaetTAmetTAmettATmetryfctryfcirpyfcipcrtipcrttcilrattyiluanetiylauneyulneclnlaclnaco:nlalo:taol:atalw5ahtaaw5hw5zhzmrzmromiroinoinlLnlLelLee SamplSeSSa:aamSm5mapmppmleLlleep:l::5e55m:mm5LLLmL OOOttthhheeerrrttthhhaaannnhhhooonnneeeyyy OtherOOOtthHhtHtOHhaheootoneernhnrnrheteeehttyorhyhyantaanhennayhhnhooonhnneoeeynyyey Beef tBaBBleloeeBweefeffteattafallloltlloaowlwwlow Fatty tFuFFanaataFttyttayyttuttyuunntnauaana EEExtxxrttrraaactccittiiooonnn Extraction TTTrrriiciccyyycccllalaazzzooollelee((5(55mmmgggT///LrLLi)c)) yTcTrlariTcizcryoyiclcelyalacz(5zloaomlzeloeg(l/5e(L5m)(m5gmg//LgL)/)L) 555555mmmmmmgggggg////12LL//LLLL.. Acri1n11.a..At1AhAc.crcrAiirnrnicinnaraatinhtthhar5irtrnmihinnrgin/L555mmm5gggm/L//LgL/L EEEExxxxttttrrrraaaaccccttttiiiioooonnnn ((a(aagggrrriiciccuuulltlttuuurrraaalllccchhheeemmm(aiicicgcaaarlillc(mma(muagala(gtaarrurirkgckirkceareueuirlrclr)t)lc)utuhlrtraeualmrlcacihlchceaehmlmemicmicaaairlcklmaemlra)marrkakererkr)e) r) Tric2y22.c..Tl2aTTr.zirrcioTiccylryecyicclayllaazc5zozlamoolezllegeo/lLe555mmm5gggm/L//LgL/L uuunnndddeeerrrAaAaAaccccccieidiededtitictoicoconcncncoeoeoen/n/n/ndndndi-i-ti-tHitHioHiooenenenxsuxsxsanwaawwdnninieteitehtehrhAu(aa(a2(uau2ncc2ccn/cnd/ie/3eeud3ede3ttn)tiite)ercic)oicdrcArancaAeAaaccocreccciceAdnia/idiedednticccotiti-coectdonHciotnicncoeoenoeone/ncxsnnn/d/oenadndwi-tn/in-Hi-titondHtiHeioehoni-teneHnxsi(aox2sxsacewna/awnewx3sinnteia)ihtwetcehhn(ai2at(ea(ach22c/cce3/(i/aedet233)icttc/)i)iec3cat)iaacccidaiiddcid MMMaaacccrrcrococoopopoploluolouurmrrmomoounununssscccdhdhdhiriariraoaoottmtomomomMammaatattaoaooccgcggererercoroMaoaoaMoMpupupuaploshaMusahcshrycmcyeroyeaecorraucaocncoaoprsorporptloctuthlohlodhuohrupmorrimrlmoaouounrutnumnmsoscsumcndcahdsdhhitracoiriradachotogmotitermmoaroomoatmmamaoutpaottamshaoacogccytegegaroeeoaracrogaoaupreurptupshoahshshyupeyyesehaaayretrrhatthhrth PPPuruuirrfiiiffiicccataaittiiooonnn GGGPPPCCC Purification GPC GGGPPPGCCCPC F(F(5F(55llumlumumvvvggagaa/l//lLilLinLinn))a)aattteee FluvaFFlilnulFuavlvatuaelvilnianaliantteaete GGGPPPCCCCCClleleeaaannn---uuupppooofffbbGbeeePeeefCffttGtaCaGaGllPlloPleGPooCwaCwCwPnCCC-CluellCepeaalaneonn-af-u-nubup-pepuoepoofffbtoabbfeleeleboeefewffteattfaalltllolaloowlwlwow PPPPuuuurrrriiiiffffiiiiccccaaaattttiiiioooonnnnAcghfrreaicmcuAtcAiAlicgctohfggurhfaArhfnearcirrrelceagimasaichfccmurmcrclteuaiiulitcctitomiliclicuctoautonutauiarnllincstarolrlsuaasalnrlllsal [*1] 00[0*[[*1*11][*]]1] 555 (5mg(/5(L5m)(m5gmg//LgL)/)L) AAcAccgghfghfhfrrrrerareiaeicaimcccmcmucututitliicliitoclitoctouaunauanrnlrlrsalsasalll [[*[**111]]] [*1[[*[]**111]]][*[[*1*11][*]]1] 1110000 00011155055 555222005010 fr1a10102c022155t510fi5ofrranafcrcrat1atmi1m51comi35n3o5i3tin0n1in0n0ign25o0renraanrnag2g220ne00eg220e5 2252552350 mm3mi33n0iimn0n03in0 GGGPPPCCCCCClleleeaaannn---uuupppooofffffGfaaattPttttyyCyttGtuCuGuGnPnnlPeGaPaCaaCCPnCCC-CluellCepeaalaneonn-af-u-nufupa-pputotpoyofffftoaufffaatntftayttyyttutytuuntnnauaana min fffrrraaaccctttiioioonnnrrraaannngggeee [[*[**222]]] [*2[[*[]**222]]][*[[*2*22][*]]2] [*2] [*[[*2*22][*]]2] ((w(wwhhheeennnpfpfpfrururauararircificfcificitctctaiaioaiototitioniononnnnrriraisiasasnininninng(sgwsgsueueuheffffefificincci(ieipewf(e(nwrnwunhtatr(h)the)wi)cfeenihcntnpefaipofrpnutraiuuronapfircrfnriuicffcratiircatcaisicfoaiatinoicttntoniiaigonsonotnunreiionrfasifianssincirnniiansgnesgsunnsienuueftgf)sfiffcueiiccifefiieiencnntie)tt))nt) 111 1 222111 1 2 222 2 GS***G*S*S*G1212h12PhPhPNPPoNPPosCNPPosCsCduu-iduu-idluu-iplierrpclipecrrcierrciicrciixoffriixaoffroxiioffaoaiioccliicclCpucclCpguaaCpugaagmaayLmeyttLmyettLelttiiNlliisoolnNiilsooNnlsoonminnmpilnnmiplnny:ply:y:aiawwlinawwlienwwlkenkekiiidi-iiditt-iidEtt-ctthhEcEhhchhsVsoTVsoTVoteiTteiel2l*GS*etirel2liurelt2lir21iuctsiu0icthmshi0chmmPs0hmamtm0aNytPPoa0ty0sCyesnel0gesdnl0-uueisgnl0tegalteApatheiAenrrca*G*SheAnchemnii12S*G*rCmly**GSxeoffmClyhae21ColyP21iiemlhccdmllNphP-PPoPdml*G*SCp-pudsCpa-Ng1PPoNaa21iPPo1lasCdii1-uusaCmiylhiimenLPlae2ilttmdena-uupdi2me-uuniNe2rrlcmiiPPolciNlmpsFsooCpimiiienrrc-iFrierricxcFoff-icdni-uuamiiiocrinniixrpoffclnlxoffiacccpn+olay:iioioerrn+cCoiipuon+cccloaogcciiilaaoeClwwrpuxpCnpoffueglemypeaaaEgokLlaapeiiuEtt-lmEuycci-rmlyLuliide-Lttre-CVpNuttlsmroooVngliiEmaaoVliiNchhmlsooNlsnmioomy-nnnpLspe-lttVpmo-iTnGpy:minnplniinnGpetinlNylGsaooy:ienly2y:lwwryniauetilamikiwlwicnnlswwlnps0AhnemliseAkmyii:dskA-atttii0aiidyiECliid-lwwchhttC-nleytteCElsnkEyl0schhgcyVhhoTe1iltsiid1salVtei-eoAT1VttlohTeeel2nlEr2eteichhteiu2mtedl2liecrlC2ylsdsr0ieuhmCdVtiouTticmCsic0Cahmslmteit0hmdmpy-el2mlartai0aetuyt10synilcislg0iehmeaesmnetl0nmsn2lg0aaAgethee0tynmtaAiaFhAmeenhe-iClysnnl0egmnemcClytieClymlaeAdn+ph-eonmlomldap-m1dp-eiClylpeiala1aEme1ni2ulii-mllaidmearnp-mm2en2ViFmoam1-imiilFinFa--cime-pnii2nn+nncGoicmoiFCIDCEin+yFCFIEDCn+on-eIFDECCooiponlnnlllEeceoolueiplojs-uAelplooloEjn+lueroeoEoouju-eouVtl-mieolwretlrCullwteeecVlulmwpueVoecymulou-eEcupnum-cntn-m1Gnmlcrpt-mmpcrtiteVmynmrGiotnotGria2ttoyantooylda-nnopnnsoAtnClnnntlGrntesArsAiteyreCtlvteiyiveClvCelsAyom1ylomoem1il1llC2el.elydp.2p.2Cpd1dl.CeC..2::::::d::::::::::::C2US3A4+23SU+A423SU4+Am.5chVm.5ch0m.5EVch0VE˚0Eeo˚CemLo˚eCVomL(CEDCFImVLt(Vd2nt(dto22d2lolLe2oooLo5ju2eL5nee05en/t0ln/l4we0x/mu4eecxu04mexm0enn0m/nct0mnC/i0/CrCDCIFEimt0iCnCtmoinCanACCIEFDmFCDCEInnAoLllnAneyoLnoojutLy)llCyele)loorNoeejouCo)ctCFDICEojluNCtlweceNenucectuvletlwell-llwelupenc-uoouoecopl-jmuuctoo1mpmnoe1nrimct1tatmhlcmtlwteoamlh2aruiaecthuri2n.otto2pkatenonankteFnomctknoeFmnrnneFt.xrintttxrtoEexraveeEtan::::::otEanveanvteoVmnVreU2AS+43nVomntoml-eve.-m5.eplch-eVlG0.EG=o.pmGp=˚e.o=CmLVl3.(.3t.::::::3dp2oA/::::::2::::::AL/A/A+23S4U15.e1n01C+A243US/+34A2USC.5m74::::::xCchmV7e007E.m5chm.51V˚chneV0Eo1+4A32US/0CE1m0LC˚Vei˚o(C2emCotmLnC2.m5dm2LVch2A(VVo(t0E2LCtd2Ld2yC˚o5eeCoo2)CLn2CmLL0N5V/ec(5ent4x0nd2m/e0/o4l-x24mLxpenom0e5/e01Cnn0inC//ma/h0nC40xCi2AmCemiC0mnLnkeAynAF)L/LC0CyNyicxC)m)CnCNEcANcal-Lpyol-V)1l-pnCopNoca1h12-eahalh-k2epG2oF=k1ekeFxFahE32xxaEkeEAa/FVan1xVVnnEC-e7a-Ge-e=V1nGG==3-2e3ICFCED3GA/FICCEDC=nEFCDICn1A/A0n/lleo0olCl1o3ju0elo1oloj7ueoeooCjueCtlAe7l/wet7l1ulwteeclulwu1eecuu1ecun1C2mcntmnm7ctmmcrt2itm2riCtotria1ttoantooCaCnnonnotn2nntrnter5terC5et5vteveveomomomll.lp.p.p...::::::1::::::1::::::100A545US04A55USA545US.m0hcV0.mhc0m0.hVc0V˚o0e˚oCemL˚oeCmL(CDIFECdmLt(d2nt(dto220loelLeoooeLo5ju1eL5ne15xn/1txln5/l4wex/5mu4eecu54memCennCm/nctCmn/i/rCDEFCCIimtLinCtmoinLCanFCICEDmLEFCCDInno0llnNneyonooNjuty)0lNly0elel)ooroeejouo)ctDCECIFoj5plutlwecepenucect2puvletlwell2l0lwaelu2encuoouoaecol0jmuuctooamm0noek0nrimctttkmhlcmtlwteokmlharuiecthurin.ottopatenoEnantenEomctnoeEmnrnnet.xrin5VtttxrVtoexraVve5eta5n::::::o1t-anve-anvteo-mG0n2rGeA554USno2G5mnto2ml5eve.5.m0ehplc5eVAl0.A=o.pmAp=˚oe.=CCmLCl1.(Cd.1t.::::::11p2o/::::::1e0::::::L1+//554AUS45+.1+04n04x4A55US/45A5US50.m4h::::::31EcmVe3E00.m3Ehc0.mCh0V0˚coneV0VA554US0/0CVm0L˚oVei˚o(CedmCLtmL-nC0m.hm2Lc-(Vdo(t-0d2te2LN22y˚oo5e2o1)eCLn0mLeLx5/0c(15pd50n1t4nx2m0/ex2/om504l540aCemmLenomme050/310Cnn3C0kixniC/3/mL/hin5n54iimCAn5emiLCn5mnALNnACeEyn)/CNyNCyicxC)CVpmL)nc2pcalpa-N2yo20l)alGna2ok0oc0hpk5ke2hlhaeEAo0=eEeEkxVCh1xVxaV-eEa/a-G+n-24xVGn2Gn52ea3E-5Ae5e=GA0n2AV=C=15eC-C1A1/2=+4//C+0+4143E0m/3E3E+0V04300ViV-n53EA-2-0V2C200-0m200m3m00i3035niA0im5nn5AA03CiCC5nAC SuSuSuSuseseseiepsipinpnnipaaganggrarrgaaPaPrPttAatAPiAiiooEtoAEEinn-n-o-E888oon-o0008fff00o0Su0PPPsef0SSSipBPnBBaSugSuSarseaasBeuSanPipnninptseAdnadaidgaipogErnnirianinPg-nanPdrt8sAtsosiaAPi0ouuEiufotEAnn0lil-lnaPoa-Ea8s8tonStt-ou0ii0if8nBnfn0ol0gPaggPfa0StoSPonioBniBiSdilllgBaianonasddinulidlinansitsnuidGudGnGdslulPuaguuPPastsClsCtCoiatttinintCmCmlCgmignlleleeeeoegoaaaaaiaislnosnslnuu-iu--lurururepeeppddddGodGoouufPufufPsscCsccsitCidGainantaGdnCmrugPrgruCgdGcPmcslcCeseiuPlCiPPtiPnentaaneAsACAmosoanComtaEEgElug-gneClems-eeu-er-e8aa-8ule8anpaeneuns00d0srsnasaus0-ope0u0-sunruifiuridnueAnp-nAoseApcudrCiCddfuCaedondpoiurdifgcsieuefceosiacsssuinPcsfinaerineseAangccorlglilrEgcaingcPnirP-geinPc8AnoAnoAiP0oEnEgsgEA0go-e-ei-E88euEgnuE8AnnEu-n00selsl0ssC8lsudusi0uni0in0tnintitseiingAn0gingnAAnsiCgPdgnePgCACPddAiAlpACiepdipeEeEoEsoios-es-ses-s8e8is8eilit0tl0te0iliio0o0lo0nuEnnAAsAsslsCuCiConotofiEugffnEusplppgsluPEuiuheEhinhtAslnpttiutlsgtiinhEguhonhnttga-PiasegatgPn8liiAlliprtAig0niPcpciEscooEA0ogp-asanua-Es8ociA8cpscits0-siti0C8idoiiod0dont0nfiseneAoeg0siApssntsCtChAiPottseooeetfCArfhrornpssEsapfhsl-hpit8ctohh0atfah0lcpliaiccdAhliactaCechcsaiidatcdeiledriecssetateserctrseisdrs dPISPSdInISdPninaCissCaiaCssssmsuBmusmBusBoloplaolpasplaslvtlslvtlteivtlteeidnteiednednd:g.d:g.d:g.3K3Kb3oKbo0boC0y0iCCyµilyiµlµ-l-HL-mHLHLmmeeieixxixxxxatatuatununnrreereeeePSIdniaCss5m5su5B,,o04l,04pa04sl0000vtlSIPd00teni00SdPIe00ddSIPni00aCnnssmmid:Cammg.iCammmssussBSPIdm3nKmsuggBouslbBggoiCapgga0ssol//Cosllpy//aipmavLL//tlusµslBlLLtseliLLvtl-evtldnotleHLitepmiaednedd:nsg.levtld:g.d:t3eg.iKiexxbdno3K30KbCodatb:ogy.i00µuClCyin3yiK-µlµlHbLrom-e0-eHLCHLmyimeµlie-exxHLiimxxxxatueat5atniuuxxrn,nee40ratreeeue00nBrB00BeeeemmBe5nBBn5n5,izggisz40i,zs,os40po//4050opp[LL00[ha00,[haha40e]0000emm]fe]f00nlfmmnlmmunluo00gguooooggloggmm//lrlrALL//ar//AaALLaggLLnnn//tthLLthheeennneee 111,B,3,33e-B-BB-DnBDDeizeiseHinnoiHnnpHnnizy[BitzyhiaztyrodtBroBdoeero]do[rfoBe[rannpoe[lrapoBuBaBpon]iznoxy]spxyo]ixpeyzoyiprzlspysrByryeornbyo[Aepybapehrabni[rzee[nrshnaeneeh]aeeeonfnpeen]tennel]nnf[zhufehnzaloenzloueeouoeo]ool[ofnor[anll[Aalauraer]Aoa]Apnao]pplnytnry1Ahyatrtrhe,rehne3enenentn-BehneneDeeeemimnHmnn1ieiz1ixy,1tixx3rodt,,tuo3t-3u[r1BuarDpo--rB,eBrDe]eD3xyeipeHnneyr-iiBHynnHeinDbznytrieznyroideztyeitoHnrodnero[dnrnoaopoi[rzyz[rteapo]axpoyrodop]oxy]yrxpy[r[pyeaaypobryryreybn]]exbeyepprrneenyenreneyyenbenznenrrnzeoezeoen[ona[ez[ea]aopR]mR]pR[pyaIyriIy]xIerprteneyunenreemnmmeixiixmtxuttuiruxerrteCeuCCroeoorrrnnnoooiilillRI RRSRSSIuIIuRullflIfefeerCrr ornHHHCoC2C2i2oOlOoOoCrnrrConnCCorOoOnoOili2il2ol2SilulferSSSuuulSflleffuHeerlrfr2eOr HHH22O2HOO2O CO2 CCCOOOC222O2 IInInnsssuuullalaatttiininngggoooiilill PPPCCCBBBInsulaItnIIinnssIsgunuulsaollaautiilttlniainngtgginoPogoilCiilolBil PPPCCCPBBBCB RRRIII RI BBBRRiRisiIssI(IR(2(22-I--eeettthhhyyyllhlhheeexxxyyyll)l))aaadddiBipippaiasatt(te2ee-BeBBitsihiBss(y2((i2l2s-h-e(-e2etxh-tthehyytly)hllhahyeedelxhxxiypeyyl)xall))yataeald)ddiapiipdpaaiatpetteaete mmmeeettthhhaaannnooolll methammmneoemetlhtthehataanhnnoaoolnllol RRRIII RI RPRRPPIhIhIRhttthIhhaaalliliciccaaaccciididdeeesssttteeerrrsssPhthaPlPiPchhhtPahtthhcaatialdhilcliiaccelaisacatccieadiirddcseiedessstettesersrtrsesrs 7777MSLCSMMMCLSSMMCSLSCDFCEtoeCECFDhtCFEDCeo0ardthoe0hardll0pareu.doolelouahpteu.loole.opuahe.uotoeo.uhaet)Tratm.lelw)Tecaretmleu)Tlrawtceecmelulrwueceecereuurceeruneexrieriaeemcnexiamntieamectxsiaiaemmcrttstaatmts:ttrsttatlrast:ttatatolist:santtoaloauinrtsnoanooisunnrootnlunryonntlr.yytenlfenry.nyte,fenr.,yeoften,e,atoe,,eoaeSea2eCrS2SCrm2CrmSe0mSR0ehSRe0hRa0hapa0aaapa0apaar7awa.r7wrp7rcw.rp.c,rpac,:::::aai,ha:::::aidh:::::VacihdVctdVc04PSM1tMP0S41sttooR4S0MP1stooPR0setoo.0RP0hhueP.0l0fehhu8e0.elhhuf.r8Ceelf˚8.ebreCMMSLCSoo.˚trCiLCbomto˚t1biLCoosemttCDFCEiL1Bmttsheatoe1Bhdisehat0B7arndtdihaqtodi7nltlLsqoap7ne.uitooeqoLosauhaett,iLcsA.aeuitd,hcAiete/u,n)TdarcAtmhiolu/ldnweNchexiso/nmuniceNxousiirmNnixersoedniimnio.onidniexiMSSLCMoaooieadmn.c(oam.oCtt(slCLSMMSMaoiCr(FECDJdSMSLCMttlattiC,l:tsCeon.JdtlthMil,iJadCn0ty.tEDCCFaardo,ltiCDFCCEn.ismonyoeoLtlhelioeunrymopA3nh0e.uoLaoriedomo0shLMSMSCuaharAt3Ldtleil.lytsAh3npluie.uloor.eshptNoyeee.uouah,feoue)TenrattCCDEFomistluahN.cttrult,,weeceeoa.isNosh,ceruecer)Tiseraat0umaacerrledsor)TarptlewamrecuelesllwoecelSrupe(pncenupe2r.uxuoouioCperceeo(puniaemueucahrmertree(mpnaamrm.et.rtmbnsrexiamnStrmeaiaeemx.cbi0er)Ttratatammiaemlcm.t:sRbtrlatwtsecahemalnttoatastr4uaaacieotiaturnioslnr:tsao4tat0aeitanrnaieot:spulnsrk4atlontiiaylnnaoaeadxtlsiikast7nnolno2ieamyicsskydnouonrna7om)nnyr2twurtd.ntrhsonye7nf2t)e.nlrtrohpttytat)l,0n1cot:tshey,r.tnoPy(fe0l1fre.,oaneEteayaaeief0oP1en(ftoi,esnE:::::2oa,tPi,(foiS-uhnEr,oengoi22,aCered-EV2atcHge,lvA-myS4Egn,Ht2v0SAr.CrES4y2He0PSM41fe0veCAnrr0H4mRts,ta0onmrhoH,Ro8Seraane0HePESa90e8e0eRaenaa.0hERp89hhueaSlhEvla9a2fe1C8realep0auvap.e1lr0anmCav7rpw-pu˚ae1aabnp.oiuSa-oarp0etniL.Cxvc-mRr7twarh81h.7rxiwvs,e.maarhp.8x.Bvhcarampho:::::t8a0icydiapmh,toai7nyt,0aadaoVqotc:::::aiyaic0i:::::thLsaaitin7rwi0hcidn0PSM41)Voc.etn,cdripVcAIn0s)ontocutodRnh)ioIt00SPM41/,nnmPaI00PSM410eoseCnt.0omnN:::::oaxRsshhutiooeCmmnhniRlPf0i8ieCeendPV.00dcoed.nrhhuC.0odl˚hh.utfb8loeeledoafoS04MP1t8(oeiL.CerlCemtesC.to˚ro1CuolelbRseMoi˚eooJdbtutBoPiLCon0heam,letttCniL.uC.01fdimtnhshueia1y7nlfssnteBfqh8oaamoetBfLhsadie.atLtrCaA3disi7nT˚itsbqhno7etntto,TqacAtoiLCtLsnuamutdTiLsahi1anNi/rtsen,etaishcAoBetcr,-rhauNcAdtxalshhiursdiimd-n/nrhihli7in/o-tnoupqeolNoudonxsei3NomeuLsx(pnneis.ariemii3niueaoie(mtieodn3,cAamoodpCsn.u.b0ridloMhii.pstaoaJd/n(0tiaraops,lo(CnC.0iaNxlrsCn,Moiiym4JldirMtii,Jid,lmolCtn.Lnoa,,ldeCns.kiA3oyyi.idsyhmo7nao2L(moetLAu)3CetihNA3lsh,MieiJdisshttcr01,luoCane.tsNPu(f,eriEyNisi,oecrpismuoa2cLrsee-(pnarA3gsr,iorpsEhmuHovApamuet4(pn.brue0(pnNtar,meraHisammcr.abnramno.sb8rta4eiariaEta9lopaanaunskoael4(pnynivoird4e1il7ani2punmaloskna)nma-ty.shbkrdy7inta2d7aon.x021v)oeaortahh8P)(fnothmE4ii01olo2e0n1ayPo(af-esktgE,P(ifyi0dEEiH7n22vAcio4-2)gn,0-thgnE,)oHrvHAEHI400av1A1noFDe04C8P(ef0a11BFBPBACFDnmrEECH9i1reCFDnaHA1BFCBPBnC2a08nAFPBC1BBle-avagE8,ee910a-aloEpEauayn9FDCCEdHeee0vhAn-loual4a-vnyDECFCeee-h0lelHo1laeviacuynFCCEDpeeeue1hora.rHHxmupvnutcnnntea-rhrn8Hnulormc-ltmi8nnnteerearhomolEio.tuxnnnatn9lvyorouyaer.helxohov8yfolazzzuaayorhtemaue8ylhoiorvuas0yomzzzpneuy1arospruzzztldcyiaolpntoooantlrrnwyse-iatldTpnt0atlnr)ooooainsuliwpteeltd0eluactoeaIoooail.xwuvepnecyarirtaehunoe8[[[unn)poernmmeycurnoenn)oh[[[I0eabkCon-yrmnconcnruI[[[l0yaibakomcntmntnmcruiabkoe0nmmmneCnucroruetdo]]teeCnxhm3c]eeitnroont]]tefxhlfe]eronofan)o]d]tntxh]effndIfea0fpslntlyovenu0flifdfaleflnunnlyouvenmolleurndflnlyoeoetveuneClufduupe,PunnaueiutusrpnoetPoneiopdndfrPntoioteafordyTsoeaoentoledsthyareortetryheetTreruerrrnhTatarreaahnerrt-naaaaelearfimaraaaaedhrsnmanu-enehledm-3nrnitnnldinnTrnnunettmtreua3entpse03itmtepthhtrbmthtrephhhps-bh0eiplphs,hbi0hiereae.ureyeee,a3e.ey,eae.nynncnpns:::::nc0innn:::::cKere:::::eeKee,eeKeeeeRUS0RAuRRSU0AaRRU0SAuaua.tctho11111111zV.tcth(8o11111111.tzV1FDicthCo11111111(8zVmP1BCBAFBic(877867889uemiooc77878698ume0mooac78987867ue-olmooaa(yn........DCFECeeehimtuia(........m61977064dHi2tcac(........inim74607916dtro2mitlcnnntnrm46901767d2looclLnleehoooula)Lyoh1uyeSLzzz)h1nerS)mh1pnen/rSst2ldmlnioooat/l0wemx2cta/imtuCcH1111BB10pee2xeucoeite0m1CB111Hc11B0eFDxyrcnHi[[[meCc111BB1H1eB1CBFBAP0cnineHoin,-,,,0bako1mnFDncieiruHiCeoyo01n-,,,,FDmm3386nCiABPBBCF1aCtieosen,,,,-oyN-ACBB1BFPlima3836CeiroynDFECoeoyeeems]ahm]tNmhx0]8633uieCndnnasnmN0mtamHif----f-apclndofaanmnyFECCDmmeee-lrohand---ptnyCEFCDnnnuntneeemfilnrlyho1veyLFDll----oupzDDDDHCldrpcciteunueHPBAFBB1ChoyLopuczuDDDDrhmaryopitnnntuyettyLrmzDDDDpo)ptrlzzzpopnnntrhlcrtoP0nialeopreapoh)lohorrunaeNoyeoooee-iiiirhlouyopoos)o.oueotadnyrldFCEDCyoeeezzzlouyheNoooatiiiilnnnnwuxeo.zzzeoryeNtae[iiiipnHur.onnnkrpceoxeohsetpnuldser[rrlernnnnsmxanoooraoptlktuldwnntyerlr[nsoooaeyt[[[aliiiilowkrenlupupupcaetaanseuahoyoeuaniiiioppttttueukbaoaauoape,mnuuycoeyrrye]iiiino[[[unttttzzzmpyyamrb,tncrrrr[[[n]rdttttonapnenyn,cbakopnnbronomnr]rrrrco]rus]tnakboatynhxldp]KbrewmnoooolcmrunrrrroooatlrwltndepamffKetwtaeoooofarourodlnpaed]tem]tKtyweoooohxuro]toeeofrlnn]lly]otddvehxlt]yeryeppnpfnenApfe[[[khfhatdunaubhfyfncnunepnppfaAkarenftlnkbaoalyovemnpppnnlcAprukfdlnlyoPnaarveilmunnuadtnryyyueeearounaoueneezotu.nraodoyyyyep]]tttnhxPn]eaezipnyyyeyrPentniPofzprrroefenrhonfanPdooronencreaPoerprrrtdnflnP:::::lyooeeeevtePlprrrardnyPaoaheunuaeeearrKuehehere[reeeeerteeezreAhmperhnnnPn[aeaiazrdhaeAnrnaha[oannnnoeRA0SRUazoatAedharmnnnaneutaatmdyeeenen.ah]ndttnhmtnEateeenrrr.he]nrpD.rteeeEen.wph]ehcthhro11111111bpzhVDEatamtawat(8ptDmtatwiaephmhymbhe-apehehcda87786798ubehneny.l.n-oyoayr-l.mnerae,8el.en.neae(........yrncet,8mt.iteetyri:::::,8m67764109ndep2ehcnhnnbhncKUene0eonlence:::::nUn0:::::LUe0nKee)aRA0RSUh1eKe.eneeSyeeu0nnaeem0RR0AUSn/ennn2cR0RAUSR0nueita.0t:::::xuRccthaio11111111zmVCcBH1BeRK(8ieeev.e0teiHActhi.tot11111111mvzVcthnic76778889o11111111uzAoe(vV8n,,,-,t11111112oR0RASUoi(ie8(Aeeoytmimm12111111u8336Ca(cse89778867mNume11111211icoa((........o87768798ueemamCim89388668otomndinnrm.tmm77906461dmC28986883----pcthcno11111111az(........rVC68386889oia(lt........(8sriii........yL3itm76679104dzDDDDi2irLpcscnmmt96710476d2........3pccoh60692179is)79878678nnhu1lee........3ooSopo)iilr20966917nLnom0a60619972Limnt)eNh1/iiii0e.oieoaS(........)2)h1tei0tnSt0nnnnxioyxt)cmn[m60149677d2mC1HB11c1B1/kecm)yn2s/eoiantpyl0u02xiHciytiiii0.muLxC1B11cHB11pecniomn,,,-,C11H11cBB1tttte.ea)h1,0ieeeeoy]S.oHin0my3836bCnHirrrrnisNonpn-,,,,mini/omein,,,-,ameoya2Kwndoooomei3386ineConytmr0lsdmNx----3368CpceismNC11BHB11c1demamiyendeimamnnmyL0zDDDDndppnpr----ApnpHinkmcta----pnpnihon-,,,,aripo)yLnierzDDDDeioyrpoyLcamtzDDDD3368CarppyyyeshceNtNniiiiizp.oeohpo)marmonnnnpo)xendornnmo[aeNPprrr----iiiikpn.oeoPoeNsiiiiaan.opeounnnnxoieeeyyLiiii[nnnnxzDDDDourppkc[tspkttttheahanp,us[]zoanpo)ypAniiiiuyrhbupnnnorrrryaiiiianuppttttaeN,iiiitttt.o]eoaaoK,nwooooyab]ronnnnlrrrrxdnoynbpeeee[.rrrrh]kdnpyaEsKewooooanpaprulDKdwoooopnppAwykeriiiildaupdneyaeardtttty,neppnp]Aoknyyabanppp-Ayyynrrrrekannparznl.naaraKwenooooearryyyled,8PprrrnaenzyyyePodnazyeeeeeePnpppprrrAknaPoPprrrUnhen0Po[arazeeeAnnhnnneeeaeayyyhen[zthezA[hannn0zneAeaheeennn.h]PaprrrnDCCEFtPE0oRatpDEDFCC0aweee.h]iFDECC0eeeRRUU.ahE]evEp[DRUURzwlAplDyhtURURnnn-weoaaollol.ua11111112elaot(oleoyaeueo-roIIVV,8yomeee-u.hl]IIVVatEl.Cl86896388ealIIewVVeprrtD,8nlwerul,w8teeUlua0lweuese........nu3enuieyeunn-U((096201796nUml.cn0((naimnn33enm0e((cr,8tmmec33rt)Rm330nreytt0neinrat33tUR0vantoR33Anait.33nnoienov11111121tn(00evAntt0nAe00rtmte1121111100(reC8368688911111121Rte(erremnntimCtnne668389881svCr........889388663nnei1Arte167099162nmms11211111........5i3(seimmm........03i5t01729696mmmnm569621709)nmiC868368980iyrt0t))))sy........3p.yi))p))97916062npi.0.t.).y.:::::.::::::::::4R44--I-NNNooonnRnyRRyyIllpIlIpRphhhIeeennnooolll 4-Non44y4-l-N-p4NNoh-ooNnennyoyylonpllplpyhhlhepeenhnnoeoolnllol RDDIDDDDTTTRRRI IIRI DDT DDDDDDTTTDT UV (3U3UU0VVnVU(m3(V(33)B3(3B0B30i0nis3isnsnmp0ppmmhnh)he)m)eennn)ooolllAAA BisphBeBBnisiioBsspplpihsAhhepeenhnnoeoolnllAoAAl A UV (3U3UU0VVnVU(m3(V(33)3A(30A3A00nnn3nnntmt0thmhmhnr)rra)ma)accc)eeennneee AnthraAAAcnnentAhtnthnhreartrahaccrceaeencnneeeene 2202000 000 012252555 1151551523303000 2202002m0mm323i3in55in55n 2252552530 3303003035 mm3mi35n3iin5mn53in5 min AR0USRA0USA0RSU.choV.ch5o.Vcho5V5eooemooeomo(CEFCDmt(md3t(mdto3md3lolLeoooLo3ueL3ne3en/tlnt/l0wex/mtu0eexute0mexmeennemncmmnCimCrCDFEmtmiCntmianCDFCEmCEFCDnnoLllpneoLooputL)lplle)loorNo,eeouo).tEDCCFoluN,tlwe.N,u.etuletlRwelllwelupRenuouoeRopmuucmpmnnrImctatmlcmIlwteamIaruaeturnottpkatnnaktnomcknomnrnet.rtttrtPeraeePtn:::::otPneteAmAre0RAUSAmtmEe.EpchoVE5pm-pe.-oo-m8.(8.t:::::8mdp30o:::::0:::::L0A0RSU3.e0n0A0RUS/RA0SU0t.0:::::xchomVe5e.Ach.oVchnoAeV5oR0AUSo5AmmCeio(oemCotomn.mdmC3cho(VCo(t5Ltmd3Lpmd3oeeooo)LnmLN3,/e.(3etnt0xnmd3m/e/eot0Rxt0mLxpenmee3eemCnninI/mamnCt0mxCimemiemnLpnkn)LpLmCpN,i.)m)nNP,.N,.RLppR)ARppNI,.aIaEIaRkpk-kIa8PPkP0AA0APEEEA--8-EC880-008000AA0ACCCAC 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN 77 77777 G-31 LIFE SCIENCE

ColonnEeffsecHts PofLeClu/enUt pHHPonLDCEAE-825 analysis Anion Exchange Chromatography Columns pH6.0 pH7.0 Sample : 100µL 1. Conalbumin 0.1% 3 2. Transferrin 0.2% 2 3. Ovalbumin 0.2% 4. Trypsin inhibitor 0.2% 4 1,2 1 Anion Exchange Chromatography Columns1 2 3 4 Colonnes HPLC/UHPLC pH10.0 Shodex™ An0ion5Exc1h0ang15e -m2Qin0 A-8205 | 5DEA1E0 -82155 20 3 Shodex™ Anion Exchange - WA-624 min 4 • Suitable for anion exchange analysis of low molecular weight • SuitablepfHo8r.0analyzing relativelpyH9h.0igh 2molecular weight compounds such as nucleotides compounds: pro3te4ins, peptides, DNA,3a4nd RNA 2 pH1 • Usable in a pH range from 2 to 12 wi1de • QA-825 fulfills USP L23 requirements Shodex™ An0ion5Exc1h0ang15e - 2E0S-5020 N 75C 10 15 20 0 5 10 15 20 45 min min min min • ComparCeoldumtno IEC: sSehordieexsIEcCoDluEAmE-n82s5, polyvinyl alcohol is used as 8.6) base mEaluteenrtial an:d(At);h22i00smmoMMfPTfriepiser-rHsaCzdilnbiefu-fHfefeCrrle(bpunHff8te.r0s)(,pe2Hp06ma.0Mr),a2Et0tihmoaMnnoBlapism-aiTntreits-e-HHrCCnl lbbuufffeferr(p(pHH97.0.0)) • 0% (B), 60min Low hydrophobic (iBn);t2(Ae0)mr+aM0c.15t,Mi3o-NDnaiaCmol ifnopprrooptaenei-nHsClabullfoferw(psH1a0n.0a) lysis under mFloiwldracteondi:t1Li.ion0emnaLrs/gmraindient; (A) to (B), 20min Detector : UV (280nm) Column temp. : 25˚C nd non-porous DEAE3N-4T for protein separation Gibberellin IsomerSshodex™ Anion Exchange hapanrovaivlnyidgseidssiDIeosDhtfihaxmpyrLrpleoaenpmtnegetiiansnhkois(osmeatenmnhvsdye) lnpfuwenpitcthSitdPisioezmanseaar.ltllD(igµincErjmloAeeucE)pt3ioNmn-ov4doTilfuiismedaePl.osNronoadmuect olumn, Manu2f.aGcAt1u4 rer 2Item Base Functional Pore Size Ion-Exchange s rapid Item CH3 NumbGSeaibrmbpelreel:lin Material Group (Å) Capacity es, as it (meq/g) HO SHQA-825 Quaternary 5,000 no8n.0-poroxus ge7l5DEAE3N-412T IEC QA-825 ammonium N.A. 0.45 F61H1O0O01C1 COOH 5000 Diethylaminoethyl 0.6 laminoethyl 20.0 x 3 150 20 IEC QA-2025 F6548000 SHQA-2025 Polyhydroxymethacrylate 2,000 1.2 8.0 1 x 50 20 : DiethylaminoethIEylC QA-LG 1 SHQA-LG Polyhydroxymethacrylate Diethylaminoethyl 2,000 0.55 1. eFn6d7o0G96A0142 N.A. 8.0 x 2 75 8 IEC DEAE-825 SHDEAE-825 Diethylaminoethyl 20.0 x 150 CH3 SHDEAE-2025 Sample : SHDEAE-LG 8.0 x 50 F6118255 1. Cona2lb0umin 0.4mIgE/CmLDEAE-2025 HO 2. Ovalbumin 1.2mg/mL HOFO6C54800C1OOH 3. Tryps2in0 inhibitor 1.0mgI/EmCLDEAE-LG F6709603 6.0 x 150 10 AXpak WA-624 F6356240 SHWA-624 Polyhydroxymethacrylate 4.6 x 10 10 AXpak WA-G F6700245 SHWA-G 30 min 7.5 0 x 51m00in 9 Asahipak ES-502N 7C F07640002 10 SHES-50220Nm7inC (pH6.0) CElou2le0un.m0t n x : S(A1h0);o02d5emx MIECPipDe1Er3aAzEin3eN--H4CTl bAusfafehrip(paHk 6E.S0-)502N 20C ColumnF68400:0S4hodex AsSaHhiEpSak-5E0S2N-52002CN 7C Polyvinyl alcohol : (LBi5n)0;e(aAr)g+ra0d.5ieMnt2N; 0(aAC) lto (B), 10Amsianhipak GC-20G 7B Eluent : CH3COOH/H2O/CH3OH 7.5 x 1.5mL/min Flow ratFe67100:2=11.05.m1/L0/.m4/i9n9S.5HGC-20G7B UV (280nm) Flow rate : Room temp. Detector : UV (210nm) 20µL Detector : Column temp. : 50˚C Column temp. : Data was provided by Prof. Yamaguch, Faculty of Agliculture, University of Tokyo. Injection vol. : NNuucclleeoottiiddeess Sulfide ion and cyanide ion Did you know? m Sample : 20µL Sample : 20µL We also sell Vials, Caps, 1. 5'CMP 20µg/mL 1. HS- 0.1mg/L Inserts & 96-well plates. 2. 5'UMP 20µg/mL 2. CN- 0.02mg/L 3. 5'TMP 20µg/mL For more information please 4. 3'CMP 20µg/mL 1 ask your Sales Representative today. 2 5. 5'ADP 100µg/mL 2 min) 6. 3'UMP 20µg/mL 7. 5'GMP 20µg/mL 8. 2'AMP 20µg/mL 9. 3'AMP 20µg/mL 6 10. 3'GMP 20µg/mL 8 14 79 3 10 5 0 3 6 9 12 15 18 min min 0 5 10 15 20 25 30 Column : Shodex IEC DEAE-825 min Eluent : 10mM Na2CO3 DENLDIEVAXEYTRY! Column : Shodex AXpak WA-624 + 1mM Ethylenediamine aq. Eluent : 0.35M CH3COOH aq. + 10% CH3OH Flow rate /0.35M CH3COONH4 aq.=240/100 Flow rate : 1.0mL/min : 1.0mL/min Detector : Electrochemical Detector : UV (260nm) (Electrode; Silver, 0mV SCE) Column temp. : 60˚C Column temp. : 25˚C 71 G-32 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

HPLC/UHPLC Columns Cation Exchange Chromatography Columns Protein separation using cation exchange column ( I ) CM-825 ( II ) SP-825 (Strong cation exchange) 30µL injection Shodex™ Cation Exchange - SP-825 | CM-825 Shodex™ Cation Exchange HPLC/UHPLC Columns-ES-502C 7C(Weak cation exchange) • Suitable for analyzing relatively high molecular weight 90µL injection Cation Exchange Chromatography Columns compounds: proteins, peptides, DNA, and RNA • Compared to IEC series columns, polyvinyl alcohol is used as Cation Exchange Chromatography Columns • Usable in a wide pH range from pH 2 to 12 base material offering differe1nt separation pattern Shodex™ Cation Exchange - SP-FT 4A 5 1 • Non-porous base material Low hydrophobic interaction with2pr4oteins • Provides ultra-rapid analysis using conventional devices • allows analysis under mild conditions 5 Shodex™ Cation Exchange - SP-421S 3 6 4 6 3 2 • Column for amino acids analysis by cation exchange mode • Provides simultaneous analysis of different amino acids • Fulfills USP L22 and L58 requ0 irem15ents 30 45 min 0 15 30 min Column : ( I ) Shodex IEC CM-825, ( II ) Shodex IEC SP-825, ( III ) Shodex IEC SP-420N Eluent : (A); 20mM Sodium phosphate buffer (pH7.0) (B); (A) + 0.5M NaCl Shodex™ Cation Exchange Flow rate ( I,II ) Linear gradient; (A) to (B), 60min ( III ) Linear gradient; (A) to (B Detector : ( I,II ) 1.0mL/min ( III ) 1.5mL/min : UV (280nm) Dimensions Particle Product Manufacturer Item Base Column temp. : Room temp. Ion-Exchange excNhaamngee columns UsIttleatmrnad-arardpsid anNaulymsibseor f pUrolttreai-nrMapaitderaianlalysis Capacity ID x Length (mm) Functional Pore Size usingPrcoatteioinnseexpcahraantigoenScuiozseliun(mµgmncsa) tion standards proGUtrelotinruap-rapid analy(Åsi)s of hemog(mloebqin/sg) Analysis of nitr tion of the testing me 25 8.0 ((xII)I C) SMP-7-8852255 8 ( II(I I)I S)IEPSC-P4-S280P2N5-825 (StnFFro66on51n(-41g12SIp88I..aIcoαT02m)a-rr05ypCoSt20pilhueoPsysni:-mn45oteoµy2gxtLp0ercynNephsgainenolg0gSe.Se1H)n6H%SASPP--218022552 2 A change) ion (WSteroankgccaatitoionneexcxchhaannggee) ) (S(Strtoronnggccaatitoionneexxcchhaannggee) ) 4 0.08% Sample : 5µL 1 Sample : 5µL F S AFSC Hemoglobin 20.0 9300xµµLLininj1eje5cc0ttioionn 20 non-3p0oµroILEuiCnsjetSycPpt-ieo2n0g2e5l F67039. R6i0b4onucle6ase A 0.1S2H%SP-LG P21..oαTly-ryChphysydimnrooogxteryynmpseintoh0ga.e1cn6ry%Alate Sul(f5o1p-rfoolpdydliluted) Contr5ol,000 0.4 4 IEC S6 P-LG 4 0.08% 4 8.0 x 50 20 3. Ribonuclease A 0.12% N.A. C 5 8.0 1 1 4. Cytochrome c 0.12% 4. Cytochrome c 0.12% x 745 5 8 1 IEC CM-825 F61150. L0y0s2ozyme 0S.0H6%CM-825 5. Lysozyme 0.06% 2 5 5 IEC CM-52025 SHCM-2025 5,000 20.0 x 150 5 20 4 F6548003 3 Carboxymethyl N.A. 0.4 4 IE3C CM-LG 6 SHCM-LG 5Polyhydroxymethacrylate 6 8.0 x 33 50 6 6 20 F6709605 3 5 2 2 1 F621133100 SHSP-FT4A 0.2 4.6 x 10 2.7 1 2 3 IEC SP-FT 4A 7.5 x 100 9 Asahipak ES-502C 7C F7640001 SHES-502C7C 1 20.0 x 100 13 Asahipak ES-502C 20C F6840003 SHES-502C20C Polyvinyl alcohol Carboxymethyl 2,000 0.55 30 45 min 7.50 0 x 15 15 50 30 30 min452m0in 0 0 2Asahip15a4k GS-2603m0Ginm7inB 0 F67210021 4 6 mSiHn GC-20G7B 0 0.5 N.A. 1.0 1.5 05 min 10mFFi66n730504FDCEC22ll364S152eooou11......atllweueuTCαRLM01mn0mc-yrmiyrCytbypstatonpooloohnetgsrncezytil:yumehnomcrmoboolgieetmnpreay.nesp:::::ecs3LU1((SiABAn0i.0hVSn7o)).˚;;o5CemgHS(2(d2aeAL0PHrn8e)/m0g-xmPA+4nrMI-ai20mEnGd1.CM5)iSeMEnSStPN;1-.(ba0AFu2T)SftfeOo4rA4S(CEDFCB(ptll)eooyouH,tlrlwe2ue5uen0mmc.mnr6tmta1ieno)nnct.i5nreotdepimvlyipnm.y:::::leb((3LU1SreBA0i.0hVn7n)).˚;;o5Cemz(2(d2aeAL0r8en)/m0gxm+enrMIai0mEnd.CM5)ieMEnSStPN;1-.(ba0AFu2T)SftfeOo4SrA4u(B(plf)oH,CCFED(25Nlleooomu.6tlamlweu1eui)nn+.imcm5n)rttanontretemp. : Shodex IEC SP-FT 4A hodex IEC CM-82C5o, l(uIIm) nShodex: I(EIC) SShPo-d8e2x5,IEC CM-825, ( II ) ShodSeaxmIpElCe :SP-825, : Column : Shodex IEC SP-4204N.6 x ( I1II5)0Shodex IEC S6P-420N 1C. MXpyoagkloPbi-n421S (5L(AB%in));;e2((aAB0Nr)m).g+AtMroa.0d1.M50ieM0En%StN; ba(Bu2fS)f,eO2rm4(pinH5.6NN) ..AA.. Eluent : 20mM Sodium phoEslpuheantte buffer (:pH(A7);.02)0mM Sodium phosphate buffe2r. (TprHyp7s.i0n)ogen : A) + 0.5M NaCl (34II..IRα)C-LiCbXinohpenyaaumkcrolgePtrraya-spGdesieiAnnotg; e(An)Ato : 1.7mL/min Linear gradient; (A) to (4B.)6, 60min x( III ) L((BiIn,I1)eI;)0a(LArin)ge+ra0dr .gie5rnMatd;iNe(Ana)t6C;t(olA)(Bto),(1B0),m6i0nmin (B), : VIS (415nm) Flow rate : 30˚C 1.0mL/min ( III ) 1.5FmloLw/mrainte : ( I,II ) 1.0mL/min ( III ) 1.5mL/min 5. Cytochrome c Detector : 280nm) 6. Lysozyme Detector : UV (280nm) Column temp. : m temp. Column temp. : Room temp. ysis of heUmUlotlrgtarl-oarb-aripnaisdpiadnaalnytAhsaneailsltyyessositisfisnohgfoemnfmiethrtooheggoeldmonsbcofooingrmsflpeoortbuilniizdnesrsAtfshonelaloltyewssitnsignogf mnietrtohgoednCsCcfaaootrmtefepecocrhtuhilnoiozdlesalramfsomliloniweninsegs Catecholamines ParPaaquraaqt uaandt adniqdudatiquat St A A 1 1 C S S Sample : 300µg/mL each, 10µL E F Sample : 5µL F Sample : 10µg/mL each, 10µL Sample : 10µg/mL each, 10µL Sample : 300µg/mL each,P1a0rµaLquat Sample : 20µL R ol 1. Urea 2Br- F AFSC Hemoglobin Control 2. Biuret 1. Urea 1. DOPA 1. DOPA H3C N+ N+ CH3 2Cl- D 3. Dicyandiamide C (51-fold diluted) 4. Guanidine 2. Biuret HO Diquat R 5. Guanylurea HO N+ N+ 3. Dicyandiamide CH2·CH·NH2 HO CH2·CH·NH2 2 COOH HO COOH CC 5 4. Guanidine 2 2 3 3 5. Guanylurea 3 2. Adrenaline 2. Adrenaline HO CH·CH2·NH HO CH·CH2·NH 2 HO OH CH3 HO OH CH3 5 3 4 3. Noradrenaline 4 3. Noradrenaline HO CH·CH2·NH2 HO CH·CH2·NH2 HO OH HO OH 14 14 4. Dopamine 4. Dopamine HO CH2·CH2·NH2 HO CH2·CH2·NH2 HO HO 1.0 01.5 0.5 0 1.0 5 11.50 15 0 20 5 10 15 20 min min min min 0 dex IEC SP-FT 4AColumn 10 20 min : Shodex IEC SP-FT 4A i4U03Sn0..hV691˚oCm2(0d1g0L9e0K/CFDCE0xmm0llHenooouAitmlLl2wneueusPnmc)omarOttfahnon4tHirept+2eaOm0k.p1E.2S:::::g-3U12S+5H0.0h0V003˚mo2Cm.P(5Cd2MOLM8e/740xSmCNnoA2imand0sCi)aumlhminipmakaloEnSa-FCDECt5e0ll0eoooubt2llweueuuCnmcmfrtfta7enontCrret(epmHp6..0::::: )3U12S+0.0hV00˚moCm.(5d2MLM8e/0xSmNnoA2imand0sCi)aumlhminipmakaloEnSa-t5e0b2uCff7eCr (pFCEDCHlleooou6tllwe.ueu0nmcm)rttanontretemp. (pH7.0) 20mM MES buffer (EplHue5n.6t) : (A); 20mCMoluMmEnS buffer:(pSHho5.d6e) x Asahipak ES-C50o2luCm7nC : Shodex Asahipak ES-502C 7C A) + 0.5M Na2SO4 (B); (A) E+lu0e.5nMt Na2SO:4 3.92g KH2PO4 + 0.12gEHlu3ePnOt 4 : : 50mM Sodium phosphate buffer ar gradient; : Linear gradient; in 1000mL of H2O : + 150mM NaCl : : 1.0mL/min B) to 100% (B), 2min : 5% (B)Ftolow10r0a%te (B), 2:m0in.6mL/min Flow rate : : UV (288nm) : : 30˚C mL/min Flow rate 1.7mL/Dmeintector : UV (190nm) Detector : 415nm) Detector VIS (41C5nomlu)mn temp. : 40˚C Column temp. 30˚C Column temp. diquat Paraquat and diquat Standard amino acids Standard amino acids + CH3 2Cl- ParaquSatample : 20µL 88 Sample : 0.1µM each, 100µL Sample : 20µL Sample : 0.1µM each, 100µL H3C N+ N+ CH3 2Cl- 1. Asp 10. Met 1. Asp 10. Met 2. Thr 11. Ile 2. Thr 11. Ile 3. Ser 12. Leu 3. Ser 12. Leu 4. Glu 13. Tyr 4. Glu 13. Tyr 1 888-226-2775 :: [email protected] :: 17www.life56s.. GPcrlioyenc1154e.. LP.yhcsea 17 5. Pro 14. Phe CANADIAN G-33 7. Ala10 16. NH3 6. Gly 15. Lys LIFE SCIENCE 8. Cy9s 171.3H1i4s 15 Diquat Diquat 1 10 13 14 15 1 7. Ala 16. NH3 23 9 2 8. Cys 17. His

Colonnes HPLC/UHPLC Special Separation Mode Columns Colonnes HPLC/UHPLC Shodex™ Hydrophobic Interaction - PH-814 • Separates proteins without denaturation • Applicable to samples obtained after ammonium sulfate fraction treatment Dimensions Shodex™ Hydrophobic Interaction ID x Length (mm) Particle Product Manufacturer Item Base Functional Pore Size Separation 8.0 x 75 Size (µm) Name Item Number Material Group (Å) Mode 10 HIC PH-814 F6110003 SHPH-814 Polyhydroxymethacrylate Phenyl 2,000 HIC Protein sPerpoatreaitniosnepbayrhaytidornopbhyohbyidcrionptehroabcictioinnteraction Choline aCnhdoalicneetyalncdhoalcineetylcholine chromatocghrraopmhaytography Special Separation Modes Columns 11 Special Separation Modes Columns11 Special Separation Modes Columns3 ••Sh odFReuixgn™idctAipoofnfliyanmlitgyerro--ubApaFspmeadokdpiaficekdinwgimthacth2eerimal3iscealnlya24bstl5eab3hlieghlig4sap65neded(s451S23a.....paLRMCOmnayiyvybpstaoaoclooelgbncz6ell:yuuhoym3mcrbro7lsieei)mn0naiµessLec542S31A.....aOLMRCmyiyvyb00000pstao.....olooe00101lgbncz34686l:yuuho%%%%%m3mcrbo7lieeimn0naµesLecA Sample : 10µL Sample : 10µL 0.03% 1. Cho3line 1. Choli5nme g/L 5mg/L 0.08% 0.16% 2. Ethylhomocho2l.inEethy1l0hmomg/oLcholine 10mg/L 0.16% 0.04% 3. Acetylcholine3. Ace1ty0lmchgo/lLine 10mg/L • Minimum detachment of functional groups ensures highly6. reproducible analysisα-Chymotryps6i.nαo-gCehnymotrypsinogen After choline anAdftaecrecthyolclihnoeliannedaarecesteyplcahraotleindeuasriengseparated using 0.05% 0.05% DE-413 polymDerE--b4a1s3epdorleyvmeersr-ebdapshedasreevceorlsuemdnp, hase column, solutes are passsoeludtethsraoruegphaAsCseHd-4th9r4otuoggheAnCeHra-t4e94 to generate hydrogen peroxhidyder.ogen peroxide. 2TahneerleescutlrtoincghheaTymdhnreioecrglaeeelscnudtleprtoitenecrgochhxteoiydmdreritociosgadeel nendtaepebtecelrteeocdxthoiduirgeshtinioslgydeentaebclteedhuigshinlgy Dimensions Shodex™ Affinity Chromatography Columns2 sensitive analyssise.nsitive analysis. ID x Length (mm) Particle Product Manufacturer Item Base Functional*See paPgoe 1r(2eÅfoS)*rSDiezEee-p41ag3e 12 fSoreDpMEa-4or1a3dteion Size (µm) Name Item Number Material Group 8.0 x 50 18 AFpak APA-894 F7118946 SHAPA-894 Protein A N.A. Affinity 0 020 2400 4600 min 60 min Polyhydroxymethacr0ylate C5ho0line oxyd1a0sm5ein, 10 min 4.6 x 10 18 Afpak ACH-494 F7118964 SHACH-494 Column AcC:eoStlyhulocmdhnoexlinReSp:akShDoEd-e4x1N3R.AS.pak DE-413 Affinity Column C: oSlhuomdnex HIC :PSHh-8o1d4ex HIC PH-814 Post column P:eoSsshtetorcdaoeslexumAFnpa: kShAoCdHe-x49A4Fpak ACH-494 Eluent E: l(uAe)n; t1.8M Amm: (oAn);iu1m.8MsulAfamtem+on(Biu)m sulfate + (B) Eluent E: l0u.e1nMt H3PO4 :+03.010MmHg3/LPOS4od+iu3m001m-dge/LcaSnosduilufomna1t-ede+cansulfonate + (B); 0.1M Phos(pBh);a0te.1bMufPfehro(pspHh7a.0te) buffer (pH7.0) 65mg/L Tetram6e5tmhygla/LmTmeotrnaimumethcyhllaomridmeonium chloride Linear gradientL;i(nAe)atrog(rBa)d, i6e0nmt; i(nA) to (B), 60min (pH8.0 adjuste(dpHby8.10.0aMdjuNsateOdHb) y 1.0M NaOH) Flow rate F: l1o.w0mraLte/min : 1.0mL/min Flow rate F: l1o.w0mraLte/min : 1.0mL/min Detector D: eUtVec(t2o8r0nm) : UV (280nm) Detector D: eEtlectororchemic: aEll(eEcletrcotcrohdeem:icPatl,(3E5le0cmtrVodSeC:EP)t, 350mV SCE) Column temp. C: oRlouommn temp. : Room temp. Column temp. C: o3l7u˚mCn temp. : 37˚C Protein separation by hydrophobic Chiral separation of epinephrines Chiral separation of lactic acids PchrorinotetmeinaratsocegtpiroaanrpahctyihornombyahtoydgrroapphhoyCbhicirainl tseerCpaahcrtiraioatnilosnepoaf reaptinonepohCfrheinopeliinsneepahnrdineacsetylcholine Chiral seCpahriraatilosnepoaf rlatcitoinc aocf ildasctic acids 11 2 Sample : 370µL Sample : 20µL SamSapmlep:le20:µ1L0µL Sample : Lactic Saacmidp5le0µ:gL/amcLti,c5a0cµidL 50µg/mL, 50µL 3 1. L-Lactic acid 1. L-Lactic acid 5 1. Cytochrome c 0.03% Epinephri3ne 50µEgp/mi1n.LeCphroinlinee50µg/mL 5mg/L 2. D-Lactic acid2. D-Lactic acid 4 2. Myoglobin 0.08% 2. Ethylhomocholine 10mg/L 11 22 6 3. Ribonuclease A 0.16% 3. Acetylcholine 10mg/L L0-.E1p6%inephrine L-Epinephrine 4. Ovalbumin 5. Lysozyme 0.04% OH OH D-Epinephrine D-EpinephrinAefter choline and acetylcholine are separated using 6. α-Chymotrypsinogen HO0.05% HNOH NH OH OHDsoElu-4te1s3 polymer-based reversed phase column, are passed through ACH-494 to generate HO HO HO HNOH hydNroHgen peroxide. HO 2 HO The resulting hydrogen peroxide is detected using an electrochemical detector to enable highly sensitive analysis. *See page 12 for DE-413 0 20 40 60 mi0n 0 5 5 10 0 10 15 5 151200mminin 20 min 0 05 5 10 10 15 min 15 min drophobic DFCEinlleooutlwteeunecmrttarontare ctio:::: n1SU((LAB.ihVn0));;oem(10d2aL..r8e81/0gxMmMnrHaimnAPdICmh)ieomnPstHpo; hn(-A8aiu)t1met4obsC(uBuflh)ff,ea6rote0(plm+iHni(n7Be.0) ECDFC) alleoooutllwneueunmcmdrttanontreatecmep.tCECDF:::::ylleoo(S1U0ou0ltl0.lwehVue.u5c0˚nomcCmm(r5thtd2ano%Ln8etore/t0xm(ewlnmOiimn/nvRp)).epC:::::aH(S1U0k030.hV.5CC0˚oCm(5DOd2%LB8eO/0xSm(Hwn-Oim4n/+vR5))03pC.a2HPECFDMkll3oeoouCCtsNlweeuDtOnacmrctBCOtaoonStlH)rel-ua4+mq5.03n/C.2H:::::M3SS610(EpCN5..lhhe01HmNaoocmM8Cdd=tg.rL09eelo/H)/L5xxcmaa3/hTPdqRA5ieneOj.FSu/mtCpr4spaitHcaa+emakk3d3leCA(D0btENhC0yElye=mH-1lc9a4g.-t5m01r4/o/M3L9m5d4SeoNon:adiPOuiutmH,m3)c51h0-lCECFDomdlrleeooouVidtcllweueuSeanmcmnCrttasnoEnture)tlefomnpa.teCEFDC::::: lleoo+S051Uoutl.0.lwehVueu50˚nomcCmmm(rttd2anoMLn3etre/t0xmeCnmOimunRSp).Op:::::a4S051Uka.0.hV50qC˚oCmm.(Rd2MLX3e/0x-mC8nOi5mun3RS) Opa4kaqC.RX-853 Column temp. : 37˚C Column temp. : Room temp. 1 Sample : 370µL epinephrinCehsiral sepCa3hriaratilos12Sn..aeECmopthhpofyalellihnrm:oea1m0atoµicLnohdonlieneolifCc105mhmmaggiacr//LLnaidldsseelipcaarcaitdoCiosbonsmeoprfvaleraidscoCotabointcsmehoaprifcgvaiEherdTidssa-oRnandtP1hon’ifsogErhcmToa-alRnuldPmt1enn’msoerpcmfefoiralcualitmetuennrmceieepcfsefoircn(atidhteiuentriocoerinecsstoicn(tadhlietpioolranetsetichaeligphlatt)e heig Chir21..aMClyytosogcelhorpboimnaercati00o..00n38%%of 6 3. Ribonuclease A 0.16% 2S1..aDLm--pMMleaaSEnn:dpadMemienalliepicncpldeahaec12Scr:lii..in2dacdLDe0ma-µ-5pcMML0ildeaaµnng:13dd/M0DsAm.ee0ofEaAltlµiLliecnu-ccgrd4tea/aece1mtccyslh3iiiLldcdcoa,phlar2ioonec0leliidµypnLamea1ns0eds0reµ-abdgc/ae1tmhst0yLermlo,cdgu2h/r0goLeµhlviLneAerCsaHered-4sp9ehp4aatsroaegtecedonlueuhsrmaiingtngeh,2t.4emmLp/.m(h1ii5ng0h˚22S1C..t.a4eLD)m-mm-pLLalaLepcc/:t.timiLcc(a1aaic5ncctii0idcd˚aCcn)ido5r0mµ0ga./5lmmtLe,Lm5/0mpµnL.oin(r4m00˚a.C5l )mteLm/mp.in(43S4210....a˚PBAUCmycerp)arenilcdtezoieiln:pneheenonS4123e....aAUPBmycerparenilcdtezoieiln:pneheenone 4. Ovalbumin 0.16% hydrogen peroxide. 5. Lysozyme 0.04% 6. α-Chymotrypsinogen 0.05% L-Epinephrine OH D-Epineph2rine The resulting hydrogen peroxide is detected using 1 Sample RSeadmucpeled plate heRigehdtu*ced plate height * HO NH 2 32 OH an electrochemical detector to enable highly 2 3 22 40˚C 150˚C40˚C 150˚C HO HO NH sen1sitive analysis. 1 3 Acetop3henone Acet3o.p2henone 2.4 3.2 2.4 *See page 12 for 2DE-413 2 Benzene Benz3e.n6e 2.3 3.6 2.3 HO * Plate height / parti*cPleladtieamheeigtehrto/fptahretipclaecdkeiadmreetseinr of the packed resi 44 G-34 CANADIAN 1 888-226-21 775 4::1 info@4 lifesc1ience.ca 1 :: www.lifescience.ca 60 min 0 5 10 min LIFE SCIENCE Column : Shodex RSpak DE-413

HPLC/UHPLC Columns Innovative manufacturing of mixed-mode HPLC columns Primesep® HPLC columns are specifically designed for mixed-mode HPLC/UHPLC Columns separations and are capable of separating a tremendous range of compounds by different separation modes based only upon mobile phase selection. A wide range of HPLC columns with id’s from 0.5 mm to 22 mm are available. PrimeSep® Phase Particle Size Pore Size ID Lengths Separation Typical (µm) (Å) (mm) Modes Application *A *100 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 Reversed-phase interac- Strongest acidic phase for weak bases, *200 0.5, 0.25 tion and cation-exchange AA, metals *C *500 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 Reversed-phase interac- Strong acidic phase for weak, medium AB 0.5, 0.25 tion and cation-exchange bases, AA, metals B 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 Reversed-phase and Medium acidic phase for strong bases, B2 0.5, 0.25 cation-exchange dibases D 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 Reversed-phase, cation Strong bases, dibases SB 0.5, 0.25 exchange and complex- N Strong bases, dibases, polybases P 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 formation 0.5, 0.25 Separation of complex mixtures of polar Reversed-phase and anionic and cationic compounds 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 cation-exchange 0.5, 0.25 Strong basic column for use with TFA, Reversed-phase, anion- phosphoric or perchloric acid solutions in a 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 exchange and cation 0.5, 0.25 exchange mobile phase Weak basic column for ammonium acetate 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 Reversed-phase and 0.5, 0.25 anion-exchange buffered solution Small hydrophobic and acidic compounds. 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 Reversed-phase and 0.5, 0.25 anion-exchange Low MW plasma components and bio fluids 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 Reversed-phase and 0.5, 0.25 anion-exchange Neutral and acidic compounds 5, 10 100, 300 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 Reversed-Phase, Basic and polar compounds 0.5, 0.25 anion-exchange and ion- Choose for separation of structural isomers 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 exclusion of aromatic compounds. Weak, medium 0.5, 0.25 aromatic bases Normal-phase, cation- exchange and HILIC Reversed-phase, pi-pi and strong cation-exchange *Choose the correct column by their functional group acidity to match the pKa value of your basic compounds. Primesep Phase About 50% of embedded acidic groups ionized at transition pH value A Ionized in all working pH 100 pH 1 200 pH 2 C pH 3.5 500 pH 5 Primesep A, 100, 200, 500 Primesep C Primesep B, B2, D, SB Primesep D Primesep P 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN H-1 LIFE SCIENCE

Colonnes HPLC/UHPLCColonnes HPLC/UHPLC Obelisc™ Obelisc™ columns, Obelisc R with reversed-phase characteristics and Obelisc N with normal-phase characteristics, separate polar and non-polar compounds using multiple separation mechanisms. Based on Liquid Separation Cell (LiSC ™) technology, they offer a new approach to separate a variety of small molecules. Buffer concentration, buffer pH, and organic modifier concentration are three orthogonal parameters of the mobile phase that allow adjustment of column properties to separate complex mixtures. ASK US ABOUT THE NEW SIELC PEI COLUMN! Two Obelisc Columns with Liquid Sepataion Cell Properties Phase Particle Size Pore Size ID Obelisc™ Phase Typical (µm) (Å) (mm) Lengths Characteristics Application R 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, 250, 150, 100, 50, 25, 10 Cationic groups separated from Analysis of complex mixture of acids, 0.5, 0.25 250, 150, 100, 50, 25, 10 anionic groups by hydrophobic chain basis, amino acids and neutral compounds N 5, 10 100 22, 10, 4.6, 3.2, 2.1, 1, Anions separated from the cationic Anlaysis of polar and charged analytes 0.5, 0.25 groups by hydrophilic chain SHARC™ SHARC™ columns are the first commercially available columns with separation based primarily on hydrogen bonding. SHARC stands for Specific Hydrogen-bond Adsorption Resolution Column. Hydrogen bonding is an interaction (attraction) of bound hydrogen atoms to the molecules with electronegative atoms such as oxygen, nitrogen, fluorine. SHARCTM columns are available in all standard dimensions: Column IDs: 22 mm, 10 mm, 4.6 mm, 3.2 mm, 2.1 mm, 1 mm, 0.5 mm, 0.25 mm Column Lengths: 250 mm, 150 mm, 100 mm, 50 mm, 25 mm, 10 mm Particles: 10 µm, 5 µm, 3 µm Pores: 100 A The SIELC guard column is a uniquely designed direct insert column that does not require any additional holders and allows zero dead volume connections with the column. Guards are available for all packing materials. The packing layer is 10 mm long and is available in 1 mm, 2 mm, 3 mm, and 4 mm internal diameters. Contact your sales representative for more information H-2 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

Chiral Chromatography HPLC/UHPLC Columns Chiral LC & SFC Chromatography Columns Chiral column chromatography is a variant of column chromatography in which the stationary phase contains a single enantiomer of a chiral compound rather than being achiral. The two enantiomers of the same analyte compound differ in affinity to the single- enantiomer stationary phase and therefore they exit the column at different times. The chiral stationary phases consist of a suitable chiral compound attached to the surface of an achiral support such as silica gel, which creates a Chiral Stationary Phase (CSP). The most common chiral stationary phases are based on polysaccharides such as cellulose or amylose. Other common chiral stationary phases are cyclodextrin, protein, enzyme, crown ether, anion-exchange, ligand exchange, etc. Polysaccharide CSPs (Cellulose and Amylose) Cellulose and amylose are linear polymers of optically active glucose units with molecular weights of 250,000 to 1,000,000 Da. Crosslinked derivatives of these materials coated onto silica give unique chiral selectivity. Their chiral recognition properties depend on the “steric fit” of guest enantiomers into the materialʼs cavities. Choice of eluent is the key factor affecting chiral recognition. Immobilized CSPs allow the use of a more robust and expanded range of solvents and bring new selectivity and higher sample solubility relative to conventionally polysaccharide coated CSPs. Traditional coated polysaccharide CSPs are limited in the solvents that may be used in the mobile phase and as sample diluents, but have been used widely and are part of many chiral separation reference methods. Protein Bound Proteins are high molecular weight polymers containing chiral sub-units. When bound to silica they act as very effective CSPs. The binding or complexation of small enantiomeric molecules is often stereospecific, especially for serum proteins such as α1-acid glycoprotein (AGP) or human serum albumin (HSA). Protein immobilized CSPs are typically used in buffered aqueous eluents compatible with many biological samples. They offer good selectivity. Enantiomer retention and stereoselectivity can often be significantly altered by changes in eluent pH or modifier concentration. They are primarily analytical columns, however can also be used for semi-preparative separations. Brush-Type Although “brush-type” (Pirkle) chiral selectors are relatively simple molecules, their well defined structure contains three types of functional groups capable of participating in charge transfer (π-π bonding), hydrogen bonding (“dipole stacking” interactions) and steric effects. The monolayer of chiral selector covalently bound to the silica surface usually gives a column of relatively high capacity and efficiency but often with limited chiral discrimination ability. Since the synthesis of the popular D-3,5-dinitrobenzoylphenylglycine phase, significant numbers of these multiple interaction CSPs have been synthesized. Polyaromatic hydrocarbon derivative CSPs are the most recent additions to the range. All “brush-type” phases are typically used with normal-phase eluents. Ligand Exchange Ligand exchange chiral phases are characterized by the attachment of a chiral chelating ligand to the stationary support. In the presence of an appropriate transition metal cation such as copper (ll), a molecular complex is formed with the chiral stationary phase ligand and the analyte. Compounds that are suitable for chiral ligand exchange are α-amino acids, hydroxy acids and small peptides. Crown Ether Chiral recognition with crown ether phases is achieved when a complex is formed between the crown ether and an ammonium ion from the analyte. These phases are used for solutes with a primary amino group at or near its chiral centre, such as amino acids and amino alcohols. Cyclodextrin Inclusion Cyclodextrins are a class of oligosaccharides containing six to twelve optically active glucose units. They are covalently bound to silica to form the corresponding CSP. The physical shape of these molecules is that of a truncated cone, the internal diameter of which is proportional to the number of glucose units. The interior of the cavity is relatively hydrophobic. Secondary hydroxyl groups at the entrance to the cavity contribute to the separation process. The relative stability of the inclusion complexes formed by the enantiomers of the guest molecule at the edge of the cyclodextrin cavity dictates the degree of separation. β-Cyclodextrin and its derivatives are the most commonly used CSPs of this type. Cyclodextrin CSPs are used in reversed-phase and are suitable for preparative separations. 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN I-1 LIFE SCIENCE

Chromatographie Chirale Chiral Phases Colonnes HPLC/UHPLC Phase Manufacturer Chiral Type Chiral Selector Chromatography Applications Mode CHIRALPAK® AGP Protein α1-acid glycoprotein Reversed-phase enantiomeric CHIRALPAK CBH Enzyme Cellobiohydrolase HPLC separations, pH variation useful tool CHIRALPAK HSA Protein HPLC CHIRALPAK BSA Protein Human Serum Albumin HPLC CHIRALPAK DSA Protein Bovine Serum Albumin HPLC CHIRALPAK MSA Protein HPLC CHIRALPAK RSA Protein Dog Serum Albumin HPLC CHIRALCEL® OA, OB, OC, Mouse Serum Albumin HPLC OD, OF, OG, OJ, OK, OX, OZ CHIRALPAK AD, AS, AY, AZ Rat Serum Albumin CHIRALPAK IA CHIRALPAK IB Cellulose Cellulose derivative HPLC/SFC CHIRALPAK IC CHIRALPAK ID Daicel Amylose Amylose derivative HPLC/SFC CHIRALPAK IE Amylose Immobilized Amylose derivative HPLC/SFC CHIRALPAK IF Cellulose Immobilized Cellulose derivative HPLC/SFC Chiral enantiomeric separations, CHIRALPAK IG Cellulose Immobilized Cellulose derivative HPLC/SFC broad application range CHIRALPAK IH Amylose Immobilized Amylose derivative HPLC/SFC CHIRALPAK QD-AX Amylose Immobilized Amylose derivative HPLC/SFC Chiral enantiomeric CHIRALPAK QN-AX Amylose Immobilized Amylose derivative HPLC/SFC separations of acids Amylose Immobilized Amylose derivative HPLC/SFC Chiral enantiomeric separations, CROWNPAK® Amylose Immobilized Amylose derivative HPLC/SFC amino acids, primary amines Anion-Exchange Chiral enantiomeric separations, Nucleodex ß-OH Anion-Exchange Quinidine derivative HPLC suitable for optical and structural Nucleodex α-PM Quinine derivative HPLC Nucleodex ß-PM Crown Ether isomers Nucleodex γ-PM 18-crown-6 type crown ether HPLC Chiral enantiomeric separations, amino Macherey-­ Nagel Cyclodextrin Nucleosil Chiral-1 Shodex α−Cyclodextrin HPLC acids and acid hydroxyl groups Ligand β−Cyclodextrin HPLC Chiral enantiomeric separations, ORpak CDBS-453 Exchange γ−Cyclodextrin HPLC Cyclodextrin β−Cyclodextrin HPLC broad application range ORpak CRX-853 Amino Acid Chiral enantiomeric separations, L-Amino Acid HPLC suitable for amino acids, hydroxyl acids, Resolvosil BSA-7PX CHIRALFLASH IA β-Cyclodextrin derivative HPLC and their derivatives CHIRALFLASH IC Amino acids and carboxylic acids CHIRALFLASH ID L-Amino Acid derivative HPLC CHIRALFLASH IE Chiral enantiomeric CHIRALFLASH IF Macherey­-Nagel Protein Bovine Serum Albumin HPLC separations, broad application range CHIRALFLASH IG Daicel Amylose Immobilized Amylose derivative MPLC Cellulose Immobilized Cellulose derivative MPLC GC chiral Inertcap Chiramix GL Sciences Amylose Immobilized Amylose derivative MPLC enantiomeric separations Chrom4 Amylose Immobilized Amylose derivative MPLC ChromCyclodexβ-DAC Amylose Immobilized Amylose derivative MPLC GC chiral enantiomeric separations ChromCyclodexγ-DAC Amylose Immobilized Amylose derivative MPLC ChromCyclodexβ-DET ChromCyclodexβ-DMP Cyclodextrin Cyclodextrin derivatives GC ChromCyclodexβ-DMT ChromCyclodexγ-DET Cyclodextrin Diacetyl tertbutylsilyl-β-Cyclodextrin GC Cyclodextrin Diacetyl tertbutylsilyl-γ-Cyclodextrin GC Cyclodextrin Diethyl tertbutylsilyl-β-Cyclodextrin GC Cyclodextrin GC Cyclodextrin Dimethyl pentyl-β-Cyclodextrin GC Cyclodextrin Dimethyl tertbutylsilyl-β-Cyclodextrin GC Diethyl tertbutylsilyl-γ-Cyclodextrin I-2 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

Chiral Chromatography USP Specific Analysis USP Code Column Name USP Specification Analysis Drug Chemical Name Drug Brand Name HPLC/UHPLC Columns (Pending/Official) L32 CHIRALPAK WH, Nucleosil Chiral-1 Fluorodopa FDOPA L40 CHIRALCEL OD and OD-H Limit of Organotin Efavirenz Sustiva L41 Limit of efavirenz R-enantiomer Voriconazole VFEND CHIRALPAK AGP Limit of voriconazole-related compound B Atomoxetine Hydrochloride Strattera L45 Limit of atomoxetine S-enantiomer Valsartan Diovan Nucleodex ß-OH, Nucleodex ß-PM, Limit of valsartan-related compound A Irinotecan Hydrochloride Camptosar L51 and Shodex ORpak CDBS-453 Limit of irinotecan hydrochloride enantiomer Ropivacaine Naropin L66 Limit of ropivacaine-related compound B Galantamine Hydrobromide Razadyne L70 CHIRALPAK AD, AD-H and AD-3 Limit of galantamine 4R, 8R-stereoisomer Montelukast Sodium Singulair Limit of montelukast S-enantiomer Tenofovir Disoproxil Fumarate Viread CROWNPAK CR(+) Limit of tenofovir disoproxil-related compound CHIRALCEL OC-H Limit of Fexofenadine Related Compound B Fexofenadine Hydrochloride Allegra Limit of Voriconazole Related Compound F Voriconazole Vfend, others Limit of Glycopyrrolate Erythro Isomer RS Glycopyrrolate Robinul, Seebri and Glycopyrrolate RS Sertraline Hydrochloride Zoloft, and others Limit of Sertraline Hydrochloride RS and Lamivudine Epivir Related Compound A RS Limit of Lamivudine enantiomer Abacavir Sulfate Ziagen Limit of abacavir enantiomer Levetiracetam Keppra Limit of levetiracetam R-enantiomer Tolterodine Tartrate Detrol Limit of tolterodine S-enantiomer Atorvastatin Calcium Lipitor Limit of atorvastatin 3S, 5S-steriomer Fulvestrant Faslodex Measurement of diastereoisomeric ratio Paroxetine Hydrochloride Paxil Limit of paroxetine-related compound C Briznolamide Azopt Limit of brinzolamide-related compound A Darifenacin Hydrobromide Enablex Enantiomeric Purity Valacyclovir Hydrochloride Valtrex Limit of valacyclovir D-isomer Oxaliplatin Eloxatin Limit of oxaliplatin-related compound D Trexall, Rheumatrex, others L75 Resolvosil BSA Enantiomeric Purity Methotrexate Calcium Supplements L79 CHIRALPAK HSA Enantiomeric Purity Calcium L-5- Methyltetrahydrofolate Aromasin L80 CHIRALCEL OJ, OJ-H, and OJ-3 Limit of Exemestane Exemestane Plavix To be specified Clopidogral Bisulfate Frova L90 CHIRALPAK AS, AS-H, and AS-3 Enantiomeric Purity Frovatriptan Succinate Zetia L93 CHIRALCEL OD-RH, and OD-3R To Be Specified Ezetimibe Enablex L99 CHIRALPAK IA and IA-3 To Be Specified Darifenacin Hydrobromide Aleve, Naprosyn L102 (S,S) Whelk-O 1 To Be Specified Naproxen Crestor L107 CHIRALCEL OJ-RH and OJ-3R To Be Specified Rosuvastatin Calcium EpiPen, Adrenalin L108 CHIRALPAK CBH Enantiomeric Purity Epinephrine Bitartrate Lysine L117 CROWNPAK CR(-) Identification and Related compound Lysine Vytorin L119 CHIRALPAK IC and IC-3 Organic Impurities Ezetimibe and Simvastin L## (To be Xalatan assigned) CHIRALCEL OD-R Assay and Organic Impurities Latanoprost 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN I-3 LIFE SCIENCE

Chromatographie Chirale Colonnes HPLC/UHPLC HPLC Screening Strategy - Immobilized Polysaccharides (Organic Solvents) SAMPLE NATURE? Choose Mobile Phase AddiƟve Alkane / 2-PrOH Alkane / EtOH Alkane / DCM / EtOH MtBE / EtOH 80/20 80/20 50/50/1 98/2 k2 < 1 1< k2 < 10 k2 > 10 k2 < 1 1 < k 2 < 10 k2 < 10 Increase No or Baseline Decrease Add or No or Baseline Increase % Alkane ParƟal ResoluƟon % Alkane Increase ParƟal ResoluƟon % DCM or ResoluƟon % Alkane ResoluƟon Alcohol Other Solvents and Other Solvents and Other Columns Eliminate Other Columns Decrease EtOH % Alkane METHOD DELIVERY HPLC Screening Strategy - Coated Polysaccharides (Organic Solvents) SAMPLE NATURE? Choose Mobile Phase AddiƟve Alkane / 2-PrOH Alkane / EtOH ACN / Alcohol 80/20 80/20 100/0 k2 < 1 1 < k 2 < 10 k2 > 10 k2 < 10 k2 > 10 No or ParƟal Add or Increase Increase No or Baseline Decrease ResoluƟon Baseline % Alkane ParƟal ResoluƟon % Alkane ResoluƟon Alcohol ResoluƟon Switch to Change the Alcohol MeOH or EtOH or Other Solvents No or ParƟal Other Columns Their Mixtures ResoluƟon Other Solvents METHOD DELIVERY Other Columns I-4 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

Chiral Chromatography HPLC Screening Strategy - Immobilized Polysaccharides (Water Compatible Mobile Phases) Acidic Compounds Neutral Compounds Basic Compounds HPLC/UHPLC Columns Aqueous SoluƟon pH 2 Water Aqueous SoluƟon pH 9 (HCOOH) + (20 mM N+H4HCO3) + 40% ACN 40% ACN 40% ACN or or or 60% MeOH 60% MeOH 60% MeOH k2 < 1 1 < k 2 < 10 k2 > 10 Increase Decrease No Baseline % Organic % Organic or ParƟal ResoluƟon Solvent ResoluƟon Solvent Other Solvents Other AddiƟves Other Columns METHOD DELIVERY HPLC Screening Strategy - Coated Polysaccharides (Water Compatible Mobile Phases) Acidic Compounds Neutral Compounds Basic Compounds Aqueous SoluƟon pH 2 Water Aqueous SoluƟon pH 9 + (HCOOH) (20 mM N+H4 HCO3 ) + 40% ACN 40% ACN or or 40% ACN 60% MeOH or 60% MeOH 60% MeOH k2 < 1 1 < k 2 < 10 k2 > 10 Increase Decrease No Baseline % Organic % Organic or ParƟal ResoluƟon Solvent ResoluƟon Solvent Other Solvents Other AddiƟves Other Columns METHOD DELIVERY 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN I-5 LIFE SCIENCE

Chromatographie Chirale Colonnes HPLC/UHPLC HPLC Screening Strategy - Protein-Based Chiral Phases - CHIRALPAK AGP (Water Compatible Mobile Phases) StarƟng condiƟon 10 mM Ammonium Acetate Buffer (pH 5.80) / 2-PrOH = 95 / 5 (v/v) Baseline (N) (A) acidic compounds (A)(B) (B) basic compounds (N) neutral compounds k2 < 1-2 1-2 < k2 < 15 k2 > 15 (A) pH 4.5 (A) pH 4.5 (B) pH 7.0 (B) pH 7.0 Rs = 0 Baseline Baseline Adjust ParƟal (Rs < 2) Baseline 2-PrOH (0-15%) Baseline Baseline Rs < 2 METHOD DELIVERY ACN, EtOH, MeOH (≤15%) Rs < 2 Buffer concentraƟon (10-100 mM) Rs < 2 Charged addiƟves Rs < 2 Other Columns CHIRALPAK® HSA, CHIRALPAK ® CBH or other Daicel columns TYPICAL CHROMATOGRAPHIC CONDITIONS Column size: 4.0 mm i.d. x 100 mm long Temperature: 20°C Flow rate: 0.9 mL/min Sample concentration: 0.1 mg/mL Injection: 5 μL To preserve the column life, it is recommended to operate at temperatures ≤ 30°C. I-6 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE

Chiral Chromatography Screening Strategy - CHIRALPAK ZWIX(+) AND CHIRALPAK ZWIX(-) MeOH / ACN / H2O MeOH / THF / H 2O HPLC/UHPLC Columns 49:49:2 49:49:2 With 25 mM Formic Acid and With 25 mM Formic Acid and 25 mM Ammonium Formate 25 mM Ammonium Formate Baseline k2 < 2 k2 > 8 Baseline Baseline Baseline Baseline Reduce MeOH% Increase MeOH% Baseline ACN% or THF% (60-80%) MeOH / H2 O (98:2 – 80:20) Reduce Flowrate * Increase AddiƟve Amount 0.2 mL/min for 3.0 mm i.d. Column 50 mM Formic Acid + 0.4 mL/min for 4.0 mm i.d. Column 50 mM Ammonium Formate Use Longer Column Add Acid ** 250 x 3.0 mm or 250 x 4.0 mm AceƟc Acid (2-8%) in the Mobile Phase Increase Temperature e.g. T + 45°C METHOD DELIVERY Reversal of EluƟon Order? METHOD DELIVERY Yes 50 mM Formic Acid + 25 mM Diethyl Amine (DEA) **CH3COOH (AceƟc Acid) as addiƟves if no compaƟbility LC-MS needed. CHIRALPAK ZWIX (-) in combinaƟon with DEA (25-50 mM) *To reach the opƟmal linear velocity (µ) METHOD DELIVERY TFA should be avoided (µ opt. = 0.5 mm/s) TYPICAL CHROMATOGRAPHIC CONDITIONS Column size: 4.0 mm i.d. x 150 mm long Flow rate: 0.8-1.0 mL/min Column size: 3.0 mm i.d. x 150 mm long Flow rate: 0.4-0.5 mL/min Temperature: 25 °C 1 888-226-2775 :: [email protected] :: www.lifescience.ca CANADIAN I-7 LIFE SCIENCE

Chromatographie Chirale Colonnes HPLC/UHPLC SFC Primary Screening Strategy – Immobilized Polysaccharide SAMPLE NATURE? Choose Mobile Phase AddiƟve CO280/ /M20eOH CO820//E2t0OH CO28/02/2-P0rOH CO720//3A0CN k2 < 1.5 1.5 < k2 < 15 k2 > 15 Increase Decrease % CO2 No or Baseline ParƟal ResoluƟon % CO2 ResoluƟon Try Secondary Screening METHOD DELIVERY SFC Primary Screening Strategy – Coated Polysaccharide SAMPLE NATURE? Choose Mobile Phase AddiƟve CO2 / MeOH CO2 / EtOH CO2 / 2-PrOH CO2 / ACN 80/20 80/20 80/20 70/30 k2 < 1.5 1.5 < k2 < 15 k2 > 15 Increase Decrease % CO 2 No or Baseline ParƟal ResoluƟon % CO2 ResoluƟon Try Secondary Screening METHOD DELIVERY I-8 CANADIAN 1 888-226-2775 :: [email protected] :: www.lifescience.ca LIFE SCIENCE