Book HB 37-3

Journal of the Brazilian Association for Horticultural Science Volume 37 number 3 ISSN 0102-0536 July - September 2019 THE BRAZILIAN ASSOCIATION Assistant Editor Francisco Antônio Passos FOR HORTICULTURAL ABH, a convite da Horticultura SCIENCE Mirtes F Lima Brasileira UFRPE Embrapa Hortaliças - Brasília R. Manoel de Medeiros s/n Itamar R Teixeira Dois Irmãos Executive and Editorial Coordination UEG - Anápolis 52171-900 Recife-PE Sieglinde Brune Tel (81) 3320 6000 Jackson Kawakami www.abhorticultura.com.br Associate Editors UNICENTRO - Guarapuava [email protected] Ana Cristina PP de Carvalho Jean Carlos Cardoso President Embrapa Agroindústria Tropical - UFSCar - Araras Roberto de Albuquerque Melo Fortaleza Jesus G Töfoli UFRPE - Recife Antonio T Amaral Júnior Instituto Biológico - São Paulo UENF - Campos dos Goytacazes Vice-President José Magno Q Luz Jackson Kawakami Arminda M de Carvalho UFU - Uberlândia Embrapa Cerrados - Brasília UNICENTRO - Guarapuava Juliano Tadeu V de Resende Carlos Alberto Lopes UEL - Londrina 1st Secretary Embrapa Hortaliças - Brasília Julio Carlos Polimeni de Mesquita Leandro SA Gonçalves Francisco Bezerra Neto UEL - Londrina IPA - Recife UFERSA - Mossoró 2nd Secretary Marina C Branco Rene de Paula Posso Geraldo Milanez de Resende Embrapa - Secretaria de Pesquisa e Embrapa Semiárido - Petrolina Desenvolvimento - Brasília Banco do Brasil - Campinas 1st Treasurer Gilmar Paulo Henz Moysés Nascimento Gabriel Alves Maciel Embrapa-Secretaria de Inteligência UFV - Viçosa e Relações Estratégicas - Brasília IPA - Recife Patrícia AA Marques 2nd Treasurer Maria do Carmo Vieira ESALQ - Piracicaba Thiago Leandro Factor UFGD - Dourados Renata SB Gomes APTA - Campinas Marinice O Cardoso Embrapa Cocais - São Luiz Embrapa Amazonia Ocidental - EDITORIAL COMMITTEE Manaus Renato Fernando Amabile Embrapa Cerrados - Brasília Horticultura Brasileira Scientific Editors [email protected] Rhuanito S Ferrarezi Tel.: (61) 99621 3780 Adriano do N Simões University of Florida - USA UFRPE - Serra Talhada Editor-in-chief Vagner Augusto Benedito Anderson F Wamser Samuel Roberts Noble Foundation Paulo Eduardo de Melo EPAGRI - Caçador - USA Ministério da Agricultura, Pecuária e Abastecimento - Brasília André Luiz Lourenção Valter R Oliveira IAC - Campinas Embrapa Hortaliças - Brasília Catariny C Aleman Wagner F da Mota UFV - Viçosa UNIMONTES - Janaúba Derly José H da Silva Waldemar P Camargo Filho UFV - Viçosa IEA - São Paulo Hortic. bras., Brasília, v.37, n.3, July - September 2019 247

Horticultura Brasileira is indexed by AGRIS/FAO, AGROBASE, CAB, JOURNAL CITATION REPORTS, SciSearch®, Directory of Open Access Journal (DOAJ), TROPAG Scientific Eletronic Library Online: http://www.scielo.br/hb www.horticulturabrasileira.com.br Horticultura Brasileira, v. 1 n.1, 1983 - Brasília, Sociedade de Olericultura do Brasil, 1983 Quarterly F o r m e r t i t l e s : V. 1 - 3 , 1961-1963, Olericultura. V. 4-18, 1964-1981, Revista de Olericultura. Not published: v. 5, 1965; 7-9, 1967-1969. Composition Periodicity until 1981: Annual. João Bosco Carvalho da Silva from 1982 to 1998: Biannual English revision from 1999 to 2001: Four-monthly Carlos Francisco Ragassi from 2002 on: Quarterly Printed copies From 2005 on: Sociedade de Olericultura do Brasil is called Associação Brasileira de Horticultura 80 copies ISSN 0102-0536 Journal partially sponsored by: 1. Horticulture - Periodics. 2. Olericulture - Periodics. I. Associação Brasileira de Horticultura. CDD 635.05 248 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Volume 37 number 3 July - September 2019 Journal of the Brazilian Association for Horticultural Science ISSN 0102-0536 CONTENTS EDITOR'S LETTER 251 COVER ARTICLE The multifunctionality of urban horticulture and its integration with the city ecosystem: a brief review of concepts and the case of São Luís João Flávio B Gomes; Renata SB Gomes; Alex O Souza 252 RESEARCH Combination of solarization, biofumigation and grafting techniques for the management of bacterial wilt in tomato 260 André R Zeist; Juliano TV de Resende; Bruna C Pozzebon; André Gabriel; Alex Antônio da Silva; Ricardo 266 Antônio Zeist 272 Torulaspora globosa: rhizosphere yeast promoting lettuce growth on seedlings and under field conditions Paloma G Cabrini; Fernando C Sala; Márcia M Rosa Magri 278 285 Genetic divergence among eggplant genotypes under high temperatures Ricardo de N Valadares; Danieli A Nóbrega; Lilian B de Lima; Adônis Q Mendes; Fabian S Silva; Roberto de A Melo; 294 Dimas Menezes 302 309 Partial diallel and potential of super sweet corn inbred lines bt2 to obtain hybrids Larissa Fernanda S Xavier; Jéssica Kelly Pestana; Alline Sekiya; Matheus D Krause; Rosângela Maria P Moreira; 315 Josué M Ferreira 324 Microsatellites for detecting inconsistencies in Capsicum cultivars registration in Brazilian database: more than meets the eye 331 Carlos Diego de O Azevedo; Rosana Rodrigues; Cláudia P Sudré 338 Selenium biofortification on garlic growth and other nutrients accumulation María B Pérez; Víctor Mario Lipinski; María Flavia Filippini; Katherine Chacón-Madrid; Marco Aurelio Z Arruda; Rodolfo G Wuilloud Herbicide selectivity for potato crop Núbia M Correia; Agnaldo DF Carvalho Soil water stress ranges: water use efficiency and Chinese cabbage production in protected cultivation Dalva Paulus; Ivan Carlos Zorzzi; Fabiana Rankrape Evaluation of production and quality traits in interspecific hybrids of ornamental pepper Naysa Flávia F do Nascimento; Elizanilda R do Rêgo; Mayana F Nascimento; Cláudio H Bruckner; Fernando L Finger; Mailson M do Rêgo Entomofauna and potential pollinators of strawberry crop under semi-hydroponic conditions Bruna Piovesan; Aline C Padilha; Marcos Botton; Moisés João Zotti Productivity, quality of fruits and architecture of Jalapeño pepper at different planting densities Carlos Francisco Ragassi; Juliana Zucolotto; Lucas M Gomes; Cláudia SC Ribeiro; Nuno Rodrigo Madeira; Francisco José B Reifschneider Production and quality of Sweet Grape tomato in response to foliar fertilization with boron Raphael O Melo; Hermínia P Martinez; Antonio PS Carneiro Hortic. bras., Brasília, v.37, n.3, July - September 2019 249

Journal of the Brazilian Association for Horticultural Science SCIENTIFIC COMMUNICATION Prospection of genetic resistance resources to root-knot nematodes in cucurbit genotypes Jadir B Pinheiro; Giovani Olegario da Silva; Valter R Oliveira; Geovani Bernardo Amaro; Alexandre Augusto de Morais 343 Combining capacity and heterosis in eggplant hybrids under high temperatures 348 Ricardo de N Valadares; Danieli A Nóbrega; Lilian B de Lima; Jordana Antônia dos S Silva; Ana Maria M dos Santos; Roberto de A Melo; Dimas Menezes Direct selection for phenotypic traits in carrot genotypes 354 Agnaldo DF de Carvalho; Giovani O da Silva; Gabriel E Pereira OBITUARY Farewell to the eminent Dr. Hiroshi Ikuta (February 9, 1929 - August 23, 2019) 359 Prof. Paulo César Tavares de Melo, Ph.D 250 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Editor's letter Hortic. bras., Brasília, v.37, n.3, July - September 2019 251

Cover article GOMES, JFB; GOMES, RSB; SOUZA, AO. 2019. The multifunctionality of urban horticulture and its integration with the city ecosystem: a brief review of concepts and the case of São Luís. Horticultura Brasileira 37: 252-259. DOI - http://dx.doi.org/10.1590/S0102-053620190301 The multifunctionality of urban horticulture and its integration with the city ecosystem: a brief review of concepts and the case of São Luís João Flávio B Gomes 1ID; Renata SB Gomes 1ID; Alex O Souza 2ID 1Embrapa Cocais, São Luís-MA, Brasil; [email protected]; [email protected]; 2Universidade Estadual do Maranhão (UEMA), Departamento de Arquitetura e Urbanismo, São Luís-MA, Brasil; [email protected] ABSTRACT RESUMO Urban agriculture is currently carried out all over the world. A multifuncionalidade da horticultura urbana e sua The activity is characterized by its multifunctionality, contributing integração ao ecossistema das cidades: uma breve revisão de to food security, preservation of biodiversity, better use of urban conceitos e o caso da cidade de São Luís spaces, and proper management of soil and water, in addition to contributing to increasing income and improving the quality of life A agricultura urbana está presente hoje em todo o mundo. A of farmers who live in the cities. In the 1980s and 1990s, urban atividade caracteriza-se por sua multifuncionalidade, contribuindo agriculture gained momentum on the international scene and, from para a segurança alimentar, preservação da biodiversidade, melhor 2005, in Brazil. Some successful experiences in the world (Detroit, aproveitamento dos espaços urbanos e manejo adequado de solo e Havana, and St. Petersburg) and in Brazil (Teresina, Sao Paulo, and água, além de colaborar para o incremento da renda e melhoria da Belo Horizonte) are briefly reported here. Then, we describe in more qualidade de vida dos agricultores que vivem nas cidades.Nos anos detail the case of the city of São Luís. The municipality is situated 80 e 90 a agricultura urbana ganhou momento no cenário internacio- on an island and its rural spaces have characteristics of peri-urban nal e, a partir de 2005, no Brasil. Algumas experiências exitosas no areas. Agricultural production has low expression in municipal mundo (Detroit, Havana e São Petersburgo) e no Brasil (Teresina, GDP (Gross Development Product). The main products are papaya, São Paulo e Belo Horizonte) são brevemente relatadas antes de nos cassava, beans, bananas, coconut, and passion fruit and, among determos no caso da cidade de São Luís. O município é situado em the vegetables, roselle, chives, coriander, and West Indian gherkin, uma ilha e seus espaços rurais têm características de áreas periurbanas. traditional regional species of Maranhão cuisine. The activity has A produção agrícola possui baixa expressividade no PIB municipal. two primary groups of actors: producers and intermediaries, with Os principais produtos são mamão, mandioca, feijão, banana, coco 83 and 41% of them, respectively, living in rural areas. Almost all e maracujá e, entre as hortaliças, vinagreira, cheiro-verde e maxixe, producers (92%) use their area, 79% use some sustainable fertilization espécies regionais tradicionais da culinária maranhense. A atividade practice, and 69% do not use pesticides. Production areas are small possui dois grupos básicos de atores: produtores e atravessadores, and producers need technical assistance. Transport and poor road sendo que 83 e 41% deles, respectivamente, vivem na zona rural. conditions are the main challenges to bring products to the markets. Quase todos os produtores (92%) cultivam em área própria, 79% The reality that came out from our study indicates the lack of public utilizam alguma prática sustentável de adubação e 69% não usam support to urban farmers in São Luís. On the contrary, successful agrotóxicos. As áreas de produção são pequenas e os produtores ca- experiences of urban agriculture have in common the convergence of recem de assistência técnica. Transporte e má condição das estradas public policies of urban planning, agriculture and supply, education, são os principais desafios para levar os produtos para as feiras. A and health. Urban agriculture is dynamic and must be integrated into realidade apreendida indica, de forma geral, falta de apoio público the urban ecosystem to make it possible to unveiling new perspectives aos agricultores urbanos em São Luís. Ao contrário, experiências on the countryside-city relationship. exitosas de agricultura urbana têm em comum a convergência de políticas públicas de planejamento urbano, agricultura e abasteci- mento, educação e saúde. A agricultura urbana é dinâmica e deve estar integrada ao ecossistema urbano, de forma a tornar possível lançar novos olhares sobre a relação campo-cidade. Keywords: Urban- and peri-urban agriculture, public policies, Palavras-chave: Agricultura urbana e periurbana, políticas públicas, production chains, socioeconomic analysis, diagnosis, scenarios. cadeias de produção, análise socioeconômica, diagnóstico, cenários. Received on June 28, 2019; accepted on October 24, 2019 252 Hortic. bras., Brasília, v.37, n.3, July - September 2019

The multifunctionality of urban horticulture and its integration with the city ecosystem: a brief review of concepts and the case of São Luís The urban population is likely to geographers, agronomists, sociologists, the author, along with the researchers reach six billion people by 2050 or economists, in governmental and Annu Ratta and Joe Nasr, released 66.7% of the world’s total population, non-governmental organizations, an updated revision of the first book, compared to 53.6% in 2014 (United are studying and seeking ways to updating the development of discussions Nations, 2015). The report The State make the multifunctionality of urban regarding urban agriculture. These of Food Insecurity in the World 2015 agriculture and its economic, social and authors propose a fundamental concept shows that food insecurity threatens environmental advantages increasingly of urban agriculture, recognizing the 795 million people worldwide (FAO, more valuable to the cities and their agricultural practices observed in 2015). Such scenario presents two population. their research as existing in the city significant challenges: how and where or metropolis in intra- or peri-urban to produce more food and how to Urban- and peri-urban agriculture areas, depending on the size of the ensure food security and conservation and the city: far beyond concepts city. Urban agriculture production of natural resources simultaneously. chains were already structured in the The use of intra- and peri-urban Cities and agricultural practices countries visited, once the reported areas for agriculture, known as urban have been intrinsically connected from experiences show urban agriculture as agriculture, is one of the alternatives the beginning of the first urban centers, an industry that produces, processes, in many countries. According to the still in the Neolithic period (3,500- commercializes, and distributes food to United Nations Food and Agriculture 3,000 BC). Agriculture was the main the urban population (Smit et al., 1996). Organization (FAO, 2015), urban activity of those human nuclei up to their agriculture is already practiced by 800 development into cities, where those In the 2000s, Luc Mougeot published million people worldwide. not involved with agriculture, carried the report Urban Agriculture: definition, out other activities, such as building presence, potentials and risks, and Urban agriculture is currently a houses, places of worship and fences, or policy challenges, a component of the universal practice (Boukharaeva et were involved in several other services. Cities Feeding People series, funded by al., 2007) and became an alternative Producers had the duty of feeding the the International Development Research to respond to the challenges posed others with the surplus of their harvests Center (IDRC) (Mougeot, 2000a). In the by the increasing urbanization. (Benevolo, 2011). Therefore, since the paper, Mougeot (2000a) stresses that the Urban agriculture plays a vital role Neolithic agricultural revolution, when emergence of the term urban agriculture in supplying food systems in cities, men went from being a predator-gatherer in the media and of urban agriculture in close connection to food security, to a domesticator-farmer (Mazoyer & experiences around the world increased biodiversity preservation, better use of Roudart, 2010), agriculture was already the responsibility of researchers in urban spaces, and proper soil and water an urban activity. Nevertheless, the seeking a conceptual consensus, mainly management (Mougeot, 2000, apud term “urban agriculture” or “intra- and to avoid the misuse of the terminology Machado & Machado, 2002). Besides, peri-urban agriculture” was coined only and to make it perfectly understandable urban agriculture contributes to increase recently and came to the spot just a few and transformative. For the author, incomes and improve the quality of life decades ago (Mougeot, 2000b). The “[...] the concept must be sufficiently of the farmers who, for one reason or United Nations Program for Human clear to allow users to easily realize another, migrated to the city. Settlements (Unhabitat) brought the its potential for complementarity and terminology to the international scene synergy with other correlated concepts.” There are successful experiences in the early 1980s by starting the Thus, Mougeot (2000a) suggested that in various developed and developing discussions on a new way of thinking the momentum went much beyond being countries of integrating urban the cities (Gomes, 2016). acquainted with urban agriculture, but, agriculture into the urban ecosystem actually, it was a matter of understanding through city planning and management, The researcher Jac Smit, considered how urban agriculture relates to other resulting in mutual benefits for both the “father of urban agriculture,” is concepts, especially to the urban the cities and the citizens. Leading the leading author of the book Urban ecosystem. Mougeot (2000a) suggested experts in urban agriculture emphasize Agriculture: food, jobs and sustainable some parameters to characterize urban its multifunctionality and its ability to cities, launched at the Urban World agriculture and therefore to distinguish provide quality food for the population, Forum, in Istanbul, in 1996, by the it from rural agriculture: the types of preserving natural resources, increasing United Nations Development Program economic activity, the intra- or peri- the incomes of the most vulnerable (UNDP). The book is a reference to urban location, the singularity of the groups, and integrating both intra- the academia and organizations that areas where it is practiced, its scale and peri-urban areas into the urban study and work with urban agriculture and production system, and product ecosystem (Mougeot, 2000a;Smit et and is the first work published on the categories, subcategories (food and al., 2001; Machado & Machado, 2002). theme with scientific rigor. It is based non-food) and destination. Mougeot’s on studies carried out from visits made studies (2000a) contributed significantly Knowing and understanding the to twenty countries between 1992 and to the discussion and to fostering urban dynamics of urban agriculture within the 1994, as well as incursions to another agriculture globally. urban ecosystem has been the object of ten countries after that date. In 2001, several research areas. Urban planners, 253 Hortic. bras., Brasília, v.37, n.3, July - September 2019

JFB Gomes et al. The multifunctionality of urban identificação e caracterização gardens, company and factory gardens, horticulture and the sustainability de iniciativas de AUP em regiões and suburban farms, among others metropolitanas brasileiras (Picture (Companioni et al., 1997, apud Bourque There is an urban agriculture of Urban and Peri-urban Agriculture & Cañizares, 2000). In Havana, urban characteristic that authors do not dispute: in Brazil and Policy Guidelines for agriculture has strong governmental its multifunctionality. The benefits its Promotion: identification and support, and urban production is quite of urban agriculture for individuals, characterization of urban agriculture representative to the Cuban economy. families, and the community are initiatives in Brazilian metropolitan The severe financial crisis that struck countless, notably food security, health regions) was carried out (Santandreu & the country in the early 1990s left improvement, income increase, and Lovo, 2007). This work, a milestone in Cubans unable to bring products from conservation of natural resources. Brazil, resulted from a very consistent the countryside to the cities due to fuel effort to diagnose urban agriculture in shortages. Hence, the population began Urban agriculture and its the country. The survey gathered the to use the empty spaces in the cities multifunctionality were officially joint support of the federal government, as cropping areas: “[...] many of the recognized in 1999 during the 15thsession social organizations and movements, first vegetable gardens were sown in of the Agriculture Committee (COAG), and universities. Santandreu & Lovo adjacent plots, patios and terraces, by held in Rome. COAG pointed out urban (2007) state that urban and peri-urban families who sought to feed themselves agriculture’s potential to address severe agriculture is a multidimensional once they realized that market shelves urban issues, including reducing food concept, as it encompasses production, became increasingly empty” (Bourque insecurity and building cities that are agro-extractivism and gathering, & Cañizares, 2000). more resilient during crises (Arruda, transformation and marketing, which 2011). Following the 15thCOAG session, can be practiced in intra- and peri- In St. Petersburg, urban agriculture the World Food Summit, in 2002, and urban spaces, being linked to the city is widely practiced, especially by the UN High-Level Task Force on the or metropolitan dynamics. citizens between 35-45 years. Russians Global Food Crisis, in 2008, recognized use rudimentary and organic practices urban and peri-urban agriculture as In 2009, the federal government, and their main production goals are viable and essential alternatives to this turn through the Ministério de self-consumption and supplementing produce food (Arruda, 2011). Desenvolvimento Social e Combate incomes, as the population spends a Fome (MDS) (Ministry of Social around 60% of the budget buying In Brazil, the discussion on urban Development and Hunger Alleviation), products in markets (Moldakov, 2000). agriculture landed in connection to launched the project Support Center Community gardens are relevant in the food and nutrition security agenda. for Urban and Peri-urban Agriculture the urban landscape and are taken into Agricultura Familiar e Agroecologia (CAAUP). CAAUP became part of the consideration in St. Petersburg’s urban (AS-PTA) (Family Agriculture and National Plan for Food and Nutrition planning and management (Moldakov, Agroecology) produced a consistent Security (PLANSAN) already in the 2000). Russian legislation encourages report to support discussions around following year, during the 4th CNSAN. and supports the development of urban a National Urban Agriculture Policy The PLANSAN anticipated actions for agriculture in intra- and peri-urban (Assessoria e Serviços a Projetos em the period 2012-2015, with the priority spaces. A clause compels the country Agricultura Alternativa, 2015). In goal of implementing the National to support gardeners’ associations Brazil, concepts and characteristics of Urban Agriculture Policy, under MDS by building urban structures to favor urban agriculture converged from the responsibility (Assessoria e Serviços the production, distribution, and Fome Zero Program (Zero Hunger) and a Projetos em Agricultura Alternativa, commercialization of urban agricultural the inclusion of community gardens and 2015). No other noteworthy meeting or products (Moldakov, 2000). were fully integrated into the context of breakthrough happened since then. food and nutrition security (Assessoria Urban agriculture is present in e Serviços a Projetos em Agricultura Successful urban horticulture developed countries as well, from a Alternativa, 2015). During the 2nd and experiences in Brazil and abroad historical perspective. Detroit, USA, 3rd National Food and Nutrition Security used the experience of European cities Conferences (CNSAN), held between We will present three experiences to install community gardens. Vegetable 2004 and 2007 (Assessoria e Serviços abroad (Havana, St. Petersburg, and gardens became a viable alternative a Projetos em Agricultura Alternativa, Detroit) and three experiences in to reduce the negative social and 2015), urban agriculture emerged as a Brazil (Teresina, Sao Paulo, and Belo economic impacts of the financial priority means to supply food to the Horizonte) among the many successful crisis of the 90s, back in the nineteenth cities. A more specific and in-depth urban agriculture experiences around century, reducing unemployment, discussion on urban agriculture was, the world. improving the nutritional standard of then, emerging. the population and generating income Community gardens are examples in a city devastated by the economic In 2007, the national survey of agriculture that take place in urban crisis (Branco & Hanson, 2011, apud Panorama da Agricultura Urbana space. In Cuba, public policies foster Castelo Branco & Alcântara, 2012). e Periurbana no Brasil e Diretrizes agricultural activities within the Políticas para sua Promoção: cities, such as intensive vegetable 254 Hortic. bras., Brasília, v.37, n.3, July - September 2019

The multifunctionality of urban horticulture and its integration with the city ecosystem: a brief review of concepts and the case of São Luís Branco & Hanson (2011, apud Castelo uses only 228.31 km2 or 12.6% of the updating the Urban Land Use and Branco & Alcântara, 2012) surveyed the total (Teresina, 2000). Aware of the large Occupation Law and including urban situation of community gardens in 22 idle area, the Municipal Secretariat of agriculture as an economic activity US states and noted that the initiatives Agriculture and Food Supply (SEMAB) defined as a legal land use category in were born from individuals or groups of implemented community gardens as the city (Belo Horizonte, 2011). individuals aiming to produce their own its main action to face the challenges food, organize cooperation networks of reducing the volume of fruit and São Paulo, a megalopolis with just with the aid of some institution or vegetable imports and supplying over 11 million inhabitants (IBGE, help the poor and the population with the city demands. Teresina used to 2011), bears numerous urban agriculture restricted access to food in the city. import slightly more than 90% of its initiatives. Regarding public policies, The dynamics consisted of social demands of vegetables and fruits from the city created the Urban and Peri-urban organization around an unoccupied other regions, most from Serra do Agriculture Program (PROAURP), space previously negotiated with the Ibiapaba, in the state of Ceará, but through Law No. 13,727/04, regulated owner to install a vegetable garden. also from the states of São Paulo, by Decree No. 51,810/10, and included Pernambuco, Bahia and Maranhão, urban and peri-urban agriculture in its The survey indicated that food which represented an important drain strategic master plan (Section X, Chapter security in the US was not a responsibility of financial resources to the state of III). PROAURP contemplated several of the public sector in general and that Piauí (Teresina, 2000).The program thematic axes of municipal management, actions on the issue were of private also aimed at generating jobs, increasing namely the fostering of agriculture and initiative (Branco & Hanson, 2011, apud incomes, and improving the food intake technical assistance, strengthening Castelo Branco & Alcântara, 2012). In of the covered families(Teresina, 2000). of central and vicinal markets, local Brazil, it goes in the other way. Federal, development, better integration of state, and municipal governments The city set community gardens in the links of the food supply system, assumed the responsibility for food urban areas identified as large pockets practice of the city and property social security through the development and of poverty, where beneficiary families functions, and environmental education implementation of public policies. In came predominantly from rural areas, (São Paulo, 2004). São Paulo experience the US, most community gardens are migrating mainly from the state of is remarkable also for recognizing in urban areas, followed by suburban Piauí, but also Maranhão, Ceará, Pará, the fundamental role of various local (or peri-urban) areas and, to a lesser and Tocantins, and do not have work actors, as well as their integration, extent, rural areas (Branco & Hanson, or employment, thus posing economic for achieving the success: public and 2011, apud Castelo Branco & Alcântara, and social challenges (Teresina, 2000). private schools, health units, rural and 2012). Gardens are relatively small, 70% Community gardens had co-management urban producers, local communities, of them with up to 2,000 m2. Organic (community and city) and the use non-governmental organizations, farming is the predominant production of unproductive areas as their basic social welfare institutions, and several system, which confirms the potential of premises. At the time of implementation, municipal departments are eligible to urban agriculture for the conservation the program included 2,503 families, integrate the program (São Paulo, 2016). and preservation of natural resources covered 116.6 hectares, and installed within cities, once the avoidance of 38 gardens. The demand came primarily Socio-spatial characterization of pesticides preserves soil and water from from the expansion zone of the urban the urban horticulture in São Luís contamination, ultimately protecting perimeter, where low-income families Island: a challenge for the city public health. concentrate. In Teresina’s experience, the municipal public agency (SEMAB) São Luís Island (from 02o22’23” Turning to Brazil, Itararé, a city in acknowledged the multifunctionality of to 02o51’00”S; from 44o26’41” to the neighborhood of Teresina, the largest urban agriculture through participatory 43o59’41”W) is located in the North city and capital of the state of Piauí, planning with the involved communities, of the state of Maranhão, in Northeast houses the most extensive community favoring actions for income increase, Brazil. The island is close to the coastal garden in an urban area in Latin America food and nutritional security, and region, with the Atlantic Ocean to the (Sinimbu, 2015). There are also social use of unproductive land, North, San Jose Bay and the Mosquito successful initiatives in metropolitan promoting positive changes for both Strait to the South, San Jose Bay again regions, such as Belo Horizonte and São the communities and the city. to the East, and San Marcos Bay to the Paulo, and in countless other Brazilian West. The island is a regional segment cities (Portal da Agricultura Urbana e The Municipal Policy to Support of the Brazilian coast located in the Periurbana, 2016), which developed Urban Agriculture (Municipal Law geological-morphological feature of actions and promoted the production, No. 10.255/2011) in Belo Horizonte, a Golfão Maranhense and composes a distribution, and commercialization of 3-million people city (IBGE, 2011), has large and complex estuarine system, animal and vegetable products in urban supported urban agricultural practices where São Marcos and São José Bays spaces (Santandreu & Lovo, 2007). since 2011. After discussions about the stand out (IMESC, 2014). The population revision of the city master plan in 2010, on the island is 1,309,330 inhabitants The city of Teresina occupies 1,809 Law No. 9,959/2010 was approved, and, the demographic density, 927.11 km2, of which the capital (urban area) inhabitants per km2. São Luís is the state Hortic. bras., Brasília, v.37, n.3, July - September 2019 255

JFB Gomes et al. capital and the island main city. The only (Figure 2). The contribution of well as foster actions to mitigate the remaining municipalities in the island São Luís agricultural production to the impact of other factors that make the are Paço do Lumiar, Raposa, and São municipal GDP is still minimal (IBGE, local agricultural production nearly José de Ribamar (Figure 1). 2014). The main products are papaya, unfeasible, such as high production cassava, beans, bananas, coconut, and costs, low qualification of producers, São Luís edaphoclimatic conditions passion fruit. Production areas are rather difficulties in supplying agricultural are suitable for growing vegetables, small and demand efficient management inputs and technological limitations. fruits, and medicinal plants, among techniques and technical assistance other crops. The several São Luís rural to increase street-market vendors the Most producers and intermediaries centers concentrate in the so-called productivity. live in rural areas. However, while 83% rural area of the municipality, which, of farmers do reside in rural areas, less in fact, is not rural, but peri-urban. Gomes (2016) interviewed 118 than half of the intermediaries (41%) Therefore, the agriculture carried out street-market vendors as part of a study actually does, although the figure is still in São Luís is actually in the domain of carried out in São Luís and found out higher than the intermediaries who live urban agriculture. Although numerous, that 48 (36%) were farmers selling their in urban areas (33%). Most producers the city agricultural production areas own products, while 70 (64%) were and intermediaries sell in São Luís do not guarantee a safe margin for intermediaries. The result highlighted (77% and 83%, respectively), followed the municipal food supply. Data from the strong presence of the intermediary, by Paço do Lumiar (21% for producers the Maranhão Hortifrutigranjeiros revealing the complexity of the and 3% for intermediaries), with 14% Cooperative (Gomes, 2016) indicate horticultural value chain in São Luís of intermediaries declining to answer. that most of São Luís vegetable Island. Public policies related to urban These figures indicate that the two supply comes from other states, the planning should give intermediaries municipalities, São Luís and Paço do production from Maranhão ranking 8th their real relevance as social actors, as Lumiar, should include producers and intermediaries in urban planning, as they Figure 1. Municipalities and geographic allocation of São Luís Island, Maranhão State, are the protagonists in urban agriculture Brasil (Source: Gomes, 2016). São Luís, Embrapa Cocais, 2016. on the island. In São Luís, agriculture is carried out in peri-urban space, while commercialization takes place in intra- urban areas. Such finding opens room for exciting propositions for the urban planning of the island. For example, it is necessary to review the master plans of Paço do Lumiar, São José de Ribamar, and Raposa, to adapt them to the City Statute (BRASIL, 2008). It also points to the need for policies to articulate and integrate the metropolitan region as a means to encourage the discussion of the relationship among municipalities and, at the end of the day, improve the socio- spatial indicators throughout the island. Producers claimed that transportation and the poor conditions of the roads are the main obstacles to bring products to the markets, while most of the intermediaries did not answer. When asked about the vehicle used to transport the vegetables to the market, 44% of producers and 48% of intermediaries said they use chartered vehicles, while 35% and 32% have their vehicles, respectively. Only 17% of producers and 3% of intermediaries make use of vehicles provided by the government. Several problems appear daily in the production-market flow, including the lack of own and third-party vehicles 256 Hortic. bras., Brasília, v.37, n.3, July - September 2019

The multifunctionality of urban horticulture and its integration with the city ecosystem: a brief review of concepts and the case of São Luís (freight) to transport the products, poor (Figure 3). These regional vegetables, offers few adapted cultivars. Thus, conditions of vicinal roads, especially well adapted to the climate and soil of tomato and onions are imported from in the rainy season, slow traffic, and the the region, are easy to grow and, thus, neighboring producing states and lack of governmental support, among have low production costs. Moreover, purchased by the intermediaries at the others. they are traditional in Maranhão cuisine, São Luís wholesale market. pleasant to the taste, are grown routinely, Most producers own their farms and have their culinary use culturally Half of the producers interviewed (92%), which stresses their vocation transmitted from one generation to do not receive technical assistance, and stability towards agriculture and the next. Tomato and onion are the which potentially reduces yield and, creates a strong background for the vegetables most commercialized by consequently, sales and income. The planning and adoption of public policies, intermediaries, although not originating lack of technical assistance also affects including urban planning. The main from the local production. São Luís the use of pesticides once producers vegetable crops are roselle (Hibiscus climatic conditions favor the high have no instructions on what to use, how sabdariffa), green onions (Allium cepa) pressure of pests and diseases over to spray, and how to dispose of the empty & coriander (Coriandrum sativum), and tomato and onions, and the local market packages. Indeed, two-thirds (69%) West Indian Gherkin (Cucumis anguria) of producers do not use chemicals. Figure 2.Value of the food products used to supply São Luís, in BRL$, per state of origin (2013-jun/2016). Source: Cooperativa dos Hortifrutigranjeiros do Maranhão (2014, 2015, 2016). US$ 1,00 = BRL$ 3,26 (in December 31, 2016. Central Bank of Brazil, https://www. bcb.gov.br/conversao). São Luís, Embrapa Cocais, 2016. Figure 3. Leading fruits and vegetables produced and commercialized by the interviewed producers in São Luís Island. São Luís, Embrapa Cocais, 2016. Hortic. bras., Brasília, v.37, n.3, July - September 2019 257

JFB Gomes et al. Although the figure is significant, it is The large number of public and In few words, the comprehensive still disturbing that 31% of producers do private idlegreen areas in intra-urban approach used in this work to describe use pesticides, the vast majority without spaces in São Luís could be earmarked for the reality indicates a lack of government any technical assistance. Aspects agricultural activities, complementing support to urban farmers in São regarding the technical efficiency and rural productivity and increasing both Luís, especially technical assistance, appropriateness of the products to food security and incomes of urban- infrastructure (transport, roads), and specific pests and crops, dosage, and and peri-urban farmers. The existing technological support. These three grace periods need to be considered. intra-urban conservation units have dimensions should be included in public Grace periods are compulsory written large areas and can be interesting for policies and programs. on the package leaflet. Observing the development of urban agriculture the deadline is important to ensure as well. Furthermore, urban agriculture REFERENCES food safety. Finally, it is necessary to can turn out to be a vector for protecting check whether producers use Personal the natural resources and for fostering ARRUDA, J. 2011. Agricultura urbana na Protective Equipment (PPE) as a means environmental education, if these areas região metropolitana do Rio de Janeiro: of protecting them and the applicators are cultivated using agroecological sustentabilidade e repercussões na reprodução from contamination. Interestingly, principles. das famílias. Rio de Janeiro: UFRRJ.197p. 79% of producers use some sustainable (Ph.D. thesis). production techniques, such as green or As far as public policy integration organic fertilizer. is concerned, the implementation of ASSESSORIA E SERVIÇOS A PROJETOS EM a program to integrate the surplus of AGRICULTURA ALTERNATIVA. 2015. When asked about recycling the food produced by urban agriculture Subsídio para uma política nacional de leftovers from the market, while 97% and the supply of government-assisted agricultura urbana e periurbana (PNAUP). of producers responded, only 30% of institutions is undoubtedly a great Available at <http://aspta.org.br/wp-content/ intermediaries agreed to answer: 65% opportunity. Another feasible example is uploads/2015/04/Subsidio-para-uma- of producers and 76% of intermediaries the integration of urban agriculture with Poli%CC%81tica-Nacional-de-Agricultura- use of leftovers. While producers mostly the municipal solid waste management Urbana-Periurbana.pdf>.Accessed March, donate it (59%), intermediaries resale policy, which can potentially promote the the leftovers elsewhere (44%), such as improvement of the urban landscape and 10, 2016. from door to door. the mitigation of the severe sanitation and health problems arising from BELO HORIZONTE. 2011. Lei nº 10.255, de FINAL CONSIDERATIONS the accumulation of waste. As urban 13 de setembro de 2011. Institui a política agriculture happens by definition within municipal de apoio à agricultura urbana e We believe the successful experiences the city, it is also worth noting that dá outras providências. 2011. Available at in urban agriculture worldwide preventive measures to avoid soil and <https://leismunicipais.com.br/a/mg/b/belo- confirm its multifunctionality, and groundwater contamination by pesticide horizonte/lei-ordinaria/2011/1026/10255/ the convergence of public policies and chemical fertilizer residues should lei-ordinaria-n-10255-2011-institui-a-politica- on urban planning, agriculture and be very strict, especially when there municipal-de-apoio-a-agricultura-urbana-e- supply, education and health should is risk of contamination of the water da-outras-providencias. Accessed November strengthen it. In addition, it is necessary sources used to supply the population, to understand the dynamics of urban in addition to the general damages to the 15, 2016. agriculture, integrating it into the urban environment. ecosystem to make it possible to develop BENEVOLO, L. 2011. História da cidade. São new perspectives on the field-city The use of public policies to foster Paulo: Perspectiva. 728p. relationship. organic farming is a viable alternative to increase the added value of the BOUKHARAEVA, L; CHIANCA, G; MARLOIE, The main challenge of the urban products, besides being ecologically M.2007. Agricultura urbana como fenômeno agriculture value chain in São Luís is the correct. Organic farming also benefits universal. Available at http://www.latio. fragmentation of production areas and farmers’ physical integrity and the org/images/news/files/Chapitre%20 the inherent spatial distances between conservation of natural resources by Agricultura%20urbana%2012%20juin%20 production and commercialization. eliminating the use of chemicals. Knowing the causes of this phenomenon Therefore, urban agriculture, when 2007.pdf. Accessed September 10, 2016. should be an important action in the combined with agroecological practices urban planning of the island. Public and organic production, is an important BOURQUE, M; CAÑIZARES, K. 2000. policies need to consider and propose instrument for the mitigation of adverse Agricultura urbana em Havana. Revista mechanisms to reduce the distances environmental impacts on unproductive de Agricultura Urbana. 1: 1-8. Available among the urban spaces that house and anthropized green areas, and favors at <http://www.ruaf.org/sites/default/files/ agricultural activities, making them the protection of the existing natural more compact. resources, allowing their coexistence AU1havana.pdf> Accessed May, 9, 2016. with human settlements. BRASIL. 2008. Estatuto da Cidade. Brasília: Senado Federal, Subsecretaria de Edições Técnicas. 102p. CASTELO BRANCO, M; HANSON, JC. 2011. Panorama das hortas comunitárias no Estados Unidos. In: CASTELO BRANCO, M; ALCÂNTARA FAA (eds). 2012. Hortas comunitárias: experiências do Brasil e dos Estados Unidos. v. 3. Brasília: Embrapa. p. 85-107. FAO.FOOD AND AGRICULTURE ORGANIZATION. 2015. The state of food insecurity in the world: meeting the 2015 international hunger targets: taking stock of uneven progress. Rome. GOMES, JFB. 2016. A multifuncionalidade 258 Hortic. bras., Brasília, v.37, n.3, July - September 2019

The multifunctionality of urban horticulture and its integration with the city ecosystem: a brief review of concepts and the case of São Luís da agricultura urbana e a sua integração no org/sites/default/files/AU1petersburg.pdf. November 11, 2016. ecossistema urbano da ilha de São Luís, São Accessed May 9, 2016. Luís, MA. São Luís: UEMA. 161p. (M.Sc. MOUGEOT, LJA. 2000a. Urban agriculture: SÃO PAULO (Município). 2016. Secretaria definition, presence, potentials and risks, Municipal do Verde e do Meio Ambiente. thesis). and policy challenges. Ottawa: International Programa de agricultura urbana e periurbana. Development Research Centre. 58p. Availableat http://www.prefeitura.sp.gov.br/ IBGE. INSTITUTO BRASILEIRO DE MOUGEOT, LJA.2000b. Agricultura urbana: cidade/secretarias/meio_ambiente/servicos/ GEOGRAFIA E ESTATÍSTICA. 2011. Censo conceito e definição. Revista de Agricultura proaurp/index.php?p=30091. Accessed demográfico 2010. Rio de Janeiro. Available Urbana 1: 1-8. Available at http://www. November 11, 2016. at http://www.ibge.gov.br/home/estatistica/ ruaf.org/sites/default/files/AU1conceito.pdf. populacao/censo2010/. Accessed September Accessed May 9, 2016. SINIMBU, F. 2015. Uma horta agroecológica PORTAL DA AGRICULTURA URBANA E modelo. Available at https://www.embrapa. 9, 2014. PERIURBANA. 2016. Iniciativas produtivas. br/busca-de-noticias/-/noticia/3529851/ Available at http://agriculturaurbana.org.br/ uma-horta-agroecologica-modelo. Accessed IBGE. 2014. Maranhão: Infográficos: despesas e iniciativas/menu01_inciativas_produtivas. August 15, 2015. receitas orçamentárias e PIB. 2014a. Available at: http://cod.ibge.gov.br/1L1N>. Accessed html. Accessed March 10, 2016. SMIT, J; NASR J; RATTA, A. 2001. Urban July 11, 2016. SANTANDREU, A; LOVO, IC. 2007. Panorama agriculture: food, jobs and sustainable cities. Nova York: Programa das Nações Unidas para INSTITUTO MARANHENSE DE da agricultura urbana e periurbana no Brasil ESTUDOS SOCIOECONÔMICOS E e diretrizes políticas para sua promoção: o Desenvolvimento. , 302p. CARTOGRÁFICOS. Maranhão em mapas: identificação e caracterização de iniciativas mapas temáticos do Estado do Maranhão. de AUP em regiões metropolitanas brasileiras. TERESINA. 2000. Secretaria Municipal de 2014. Available at <http://imesc.ma.gov.br/ Belo Horizonte: REDE-IPES/RUAF, Available Agricultura e Abastecimento. Departamento de maranhaoemmapas/Home/mapas>. Accessed at: http://www.agriculturaurbana.org.br/textos/ Produção. Estudo de caso: hortas comunitárias. December 18, 2016. panorama_AUP.pdf. Accessed July 15, 2016. In: SEMINÁRIO AGRICULTURA SÃO PAULO (Município). 2004. Lei nº 13.717, de 8 URBANA NAS CIDADES NO SÉCULO MACHADO, AT; MACHADO, CTT. 2002. de janeiro de 2004. Dispõe sobre a implantação 21, .Anais...Teresina. Available at: http://www. Agricultura urbana. Planaltina: Embrapa das Terapias Naturais na Secretaria Municipal agriculturaurbana.org.br/sitio/textos/teresina. Cerrados. 25p. (Documents, 48.) de Saúde, e dá outras providências. Available at http://www3.prefeitura.sp.gov.br/cadlem/ htm. Accessed March 15, 2016. MAZOYER, M.; ROUDART, L. 2010. História secretarias/negocios_juridicos/cadlem/integra. das agriculturas no mundo: do neolítico à crise asp?alt=09012004L%20137170000. Accessed UNITED NATIONS. 2015. Department of contemporânea Economic and Social Affairs. Population Division. World Urbanization Prospects: the MOLDAKOV, O. 2000. Os agricultores urbanos 2014 revision. New York. CD-ROM. de São Petersburgo. Revista de Agricultura Urbana 1:. 1-8. Available at http://www.ruaf. Hortic. bras., Brasília, v.37, n.3, July - September 2019 259

Research ZEIST, AR; RESENDE, JTV; POZZEBON, BC; GABRIEL, A; SILVA, AA; ZEIST, RA. 2019. Combination of solarization, biofumigation and grafting techniques for the management of bacterial wilt in tomato. Horticultura Brasileira 37: 260-265. DOI - http://dx.doi.org/10.1590/S0102-053620190302 Combination of solarization, biofumigation and grafting techniques for the management of bacterial wilt in tomato André R Zeist1,3 ID; Juliano TV de Resende2,4ID; Bruna C Pozzebon3ID; André Gabriel4ID; Alex Antônio da Silva4ID; Ricardo Antônio Zeist4ID 1Universidade do Oeste Paulista (UNOESTE), Presidente Prudente-SP, Brasil; [email protected]; 2Universidade Estadual de Londrina (UEL), Londrina-PR, Brasil; [email protected]; 3Universidade Federal de Lavras (UFLA), Lavras-MG, Brasil; bcpozzebon@gmail. com; 4Universidade Estadual do Centro-Oeste (UNICENTRO), Guarapuava-PR, Brasil; [email protected]; alex.antonio.silva27@ gmail.com; [email protected] ABSTRACT RESUMO Considering the aforementioned information, the objective was Combinação das técnicas de solarização, biofumigação e to evaluate the influence of combining techniques of solarization, enxertia para o manejo da murcha bacteriana no tomateiro biofumigation with chicken manure and grafting on the incidence of bacterial wilt and productivity of the hybrid tomato ‘Absoluto’. Objetivou-se avaliar o efeito da combinação das técnicas de sola- Two experiments were carried out in a chapel-type greenhouse rização, biofumigação com cama de frango e enxertia na incidência da and in field, in the agricultural year 2013/2014, in a commercial murcha bacteriana e na produtividade do tomateiro híbrido Absoluto. farm on the municipality of Barra do Rio Azul-RS. In the two Foram realizados dois experimentos, em casa de vegetação tipo capela cultivation environments, treatments were arranged in randomized e em campo, no ano agrícola 2013/2014, em propriedade agrícola no block experimental design, with the plots subdivided into space and município de Barra do Rio Azul-RS. Nos dois ambientes de cultivo, treatments randomly arranged, in an area naturally infested with race os tratamentos foram organizados em delineamento experimental 1, biovar 1, phylotype II of R. solanacearum. The treatments were soil de blocos casualizados, com as parcelas subdivididas no espaço e solarization, biofumigation, biofumigation + solarization and control, os tratamentos dispostos aleatoriamente, em área naturalmente in- and in the subplots, the commercial hybrid tomato Absoluto with festada com Ralstonia solanacearum raça 1, biovar 1, filotipo II. Os and without grafting on the hybrid rootstock Guardião. Based on the tratamentos nas parcelas foram solo com solarização, biofumigação, incidence of bacterial wilt, the plant health index and the area under solarização + biofumigação e testemunha; nas subparcelas, foi usado the disease progress curve were estimated. The number, production o tomateiro híbrido comercial Absoluto com e sem enxertia sobre o and average mass of commercial fruits were evaluated. A beneficial porta-enxerto híbrido comercial Guardião. Com base na incidência da effect was found of soil solarization associated with the addition murcha bacteriana, estimou-se o índice de sanidade e a área abaixo of chicken manure in the control of bacterial wilt and increase of da curva de progresso da doença. Avaliou-se também o número, productivity. Grafting was more efficient in increasing plant health a produção e a massa média de frutos comerciais. Foi constatado index and reducing the area under the disease progress curve than efeito benéfico da solarização do solo associada à biofumigação no solarization and biofumigation, thus indicating that the association of controle da murcha bacteriana e aumento da produtividade. A enxertia the three measures is beneficial to the integrated control of the disease. foi mais eficiente no aumento do índice de sanidade e redução da área abaixo da curva de progresso da doença que a solarização e biofumigação, indicando que a associação dos tratamentos é eficaz no controle da doença. Keywords: Solanum lycopersicum, Ralstonia solanacearum, soil Palavras-chave: Solanum lycopersicum, Ralstonia solanacearum, pathogens control, soil disinfestation, rootstock. controle de patógenos do solo, desinfestação do solo, porta-enxerto. Received on January 25, 2018; accepted on May 16, 2019 Among the main factors that affect pseudosolanacearum (Fegan & Prior, Bacterial wilt is a disease of difficult tomato productivity in Brazil, 2005; Lopes, 2015). Initial symptoms control, especially in climates subject diseases of bacterial etiology, which are wilt of the terminal leaves, darkening to high temperatures, due to its global are difficult to handle and control, stand of the vascular region, wilt leaflet and distribution, high genetic variability, out. Amidst them, bacterial wilt stands leaf epinasty. With the progression of long-term survival of the pathogen in out, caused by the complex of soil- the disease, wilt affects the whole plant soil and a wide range of hosts (Lebeau et dwelling species of the genus Ralstonia, irreversibly, and the plant dies (Inoue- al., 2011; Lopes, 2015). Although these formed by R. solanacearum and R. Nagata et al., 2016). characteristics indicate that individual 260 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Combination of solarization, biofumigation and grafting techniques for the management of bacterial wilt in tomato measures of control of bacterial wilt this combination in different growing had already a continuous cultivation are not effective, studies that propose to environments and in subtropical of tomato plants. In these areas, in the integrate different management methods climates, considering the pathogen five years prior to the implantation of in the control of the disease are scarce population in the soil, its specific the experiments, the presence of wilt (Baptista et al., 2007; Oz et al., 2017). virulence in the isolates in the region, symptoms caused by R. solanacearum Among these, we should appeal to those the local efficiency of solarization in was confirmed. In the greenhouse with a greater focus on environmental certain times of the year and chemical experiment, plots were 3.0 x 6.0 m and issues and that are not detrimental to and biological composition of the soil. subplots 3.0 x 3.0 m and the 18 central the health of farmers and consumers plants of each subplot were considered (Baptista et al., 2007). Considering the aforementioned as useful area. In the field environment, information, the objective was to plots were 4.0 x 12 m and the subplots Solarization is an efficient method evaluate the influence of combining 4.0 x 6.0 m and the 30 central plants of to control soil pathogens and reduce techniques of solarization, biofumigation each subplot were considered as useful the use of agrochemicals (Kanaan et with chicken manure and grafting for area. al., 2016; Oz et al., 2017). This method the bacterial wilt and productivity of is based on the use of solar energy to the hybrid tomato Absoluto in two Before the application of the raise soil temperature by 10 to 15°C commercial growing environments, in treatments in the plot, the soil of both and affect the survival of the pathogen at Barra do Rio Azul-RS. environments was revolved up to depths of approximately 20 cm (Kanaan 20 cm deep. The application of the et al., 2015). MATERIAL AND METHODS treatments was succeeded according to Baptista et al. (2007), in which, for four Alternatively, there could be the Two experiments were carried out months (from June to September) before addition of compounds that alter the in a chapel-type greenhouse (protected transplanting the seedlings, solarization microbial activity and affect survival environment) and in field (external), and biofumigation were carried out of pathogens (Kanaan et al., 2015, from June to February in the agricultural by means of transparent polyethylene 2016). Using organic biofumigants, year 2013/2014, at a property in the plastic covering, 75 μm thickness, besides increasing soil fertility, is municipality of Barra do Rio Azul-RS and incorporation of chicken manure effective in controlling soil diseases (27°24’S, 52°26’ W, altitude 438 m). to the soil in 5% (v/v) concentration, (Oz et al., 2017). The biofumigant effect The municipality belongs to the north- respectively. by the addition of chicken manure to west mesoregion of Rio Grande do Sul the soil has already been described and to the micro-region of Erechim-RS In a greenhouse, which had a 3.0 m in some works carried out in Brazil and, according to Köppen’s climatic ceiling height, during this period the side (Baptista et al., 2006, 2007; Coca et classification, it presents a subtropical curtains were kept closed and weekly al., 2012). Solarization for four months humid climate (Wrege et al., 2011). The irrigation was carried out by sprinkling or biofumigation at 5% with chicken site soil is classified as Red Latosol. to the field capacity. Treatments with manure in a tropical climate region, in solarization were irrigated only before Brasília-DF, reduced the incidence of R. In both cultivation environments, the the installation of the transparent solanacearum in potatoes and tomatoes treatments were arranged in randomized polyethylene plastic cover. During the (Baptista et al., 2006; Coca et al., 2012). block experimental design, with solarization and biofumigation period, the plots subdivided into space and the soil temperature data were collected Tomato grafting in resistant rootstock treatments randomly arranged, in an area at 10 cm depth every 15 days, at 12:30 is an alternative increasingly used for the naturally infested with race 1, biovar hs, by using a stick digital thermometer control of bacterial wilt (Lopes et al., 1, phylotype II of R. solanacearum. (TP3001, Digital Thermometer). 2015). This technique, even in Brazil, Treatments in the plots were soil with is more widespread than solarization solarization, biofumigation, solarization At the beginning October, the and biofumigation. Protection provided + biofumigation, and control (absence polyethylene was removed and, in all solely by grafting, however, should be of treatments) and, in the subplots, the plots, ungrafted and grafted seedlings considered with certain restrictions, hybrid commercial tomato Absoluto were transplanted, when they had since it may not work properly in (Feltrin) ungrafted (without rootstock) from 4-5 expanded defined leaves. The the presence of isolates that “break” and grafted on the commercial hybrid adopted spacings were 1.0 m between the resistance and in situations of rootstock Guardião (Takii). The hybrid rows and 0.45 between plants in the environments favorable to the disease, Absoluto has a habit of semi-determined greenhouse and 1.0 m between rows and such as in the Amazon region (Lopes, growth, produces salad type fruits and 0.6 m between plants in the field. Plants 2015; Lopes et al., 2015). is susceptible to bacterial wilt. The were conducted by maintaining a main rootstock ‘Guardião’ is resistant to stem and supported by vertical cutting. There are few studies on the efficacy bacterial wilt and is available in the of the combination of these techniques Brazilian market (Lopes et al., 2015). During the cycle, for irrigation, in the control of bacterial wilt and its in both experiments, micro drippers influence on productive output of the The experiments in greenhouse were used, with the application of tomato plant. In addition, there is a and in the fields were in areas that fertirrigation in the morning, following need to observe the effectiveness of recommendations adapted from Hortic. bras., Brasília, v.37, n.3, July - September 2019 261

AR Zeist et al. Trani et al. (2011), depending on maturation stage were collected during (2007) observed throughout the period the development stage of the crop. the cycle, which were then evaluated soil temperatures around 50°C and about Phosphorus(P) was supplied only in by: 1) the number of commercial 10°C above the non-solarized soil. In transplanting, at the dose of 70.0 g of fruits (NCF), determined by the sum contrast, in experiments conducted in single superphosphate (SSP) per m², of the number of harvested fruits, in Inparta, Turkey, where air temperature according to the previously performed order to establish the total number of conditions are similar to the region of soil analysis. fruits classified within the commercial this work, Oz et al. (2017) verified, standards per plant; 2) production of during the solarization period in the For the formulation of fertigation, commercial fruits (PCF, kg/plant), greenhouse, a soil temperature variation 0.015 g urea, 0.06 g potassium chloride, determined by weighing the cumulative similar to those described in Table 1. It is 0.012 g Nitrabor, 0.03 g Krista SOP and production of fruits in order to establish reported that heat treatment at 45°C for 0.1 Krista Mag per plant were used in the total production of fruits classified two days, under controlled conditions, the first phase. In the second phase, 0.11 within the commercial standards per is enough to reduce the total bacterial g potassium chloride, 0.05 g Nitrabor, plant; and 3) average mass of commercial population by 60-97% and the incidence 0.1 g Krista SOP and 0.4 Krista Mag per fruits (AMCF, g/fruit), determined based of bacterial wilt by 50-75% (Yuliar & plant were used. In the third phase, 0.17 on the relationship between PCF and Toyota, 2015). g potassium chloride, 0.24 g Nitrabor, NCF (AMCF=PCF/NCF). 0.4 g Krista SOP and 0.87 g Krista As in this work, Kanaan et al. (2016) Mag were used per plant. In the fourth Data of the evaluated characteristics observed a rise in soil temperature phase, 0.17 g potassium chloride, 0.48 were tested for normality and by about 12ºC when solarized and no g Nitrabor, 0.4 g Krista SOP and 1.1 homogeneity of the residual variances by significant increase in temperature with Krista Mag per plant were used, and in Lilliefors & Bartlett tests, respectively, the application of organic additives. the fifth phase, 0.2 g potassium chloride, and later submitted to analysis of Similar results were also observed 0.48 g Nitrabor, 0.4 g Krista SOP and variance. When F test was significant, by Kanaan et al. (2015) by studying 1.1 g Krista Mag were used per plant. averages were compared by Tukey test the effects of solarization and the (p≤0.05), and analyzed in the statistical application of organic compounds in The incidence of bacterial wilt program ASSISTAT, version 7.7 (Silva soils infested with Macrophomina was evaluated from 14 days after & Azevedo, 2016). phaseolina and Verticillium dahliae. transplanting, and performed every 15 days, until 84 days after transplanting, RESULTS AND DISCUSSION For the characteristics related to totalizing six evaluations. Plants the control of bacterial wilt, there was showing symptoms of wilt were In both cultivation environments, at interaction between treatments of plots recorded, in which those with partial 10 cm depth, in the soil that was solarized, and subplots in the greenhouse and wilt (>50% wilted leaves) or total higher temperatures were observed than field crops. When grafting, there was wilt were considered for evaluation. those of the other treatments (Table no effect of the treatments applied to the According to Lopes & Rossato (2013), 1). The soil of the greenhouse, during soil. In contrast, when hybrid Absoluto in order to confirm the infection of the months August and September, plant was cultivated on an ungrafted plants by R. solanacearum, the lower presented temperatures above 50ºC and basis in both growing environments, part of the stem was submerged in a with averages approximately 10ºC above the treatments compared to the control clear vial containing water and the the treatments without solarization. In resulted in increased plant health presence of a milky fillet was identified the field environment, although average index and reduced AUDPC (Table outlying the tissue of the wilting plants. soil temperatures were lower than those 2). Baptista et al. (2007), with same The resistance characteristics of the in the greenhouse, solarization also solarization period and same chicken plant to the pathogen were estimated provided an increase in temperature. We manure concentration of this study, by calculating the plant health index observed in the soil of this environment, also observed reduction in the number (PHI) and the area under the disease in September, temperatures near 49ºC of plants affected by bacterial wilt. progress curve (AUDPC). PHI values and with average approximately However, these authors did not observe were estimated using the formula: PHI 12ºC above the treatments without interaction between solarization and = NP/TNT, where NP is the number of solarization (Table 1). biofumigation. plants in the plot with no symptoms of wilt in the last evaluation and TNT Higher soil temperatures in In both growing environments, is the total number of plants in the September, when compared to the grafting of the hybrid Absoluto on the plot (Plank, 1963). The area under the months June to September, happened rootstock ‘Guardião’, compared to the disease progress curve (AUDPC) was due to air temperature in the region same ungrafted plants, increased health calculated according to Campbell & of the experiment be lower in the and reduced disease progression, except Madden (1990). first three months of follow-up. In the when grafted plants were cultivated in solarization carried out in the field, the greenhouse and the soil received Fruits were harvested according in Brasília-DF, where the climate is solarization + biofumigation (Table to Zeist et al. (2017b), during which characterized as tropical, Baptista et al. 2). Lopes et al. (2015) observed that the fruits that comprised the light-red ‘Guardião’ offers good protection to 262 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Combination of solarization, biofumigation and grafting techniques for the management of bacterial wilt in tomato Table 1. Effects of solarization and biofumigation with chicken manure in soil naturally infested with Ralstonia solanacearum on soil temperature (ºC), 10 cm depth, during the observation period in two growing environments. Barra do Rio Azul, UNICENTRO, 2013/2014. Greenhouse Treatments Biofumigation Solarization B+S¹ Control Max Min Avg Max Min Avg Max Min Avg Max Min Avg June 35.5 15.3 24.8 41.5 17.2 34.5 41.4 17.7 34.4 35.5 13.2 24.1 July 35.5 13.7 25.5 44.4 16.9 34.6 44.4 17.0 34.5 35.0 11.6 25.4 August 37.1 15.9 27.8 51.2 21.2 37.4 52.0 25.0 37.3 37.0 13.6 28.1 September 37.9 23.9 28.5 38.1 22.1 28.9 52.0 28.5 39.3 53.0 29.1 39.8 June 29.6 10.3 18.9 29.6 10.3 18.9 Field 38.1 11.7 26.2 38.1 12.0 26.3 July 30.3 9.9 19.1 38.6 10.4 26.3 38.4 10.5 26.4 29.9 9.6 19.1 August 30.6 10.8 22.1 42.0 20.8 33.7 41.9 23.3 33.4 30.5 10.8 22.0 September 33.5 18.2 26.4 48.7 22.8 38.5 48.9 24.2 39.2 33.9 17.9 25.1 ¹B+S= biofumigation + solarization; Max= maximum temperature; Min= minimum temperature; Avg= average temperature. Table 2. Effects of solarization and biofumigation with chicken manure in soil naturally infested with Ralstonia solanacearum on plant health index (PHI) and area under the disease progress curve (AUDPC) of hybrid tomato Absoluto, grafted and ungrafted on the commercial hybrid rootstock Guardião in two growing environments. Barra do Rio Azul, UNICENTRO, 2013/2014. Greenhouse Treatments 1PHI Ungrafted Grafted AUDPC Grafted 0.77Bb 8.75 Ba Ungrafted Solarization 0.97 Aa* 0.82 Ba 8.75 Ba 77.00 Ab Biofumigation 0.97 Aa 0.92 Aa 10.50 Aa 70.00 Ab Solarization + biofumigation 0.95 Aa 0.45 Bb 8.75 Ba 26.25 Ac Control 0.97 Aa 224.00 Aa CV (%) 21.00 Ba 10.15 29.75 Ba 42.03 Solarization 38.50 Ba Biofumigation Field 21.00 Ba 154.00 Ab Solarization + biofumigation 248.50 Aab Control 0.95 Aa 0.67 Ba 148.75 Ab CV (%) 0.92 Aa 0.45 Bab 355.25 Aa 0.92 Aa 0.67 Ba 49.95 0.95 Aa 0.22 Bb 17.92 *Means followed by same lowercase letters in the column and same uppercase letters in the line, do not differ significantly from each other by Tukey test, p≤0.05; 1PHI= NP/TNT; NP= number of plants without wilt symptoms in the last evaluation; TNT= total number of plants (Plank, 1963). the tomato against bacterial wilt under The effect of adding poultry litter Mehta et al., 2014). The decomposition normal growing conditions. According for disease reduction is possibly related of chicken manure releases volatile to these authors, this rootstock also to the effects of decomposition of the nitrogen compounds (Silva et al., 2014), shows resistance to fusarium wilt material on soil microbial activity. The which leads to possible toxic effects on (some races), verticillium wilt and organic changes in the soil increase R. solanacearum (Baptista et al., 2006; some species of nematodes of the genus the probability of competition effects Coca et al., 2012). Meloidogyne. caused by the increase of the activities of microorganisms that are antagonistic to About solarization, despite reducing In the greenhouse environment the pathogen (Yuliar & Toyota, 2015). In soil pH and the concentration of for ungrafted plants, treatments with addition, degradation of organic matter potassium, sodium, boron and zinc biofumigation were the most efficient may restrict the available nutrients nutrients, it decreased biomass and in increasing plant health index and to the pathogen and release natural microbial respiration, with subsequent the combination of solarization + substances with variable inhibitory increase in respiration, 60 days after biofumigation was the one that reduced properties (Bailey & Lazarovitz, 2003; solarization (Baptista et al., 2007). The AUDPC values the most (Table 3). combination of this technique with Hortic. bras., Brasília, v.37, n.3, July - September 2019 263

AR Zeist et al. biofumigation was more efficient than Regarding the productive (Zárate et al., 2007), Allium fistulosum, isolated solarization or biofumigation, characteristics per plant, there was no Eruca sativa (Zárate et al., 2006) and negatively affecting bacterial wilt. In interaction between plots and subplots. carrot (Araujo et al., 2004). addition, in the greenhouse cultivation, We also observed that there was no solarization + biofumigation proved influence of treatments on the number The results of the control to be as efficient as the use of grafting of commercial fruits. However, the characteristics of bacterial wilt and using the ‘Guardião’ rootstock. In treatments applied to the soil provided fruit production in this work highlight this environment, with solarization + a difference for the production and the possibility of using solarization and biofumigation, there was no difference average mass of commercial fruits. biofumigation together. Baptista et al. between grafted and ungrafted plants for When biofumigation was applied with (2006), when growing potato in an area the characteristics related to controlling poultry litter, there was an increase in infested with R. salanacearum, also bacterial wilt (Table 2). Solarization these commercial characteristics both in emphasized the association between in the presence of organic additives the greenhouse and in the field (Table 3). solarization and biofumigation with may accelerate the emission of toxic chicken manure as an alternative for the volatiles that stimulate the predation or It can be considered that increment of the productive components. suppression of reproductive organs of biofumigation through the application soil pathogens (Kanaan et al., 2015). of poultry litter allowed an increase Grafting, although it did not of the productive components once, in provide an increment of the productive It is important to emphasize that association with the fertirrigation, the characteristics per plant, was efficient soil temperature elevations promoted availability of nutrients to the plants in controlling bacterial wilt. In the field by solarization technique may have a has increased. The use of poultry environment, grafting was more efficient limited effect on controlling bacterial litter as organic fertilizer for tomato than solarization and biofumigation, wilt (Baptista et al., 2006). According to plants, when associated with mineral promoting increased sanity and reducing these same authors, during solarization, nutrition, supplies the demand for infection of tomato plants. in the deeper layers of soil, temperature primary macronutrients (Mueller et is only sublethal to the inoculum. al., 2013). It is commonly reported Grafting is a well-established and Thus, microbial processes are likely that poultry litter, when decomposed, efficient technique in regions where to be favored by the association improves the physical, chemical and there is incidence of bacterial wilt in the between temperature increase and biological characteristics of the soil, tomato crop (Lopes et al., 2015). The organic matter decomposition, with that is, increases fertility, water retention main obstacles in using this technique greater contribution of this aspect to capacity, aggregation and soil porosity. in Brazil relates to the need for skilled the control of pathogens, than only workforce and the increase in the cost changing soil temperature (Kanaan et A relevant aspect is that to obtain the seedling (Zeist et al., al., 2016). In addition, increasing soil biofumigation with chicken manure 2017a). In addition, there is a shortage temperature may also affect the survival was performed four months before of rootstocks, which, together with the of beneficial microorganisms.Therefore, transplanting the seedlings. For organic control of soil pathogens, provide an under natural growing conditions, fertilization to increase production, it increase in fruit production and thus solarization should not be considered must be applied in advance to the soil better justify its use (Zeist et al., 2017b). as the sole form of controlling bacterial (Sediyama et al., 2014), as in this study, wilt, but rather a measure capable of four months before transplanting. In Although grafting hybrid Absoluto reducing the population of pathogens in other horticultural species, an increase on the ‘Guardião’ rootstock in field the most superficial layers of the soil, so of productivity was also observed, with cultivation has been more efficient that the association with other measures the application of poultry litter, as in in controlling bacterial wilt than the is more effective. Arracacia xanthorrhiza (Graciano et solarization and biofumigation with al., 2006), Colocasia esculenta, lettuce chicken manure, it is advisable to adopt more than one control measure. Its efficacy, like that of other commercial Table 3. Effects of solarization and biofumigation with chicken manure in soil naturally infested with Ralstonia solanacearum on production of commercial fruits (CF) and average mass of commercial fruits (AMCF) of tomato hybrid Absoluto in two commercial growing environments. Barra do Rio Azul, UNICENTRO, 2013/2014. Treatments Greenhouse Field CF (kg/plant) AMCF (g/fruit) PCF (kg/plant) AMCF (g/fruit) Solarization 6.91 b 213.14 c 6.30 b 200.13 ab Biofumigation 8.12 a 241.48 ab 7.13 a 215.21 ab Solarization + biofumigation 8.57 a 254.33 a 7.28 a 219.78 a Control 7.04 b 219.72 bc 6.04 b 191.27 b CV (%) 4.57 7.99 6.27 9.61 Means followed by same letters in the column do not differ significantly from each other by Tukey test, p≤0.05. 264 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Combination of solarization, biofumigation and grafting techniques for the management of bacterial wilt in tomato rootstocks, is isolated, dependent and sobre dois clones de mandioquinha-salsa. Acta ROSSATO, M; LOPES, CA; BOITEUX, LS. unstable under conditions of high Scientiarum. Agronomy 28: 365-371. 2018. Evaluation of Solanum peruvianum temperature and high humidity (Lopes (sensu lato) germplasm to a standard Ralstonia et al., 2015; Rossato et al., 2018). Thus, INOUE-NAGATA, AK; LOPES, CA; REIS, A; solanacearum race 1/biovar 1 isolate and to a the benefit of solarization associated PEREIRA, RB; QUEZADO-DUVAL, AM; novel ‘Hawaii 7996’ resistance-overcoming to the addition of chicken manure is PINHEIRO, JB; LIMA, MF. 2016.Doenças race 3/biovar 2A isolate from Brazil. Tropical evident in controlling bacterial wilt, do tomateiro. In: AMORIM, L; REZENDE, Plant Pathology 43: 477-483. and the increase of the productive JAM; BERGAMIM FILHO, A; CAMARGO, characteristics of hybrid Absoluto in LEA (eds). Manual de Fitopatologia. v.2. 5. SEDIYAMA, MAN; SANTOS, IC; LIMA, areas infested with R. solanacearum in ed.Ouro Fino: Agronômica Ceres. p.697-732. PC. 2014. Cultivo de hortaliças no sistema subtropical region. orgânico. Revista Ceres 61: 829-837. KANAAN, H; MEDINA, S; KRASSNOVSKY,A; REFERENCES RAVIV, M. 2015. Survival of Macrophomina SILVA, VB; SILVA, AP; DIAS, BO; ARAUJO, phaseolina. l. and Verticillium dahliae during JL; SANTOS, D; FRANCO, RP. 2014. ARAUJO, C; ZÁRATE, NAH; CARMO VIEIRA, solarization as affected by composts of various Decomposition and mineralization of N, P and M. 2004. Produção e perda de massa pós- maturities.Crop Protection 76: 108-113. K of cattle manure and poultry litter isolated or colheita de cenoura ‘Brasília’, considerando mixed. Revista Brasileira de Ciência do Solo doses de fósforo e de cama de frango semi KANAAN, H; MINZ, D; MEDINA, S; 38: 1537-1546. decomposta. Acta Scientiarum. Agronomy KRASNOVSKY, A; RAVIV, M. 2016. The 26: 131-138. interdependent effects of solar disinfestation SILVA, FAS; AZEVEDO, CAV. 2016.The assistat and compost maturity level on soil microbial software version 7.7 and its use in the analysis BAILEY, K.; LAZAROVITS, G. 2003. activity. Phytoparasitica 44: 55-64. of experimental data.African Journal of Suppressing soil-borne diseases with residue Agricultural Research 11: 3733-3740. management and organic amendments.Soil LEBEAU, A; DAUNAY, MC; FRARY, A; and Tillage Research 72: 169-180. PALLOIX, A; WANG, JF; DINTINGER, J; TRANI, PE; TIVELLI, SW; CARRIJO, OA. 2011. CHIROLEU, F; WICKER, E; PRIOR, P. 2011. Fertirrigação em hortaliças. 2.ª ed. Campinas: BAPTISTA, MJ; LOPES, CA; SOUZA, RB; Bacterial wilt resistance in tomato, pepper, and Instituto Agronômico, Série Tecnologia FURUMOTO, O. 2006. Efeito da solarização e eggplant: Genetic resources respond to diverse APTA(Boletim Técnico IAC, 196). 53p. biofumigação, durante o outono, na incidência strains in the Ralstonia solanacearum species de murcha bacteriana e produtividade da complex. Phytopathology 101: 155-165. WREGE, MS; STEINMETZ, S; REISSER batata. Horticultura Brasileira 24: 99-102. JUNIOR, C; ALMEIDA, IR. 2011. Atlas LOPES, CA; ROSSATO, M. 2013. Diagnóstico climático da região sul do Brasil: estados BAPTISTA, MJ; REIS JUNIOR, FB; XAVIER, de Ralstonia solanacearum em tomateiro. do Paraná, Santa Catarina e Rio Grande do GR; ALCÂNTARA, C; OLIVEIRA, AR; Brasília: Embrapa Hortaliças. 10p. Sul. 1. Pelotas: Embrapa Clima Temperado; SOUZA, RB; LOPES, CA. 2007. Eficiência (Comunicado Técnico 92). Embrapa Florestas, 336p. da solarização e biofumigação do solo no controle da murcha bacteriana do tomateiro LOPES, CA. 2015. Bacterialwilt – a threatening YULIAR, YAN; TOYOTA, K. 2015. Recent no campo. Pesquisa Agropecuária Brasileira disease of tomato cultivated under warm trends in control methods for bacterial wilt 42: 933-938. temperatures. Brasília: Embrapa Hortaliças. diseases caused by Ralstonia solanacearum. 4p. (Comunicado Técnico 109). Microbes and environments 30: 1-11. CAMPBELL, CL; MADDEN, LV. 1990. Introduction to plant disease epidemiology. LOPES, CA; BOITEUX, LS; ESCHEMBACK, ZÁRATE, NAH; VIEIRA, MC; GRACIANO, JD; New York: John Wiley & Sons, 560p. V. 2015. Eficácia relativa de porta-enxertos GASSI, RP; ONO, FB; AMADORI, AH. 2006. comerciais de tomateiro no controle da Produção de cebolinha, solteira e consorciada COCA, DM; RAGASSI, CF; LOPES, CA. 2012. murcha bacteriana. Horticultura Brasileira com rúcula, com e sem cobertura do solo com Utilização de esterco como medida auxiliar no 33: 125-130. cama-de-frango. Semina: Ciências Agrárias controle da murcha bacteriana em genótipos 27: 505-514. de batata. Revista Latinoamericana de la Papa MEHTA, CM; PALNI, U; FRANKE-WHITTLE, 17: 152-169. IH; SHARMA, AK. 2014. Compost: Its role, ZÁRATE, NAH; VIEIRA, MC; GIULIANI, AR; mechanism and impact on reducing soil- HELMICH, M; PONTIM, BCÁ; PEZZONI FEGAN, M; PRIOR, P. 2005. How complex is the borne plant diseases. Waste Management 34: FILHO, JC. 2007. Produção e renda de taro “Ralstonia solanacearum species complex”? 607-622. Macaquinho, solteiro e consorciado com alface In: ALLEN, C; PRIOR, P; HAYWARD, AC ‘Salad Bowl’, em solo com cobertura de cama- (eds). Bacterial wilt disease and the Ralstonia MUELLER, S; WAMSER, AF; SUZUKI, A; de-frango semidecomposta. Semina: Ciências solanacearum species complex. St. Paul: APS BECKER, WF. 2013. Produtividade de tomate Agrárias 28: 563-570. Press.p.449-461. sob adubação orgânica e complementação com adubos minerais. Horticultura Brasileira ZEIST, AR; RESENDE, JTV; GIACOBBO, CL; GRACIANO, JD; ZÁRATE, NAH; VIEIRA, 31: 86-92. FARIA, CMDR; DIAS, DM. 2017a.Graft MC; ROSA, YBCJ; SEDIYAMA, MAN; takes of tomato on other solanaceous plants. RODRIGUES, ET. 2006. Efeito da cobertura OZ, H; COSKAN, A; ATILGAN, AJ. 2017. Revista Caatinga 30: 513-520. do solo com cama-de-frango semidecomposta Determination of effects of various plastic covers and biofumigation on soil temperature ZEIST, AR; RESENDE, JTV; SILVA, IFL; and soil nitrogen form in greenhouse OLIVEIRA, JRF; FARIA, CMDR; solarization: new solarization cover material. GIACOBBO, CL. 2017b. Characteristics of Journal of Polymers and the Environment tomato plant cultivar Santa Cruz Kada grafted 25: 370-377. on species of the genus Solanum. Horticultura Brasileira 35: 419-424. PLANK, JE.1963. Plant disease: epidemic and control. New York: Academic Press, 349p. Hortic. bras., Brasília, v.37, n.3, July - September 2019 265

Research CABRINI, PG; SALA, FC; MAGRI, MMR. 2019. Torulaspora globosa: rhizosphere yeast promoting lettuce growth on seedlings and under field conditions. Horticultura Brasileira 37: 266-271. DOI - http://dx.doi.org/10.1590/S0102-053620190303 Torulaspora globosa: rhizosphere yeast promoting lettuce growth on seedlings and under field conditions Paloma G Cabrini1ID; Fernando C Sala1ID; Márcia M Rosa Magri1ID 1Universidade Federal de São Carlos (UFSCar), Araras-SP, Brasil; [email protected]; [email protected]; [email protected] ABSTRACT RESUMO Among soil microorganisms, one group stands out as beneficial Torulaspora globosa: levedura rizosférica promotora de to agricultural activities: a plant growth-promoting rhizobacteria crescimento de alface para produção de mudas e em campo (PGPM). These microorganisms support plants through phytohormone production, nutrient provision and plant health maintenance. Among Micro-organismos promotores de crescimento vegetal (MPCV) these PGPM, yeasts have a high potential, which is still not very well auxiliam as plantas pela produção de fitormônios, disponibilização known.This study aimed to evaluate the effect of inoculation with the de nutrientes e manutenção da sanidade vegetal. Dentre os MPCV, rhizosphere yeast Torulaspora globosa (strain 5S55) on development as leveduras apresentam grande potencial ainda inexplorado. O ob- of lettuce (cv. Crocantela). The first research consisted of inoculating jetivo deste trabalho foi avaliar a inoculação da levedura rizosférica seeds with yeast (100 cells/seed), and inoculating seeds, 7 and/or Torulaspora globosa (linhagem 5S55) no desenvolvimento de alface 15 days after emergence (DAE) (1x106 cells/plant). The second one (cv. Crocantela). O primeiro experimento consistiu na inoculação de consisted of transplanting seedlings from the first experiment to field. sementes nuas com a levedura (100 células/semente), e na inoculação Inoculation of seeds and seedlings provided a significant increase of das mudas, 7 e/ou 15 dias após a emergência (DAE) (1x106 células/ seedling root dry mass; we observed the significant increase of 27% in planta). O segundo experimento consistiu no transplante das mudas productivity of lettuce under field conditions, of shoot fresh mass and do primeiro experimento para o campo. A inoculação das sementes a raise of number of leaves per plant. However, studies on inoculation e mudas proporcionou aumento significativo de massa seca de raízes methods, inoculum formulation, cell concentration are essential to das mudas; foi observado incremento significativo de produtividade optimize the results in growth promotion and to establish technology. na produção de alface em campo, com incremento de 27% da massa fresca da parte aérea, com aumento no número médio de folhas por planta. Estudos relacionados a métodos de inoculação, formulações do inóculo, concentração de células, porém, são imperativos para otimizar os resultados de promoção de crescimento e para o estabelecimento da tecnologia. Keywords: Lactuca sativa, plant growth promotion, biostimulant, Palavras-chave: Lactuca sativa, promoção de crescimento vegetal, cv. Crocantela. bioestimulante, cv. Crocantela. Received on December 6, 2018; accepted on May 31, 2019 Amore sustainable approach, technological options using PGPM in plants against diseases and pests, considering techniques used in agronomical management of crops in increasing nutrient uptake, producing agriculture, would be the use of plant field can be found (Clemente et al., phytonutrients, and even inducing growth-promoting microorganisms 2016). Among established technologies, plant resistance against biotic and (PGPM), and the benefits for plants with currently used by producers, biological abiotic stresses (Odoh, 2017). Among the use of these promoters (Lugtenberg nitrogen fixation using rhizobium plant growth promotion mechanisms, et al., 2002). Several positive results species stands out (Hungria et al., 2006), phytonutrient production, especially were observed using PGPM species for and in grass, the bacterium Azospirillum indoleacetic acid (IAA), belonging to cultivation in a controlled environment; brasilense (Zeffa et al., 2019). We auxin group, is known for providing In field, however, several factors may could also cite the use of some bacterial a direct effect on plant growth, mainly influence the results, such as abiotic species of the genus Bacillus in order to through stimulating hairy roots stresses, competition with native control phytopathogens and pests (Fira development and increasing root dry microbiota, the specificity between et al., 2018). mass (Ludwig-Müller, 2015). Bacteria, microorganisms and plant species or yeast and filamentous fungi are able to varieties, among other aspects (Tabassum PGPM naturally inhabit soil and produce significant amounts of IAA, et al., 2017). Thus, few well established plants, show mechanisms to promote being described as microbial groups plant growth ranging from defending 266 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Torulaspora globosa: rhizosphere yeast promoting lettuce growth on seedlings and under field conditions belonging to PGPM (Shao et al., 2015; São Carlos (22º21’25’’S, 47º23’03”W, The mixture was done in a small plastic Sarabia et al., 2018). altitude 629 m) and stood out due bag, with sterile interior, to facilitate to its high production of IAA (over homogeneous distribution of the cell Yeasts are naturally present in soil, 800 µg mL-1 in 24 hours incubation) suspension in the seeds. Non-inoculated rhizosphere and plant tissues. However, and its ability to solubilize calcium seeds (control treatment) were treated few studies on this group (such as phosphate in vitro (Oliveira et al., using only sterile saline solution, in the PGPM), comparing to reported studies 2019). The strain was identified through same conditions described above. on bacteria and filamentous fungi, can molecular biological techniques, be found (Nassar et al., 2005). The yeast sequencing of the D1/D2 region of Sowing was performed in coconut Torulaspora globosa was isolated from the 28S rDNA, using primers NL1(5’- fiber substrate, Amafibra®, distributed in sugarcane rhizosphere, and is able to TATCAATAAGCGGAGGAAAAG-3’) plastic trays with 200 cells, considering produce plant growth promoters, like and NL4 (5’-GGTCCGTGTTT one seed per cell, 1-cm depth. After IAA, phosphate-solubilizing organic CAAGACGG-3’) (Kurtzman & sowing, the trays were kept in a acids (Rosa, 2009; Rosa-Magri et al., Robnett, 1998). greenhouse. Substrate moisture was 2012; Oliveira et al., 2019), and control kept at field capacity, water was replaced phytopathogens (Rosa et al., 2010). The strain 5S55 is part of according to the crop needs using Few studies on isolation, selection and microorganism bank in Laboratório de intermittent micro-sprinkler irrigation. use of plant growth-promoting yeasts Microbiologia Agrícola e Molecular Fertigation was done three times a week, can be found in Brazil, and no study (LAMAM), at Universidade Federal with 1 L hydroponic lettuce/nutrient on inoculation effect of this species on de São Carlos, Centro de Ciências tray, 0.5 g L-1 calcium nitrate, 0.5 g L-1 plants was published. Agrárias, campus Araras-SP; the yeast potassium nitrate, 0.35 g L-1 magnesium was multiplied in potato broth medium sulfate, 0.1 g MAP L-1 and 0.03 g L- 1 Lettuce is the most commercialized (BD), Difco, during 48 hours, 150 rpm, of micronutrients (ConMicros®). After leaf vegetable in Brazil. This crop is 25ºC. The yeast was centrifuged (3000 plant emergence, the authors performed more adapted to mild climate (Fernandes rpm during 5 minutes). Supernatant was new inoculations of yeast cells at seven et al., 2002). Thus, several breeding removed and the cells were resuspended and/or fifteen days after emergence of programs have been carried out aiming in saline solution (0.85% NaCl) and lettuce seedlings. Seedling inoculation to develop cultivars adapted to Brazilian used as inoculum in the experiments. was performed individually, being weather. Cv “Crocantela” was developed applied 1 mL yeast suspension per plant, at Universidade Federal de São Carlos Lettuce (Lactuca sativa), cultivar with 1x106 cells/mL. In non-inoculation (UFSCar), in Centro de Ciências Crocantela, was used in the experiments. treatments, the same quantity of sterile Agrárias, This cultivar is adapted to Naked seeds were provided by Fercam® saline solution (0.85% NaCl) was warm weather, shows intermediate company and used in tests without applied. characteristics between crispy head pesticide in order to avoid any influence and head lettuce, is resistant to several on viability of inoculated yeast cells. A total of eight treatments were diseases and has short cultivation cycle considered: T1= non-inoculated (Sala & Costa, 2012; UFSCar, 2013). Evaluation of lettuce seedling treatment (control); T2= non-inoculated Taking into consideration these crop development using seeds inoculated seeds; inoculated plants seven DAE characteristics, importance of lettuce with T. globosa (5S55) (days after emergence); T3= non- to Brazilian horticulture, and PGPM inoculated seeds; inoculated plants potential for plant health maintenance The experiment was carried out in fifteen DAE; T4= non-inoculated seeds; and resistance to stress. The aim of this April and May 2017, in a greenhouse inoculated plants seven and fifteen study was to evaluate the inoculation at Centro de Ciências Agrárias, DAE; T5= only inoculated seeds; T6= effect of seeds and seedlings of lettuce, Universidade Federal de São Carlos, inoculated seeds; inoculated plants cv Crocantela, with rhizosphere yeast campus Araras-SP. Average annual seven DAE; T7= inoculated seeds; Torulaspora globosa (strain 5S55) rainfall in this area during April and inoculated plants fifteen DAE; T8= on seedling development, grown in a May was 77 and 69 mm, respectively. inoculated seeds; inoculated plants greenhouse, and development of plants Minimum and maximum air temperature seven and fifteen DAE. Four replicates transplanted to field. was 14 and 26ºC. of 100 plants per treatment were used. MATERIAL AND METHODS Before inoculation, seeds were After seedling development, 30 days disinfected with sodium hypochlorite after emergence, ten plants per plot (40 Biological material (0.6% active chlorine), followed by plants per treatment) were randomly several washes with sterile distilled sampled. The authors evaluated shoot The evaluated yeast belongs to the water to remove excess chlorine. height, root length, width and length of species Torulaspora globosa (strain We used 3200 seeds throughout the leaves, with the aid of a ruler. Besides, 5S55); the strain was isolated in the experiment, considering that half of number of leaves, fresh mass of root campus, in Araras, of Centro de Ciências this amount was inoculated with yeast and shoot, dry mass of root and shoot Agrárias, at Universidade Federal de cells. Inoculation consisted of a mixture were determined; in order to obtain plant of 2 mL of a suspension of cells, mass, we use an analytical scale, and to concentration 1x106 cells/mL in 20 g of seeds, approximately 100 cells per seed. 267 Hortic. bras., Brasília, v.37, n.3, July - September 2019

PG Cabrini et al. determine dry mass, plants were dried in RESULTS AND DISCUSSION IAA, which promoted corn growth an oven, at 60ºC, until constant weight. (shoot and root) in greenhouse trials The results found in this experiment (Nassar et al., 2005). Amprayn et al. Evaluation of lettuce development showed that root length presented lower (2012) evaluated the effect of yeast in field using seedlings inoculated with values for treatment 8 (inoculation of species Candida tropicalis (CtHY), also T. globosa (5S55) seeds and seedlings seven and fifteen an IAA producer, on rice development, DAE). The same plants, however, and observed 35% increase in root dry Seedlings were transplanted into presented values of root dry mass mass. field, in an area of Centro de Ciências superior to non-inoculated plants (Table Agrárias, Universidade Federal de São 1). This result indicates that despite Among growth promotion Carlos, campus Araras-SP, in the same being shorter, roots presented greater mechanisms reported associated with rainfall and temperature conditions branching. The inoculation with yeast in yeast, IAA production and phosphate described in the previous item. Soil the plant several times probably provided solubilization are the most directly was classified as Typic Paleudult, high concentration of microorganism active. For the strain evaluated in this clayey texture (Yoshida & Stolf, 2016), cells in the rhizosphere, which study, high production of IAA and and prepared through subsoiling, then stimulated root branching. Changing significant phosphate solubilization harrowed and seedbeds prepared with root architecture brings benefits as it were observed, both in vitro (Oliveira et a plow. Fertilization was done with provides greater surface area for nutrient al., 2019). However, other mechanisms 150 g 04-14-08 NPK per square meter uptake. This phenomenon is reported have not been evaluated yet (production seedbed, applied and incorporated to soil in literature as an expected effect of the of other plant hormone and other seven days before transplanting; after inoculation with plant growth promoter compounds of secondary metabolism) twelve days, top dressing fertilization microorganisms (Idris et al., 2007; Taiz may be acting to stimulate plant (10 g/plant of 20-00-20 NPK) was & Zeiger, 2009). development. Thus, it is not possible to applied. say which mechanism is responsible for Considering shoot growth of lettuce the observed results. Seedlings used in this experiment seedlings, the results showed that were obtained from the experiment treatment 8 provided significant increase No study on yeast inoculation described in the previous item. The of dry mass, and also wider and longer in lettuce can be found in literature. experimental design was randomized leaves. Significant reduction in the In this study, the results for lettuce blocks, with four blocks per treatment average number of leaves per seedling seedlings, both for shoot and root, (eight treatments belonged to the was noticed, though. We observed that showed that plants needed to be yeast- previous experiment), with 20 plants/ inoculation with yeast provided less inoculated, at least, at three different block. Transplanted seedlings were voluminous plants, longer and bigger moments (in the seeds, and in the sampled from trays randomly obtained plants, though. This fact reflected in seedlings seven and fifteen DAE) for and planted using spacing 25 cm the results of shoot dry mass (Table 1). obtaining an effect superior to the between lines, and 30 cm between control treatment (without inoculation) plants. Inoculation of plants with in plant development. Due to the fact AIA producing microorganisms that studies on inoculation with yeasts Plants were kept in field during 63 is described as an efficient growth in plants are scarce, no information days under sprinkler irrigation with 200 promotion of several crops. Corn on the competence of this group to L h-1 flow, until horticultural point. At plants inoculated with AIA producing establish itself in the rhizosphere is the end of the experiment, five plants bacteria (Chryseobacterium sp. and available; therefore, more in-depth per block were evaluated (20 plants per Flavobacterium sp. and Burkholderia studies are needed to evaluate the ability treatment). We evaluated shoot height contaminans) promoted significant of a microorganism to resist edaphic of the harvested plants (measuring the increase of shoot and root dry mass conditions (low nutrient concentration, stem base up to the greater measurement (Tagele et al., 2018; Youseif, 2018). abrupt changes in soil physical and of the plant) size and width of leaves, Radhakrishnan & Lee (2016) inoculated chemical characteristics), to compete stem size, using a ruler. Number of lettuce plants with the bacterium Bacillus with other rhizosphere microorganisms, leaves, fresh and dry mass of shoot methylotrophicus, which produces IAA, as well as the ability to stimulate the were also evaluated; in order to obtain and observed plant growth promotion, production of root exudates by the plant. plant mass. The authors used a semi- highlighted, mainly, by fresh mass gain. analytical scale and plants were dried in The results obtained from field- an oven, at 60ºC, until constant weight, Despite the prominence of harvested plants, since seeds and for determining dry mass. rhizobacteria as plant growth promoters, inoculated seedlings showed that some species of rhizosphere yeasts treatments with only one inoculation Statistical analysis are able to produce IAA, and present (in the seed, in seven or fifteen- Obtained data were submitted satisfactory results in growth promotion DAE seedlings) were the ones which to variance analysis (ANOVA) and of several crops: we can mention the presented the best results in the averages compared using LSD test species Williopsis saturnus (yeast 4), evaluated parameters (treatments 2, 3 (Fisher) at 5% significance. Analyses endophytic of maize and producer of and 5). For shoot length, plants which were performed using statistical software Statistica V.7. Hortic. bras., Brasília, v.37, n.3, July - September 2019 268

Torulaspora globosa: rhizosphere yeast promoting lettuce growth on seedlings and under field conditions were inoculated only seven DAE It is important to highlight that lettuce development. However, the (treatment 2) presented higher values; results obtained for lettuce seedlings ability of yeast to establish in plant root the same result was observed for number were not the same for plants grown is considered an imperative factor for an of leaves. Treatment 2 also provided in field. Seedlings from treatment increase in plant development. This result larger (longer) leaves compared to 8, which presented the best results was not determined in this study, though. non-inoculated plants (Table 2). For [values superior to the control shoot fresh mass, plants whose seeds (without inoculation) in dry mass Many microorganisms have specificity were inoculated at 15 DAE presented for both shoot and root] did not related to their association with some plant a statistically superior result compared present the best results for plants species, which allows their establishment to non-inoculated plants, providing grown in field. In spite of this, plants in the rhizosphere, and their response 27% increase in the production of generated with seed inoculation or that to environmental stimuli (Tabassum et fresh mass (Figure 1). In general, non- received seedling inoculation (seven al., 2017); thus, the results may vary inoculated plants (treatment 1) showed or fifteen DAE) showed an increase in depending on the inoculated species or lower average values in all evaluated development when compared to non- cultivar. In this study, cultivar Crocantela parameters. No difference was observed inoculated plants (treatment 1). This was chosen for being new, and due to between treatments for stem length and result indicates that the T. globosa the fact that no studies on response to shoot dry mass. yeast was efficient in promoting inoculation with PGPM can be found. Many microorganisms can promote plant Table 1. Development parameters of lettuce seedlings grown in greenhouse, inoculated and non-inoculated with the yeast T. globosa (5S55) in different stages. Araras, UFSCar, 2017. Inoculation CPA CR LF CF MSPA MSR NL (cm) (g) seed (-), 7 DAE (-), 15 DAE (-) 3.561 8.42 ab2 1.99 b 3.46 b 0.035 b 0.025 b 3.47 ab seed (-), 7 DAE (+), 15 DAE (-) 3.61 8.66 ab 2.06 b 3.41 b 0.033 b 0.026 b 3.53 ab seed (-), 7 DAE (-), 15 DAE (+) 3.53 8.39 ab 2.20 ab 3.28 b 0.034 b 0.028 b 3.37 ab seed (-), 7 DAE (+), 15 DAE (+) 3.53 8.62 ab 2.08 b 3.41 b 0.033 b 0.025 b 3.53 ab seed (+), 7 DAE (-), 15 DAE (-) 3.77 8.27 ab 2.14 ab 3.65 ab 0.036 b 0.026 b 3.47 ab seed (+), 7 DAE (+), 15 DAE (+) 3.70 8.69 ab 2.15 ab 3.70 ab 0.037ab 0.029 ab 3.73 a seed (+), 7 DAE (-), 15 DAE (+) 3.64 9.13 a 2.13 ab 3.47 b 0.034 b 0.026 b 3.20 b seed (+), 7 DAE (-), 15 DAE (+) 3.81 7.71 b 2.40 a 4.08 a 0.042 a 0.033 a 3.17 b CV (%) 9.27 7.35 8.47 10.31 11.67 12.01 7.67 1parameter without statistical difference; 2same letters among data in the column do not differ significantly among each other, Fisher test (5%); DAE= days after emergence; CPA= shoot length; CR= root length; LF= leaf width; CF= leaf length; MSPA= shoot dry mass; MSR= root dry mass; NL= number of leaves. Table 2. Development parameters of lettuce seedling grown in the field, from seedlings inoculated and non-inoculated with the yeast T. globosa in different stages. Araras, UFSCar, 2017. Inoculation CPA CF CC MFPA MSR NL (cm) (g) seed (-),7 DAE (-),15 DAE (-) 22.00 c2 25.63 b 2.751 334.50 b 14.111 14.50 b seed (-), 7 DAE (+), 15 DAE (-) 24.17 ab 28.46 a 3.50 407.33 ab 16.42 16.33 a seed (-), 7 DAE (-),15 DAE (+) 22.50 abc 26.00 ab 3.00 360.67 ab 14.08 16.67 a seed (-), 7 DAE (+), 15 DAE (+) 22.08 bc 26.21 ab 2,96 359.42 ab 17.57 15.33 ab seed (+), 7 DAE (-), 15 DAE (-) 24.62 a 27.08 ab 3.08 402.17 ab 18.25 16.25 a seed (+), 7 DAE (+), 15 DAE (+) 23.29 abc 27.00 ab 3.17 382.83 ab 16.83 16.00 ab seed (+), 7 DAE (-), 15 DAE (+) 23.42 abc 27.50 ab 3.29 425.33 a 18.56 16.42 a seed (+), 7 DAE (-), 15 DAE (+) 23.25 abc 27.54 ab 2.96 383.17 ab 16.44 15.92 ab CV (%) 5.89 6.23 14.04 13.31 22.10 6.42 1parameter without statistical difference; 2same letters among data in the column do not differ significantly among each other, Fisher test (5%); DAE= days after emergence; CPA= shoot length; CF= leaf length; CC= stem length; MFPA= shoot fresh mass; MSR= root dry mass; NL= number of leaves. Hortic. bras., Brasília, v.37, n.3, July - September 2019 269

PG Cabrini et al. (CAPES) - Finance Code 001. REFERENCES T1= seed (-) 7 DAE (days after emergence) (-) 15 DAE (-); T2= seed (-) 7 DAE (+) 15 DAE AMPRAYN, K; ROSE, MR; KECSKÉS, M; (-); T3= seed (-) 7 DAE (-) 15 DAE (+); T4= seed (-) 7 DAE (+) 15 DAE (+); T5= seed (+) PEREG, L; NGUYENM, HT; KENNEDY, IR. 7 DAE (-) 15 DAE (-); T6= seed (+) 7 DAE (+) 15 DAE (-); T7= seed (+) 7 DAE (-) 15 2012. Plant growth promoting characteristics DAE (+); T8= seed (+) 7 DAE (+) 15 DAE (+). SL= shoot length; NF= number of leaves; of soil yeast (Candida tropicalis HY) and FW= fresh weight. its effectiveness for promoting rice growth. Figure 1. Increase (%) obtained in treatments with inoculation of yeast T. globosa, compared Applied Soil Ecology 61: 295-299. with control treatment. Araras, UFSCar, 2017. BARASSI, CA; AYRAULT, G; CREUS, CM; growth in several crops (cosmopolitan the results found in this study were SUELDO, RJ; SOBRERO, MT. 2006. Seed species), such as bacterium Azospirillum obtained from the simple inoculation inoculation with Azospirillum mitigates NaCl brasilense. This species of diazotrophic with T. globosa (5S55) cells in seeds and effects on lettuce. Scientia Horticulturae, bacteria has been isolated from several seedlings of lettuce, in an environment 109: 8-14. crops, such as maize and rice, and without control (greenhouse and currently several studies have confirmed field). The used inoculum consisted of CASSÁN, F; DIAZ-ZORITA, M. 2016. its efficiency as growth promoter in nothing but cells, that is, the use of a Azospirilllum sp. in current agriculture: From different crops (Cassán & Dias-Zorita, formulation that provided some types of the laboratory to the field. Soil Biology & 2016), as in common bean (Remans cell protection, or addition of nutrients Biochemistry 103: 117-130. et al., 2008). For lettuce, inoculation to favor the establishment of yeast in with Azospirillum brasilense promoted plants was not evaluated. CLEMENTE, JM; CARDOSO, CR.; VIEIRA, an increase in germination rate and BS; FLO, IM; COSTA, RL. 2016. Use of stimulated growth after saline stress, We can conclude that inoculation Bacillus spp. as growth promoter in carrot with the increase in number of leaves, in seeds and seedlings of lettuce, cv. crop. African Journal of Agricultural Research plant height and root length (Barassi et Crocantela, with T. globosa rhizosphere 11: 3355-3359. al., 2006; Mangmang et al., 2015). yeast (strain 5S55) provided an increase in root dry mass, and a significant FERNANDES, AA; MARTINEZ, HEP; Nevertheless, no studies on yeast increase in lettuce production, under PEREIRA, PRG; FONSECA, MCM. 2002. inoculation in plants and evaluation field conditions. Considering the need Produtividade, acúmulo de nitrato e estado of their specificity related to growth to carry out some experiments which nutricional de cultivares de alface, em promotion in different plant species evaluate inoculation, cell concentration hidroponia, em função de fontes de nutrientes. can be found. The action of the yeast in the inoculum and formulation Horticultura Brasileira20: 195-200. T. globosa (5S55), evaluated in this development is important. In addition, work as a plant-growth promoter, was we consider the need to evaluate the FIRA, D; DIMKIC, I; BERIC, T; LOZO, J; previously evaluated by Oliveira et al. establishment of the species in roots STANKOVIC, S. 2018. Biological control of (2019), who observed that inoculation through its re-isolation in selective plant pathogens by Bacillus species. Journal with yeast cells in transplanted tomato media, or with the use of molecular of Biotechnology 285: 44-55. seedlings promoted significant increase markers. in dry mass of the plants in greenhouse HUNGRIA, M; CAMPO, RJ; MENDES, IC; cultivation. These data may indicate ACKNOWLEDGEMENTS GRAHAM, PH. 2006. Contribution of that yeast may be used in different biological nitrogen fixation to the N nutrition crops. More detailed studies using other This study was financed in part of grain crops in the tropics: The success of species and other cultivars are necessary by Coordenação de Aperfeiçoamento soybean (Glycine max L. Merr.) in South to confirm this fact, considering that this de Pessoal de Nível Superior - Brasil America. In: SINGH, RP; SHANKAR, N; was not the aim of this study. JAIWA, PK (eds). Nitrogen Nutrition and Sustainable Plant Productivity, Houston: The authors also highlight that Studium Press. 43-93. IDRIS, EE; IGLESIAS, DJ; TALON, M; BORRISS, R. 2007. Tryptophan-dependent production of indole-3-acetic acid (IAA) affects level of plant growth promotion by Bacillus amyloliquefaciens FZB42. Molecular Plant-Microbe Interactions 20: 619-626. KURTZMAN, CP; ROBNETT, CJ. 1998. Identification and phylogeny of ascomycetous yeast from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie van Leeuwenhoek 73: 331-371. LUDWIG-MÜLLER, J. 2015. Bacteria and fungi controlling plant growth by manipulating auxin: balance between development and defense. Journal of Plant Physiology 172: 4-12. LUGTENBERG, BJJ; CHIN-A-WOENG, TFC; BLOEMBERG, GV. 2002. Microbe-plant interactions: principles and mechanisms. Antonie van Leeuwenhoek 81: 373-383. MANGMANG, JS.; DEAKER, R; ROGERS, G. 2015. Early seedling growth response of lettuce, tomato and cucumber to Azospirillum brasilense inoculated by soaking and drenching. Horticultural Science 42: 37-46. 270 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Torulaspora globosa: rhizosphere yeast promoting lettuce growth on seedlings and under field conditions N A S S A R , A ; E L - TA R A L I B Y, K ; L.). Plant and Soil 302: 149-161. liquefaciens SQR9. Biology and Fertility of SIVASITHAMPARAM, K. 2005. Promotion Soils 51: 321-330. of plant growth by an auxin-producing isolate ROSA, MM. 2009. Avaliação de leveduras TABASSUM, B; KHANB, A; TARIGA, M; of the yeast Williopsis saturnus endophytic isoladas de áreas agrícolas como agentes no RAMZANC, M; KHANA, MSI; SHAHIDA, in maize (Zea mays L.) roots. Biology and controle biológico de fitopatógenos. 151p. Rio N; AALIYAA, K. 2017. Bottlenecks in Fertility of Soils 42: 97-108. Claro: UNESP. (Ph.D. Thesis). commercialization and future prospects of MPCV. Applied Soil Ecology 121: 102-117. ODOH, CK. 2017. Plant growth promoting ROSA, MM; TAUK-TORNISIELO, SM, TAGELE, SB; KIM, SW; LEE, HG; KIM, HS; rhizobacteria (MPCV): a bioprotectant RAMPAZZO, PE; CECCATO-ANTONINI, LEE, YS. 2018. Effectiveness of multi-trait bioinoculant for sustainable agrobiology. A SR. 2010. Evaluation of the biological Burkholderia contaminants KNY17BI1 in review.International Journal of Advanced control by yeast Torulaspora globosa against growth promotion and management of banded Research in Biological Sciences 4: 123-142. Colletotrichum sublineolum in sorghum. World leaf and sheath blight in maize seedling. Journal of Microbiology and Biotechnology Microbiological Research 214: 8-18. OLIVEIRA, BT; BIZARRIA JUNIOR, R; SILVA, 26: 1491-1502. TAIZ, L; ZEIGER, E. 2009. Fisiologia Vegetal. LG; ROSA-MAGRI, MM. 2019.Rhizosphere Artmed Editora. 848p. yeast Torulaspora globosa with plant growth ROSA-MAGRI, MM; AVANSINI, SH; LOPES- UFSCar. 2013. UFSCar desenvolve nova cultivar promotion traits and improvement of the ASSAD, ML; TAUK-TORNISIELO, SM; de alface. Informativo FAI-UFSCar 133:3. development of tomato seedlings under CECCATO-ANTONINI, SR. 2012. Release YOUSEIF, SH. 2018. Genetic diversity of plant greenhouse conditions. African Journal of of potassium from rock powder by the yeast growth promoting rhizobacteria and their Agricultural Research 14: 935-942. Torulaspora globosa. Brazilian Archives of effects on the growth of maize plants under Biology and Technology 55: 577-582. greenhouse conditions. Annals of Agricultural RADHAKRISHNAN, R; LEE, IJ. 2016. Sciences 63: 25-35. Gibberellins producing Bacillus SALA, FC; COSTA, CP. 2012. Retrospectiva YOSHIDA, FA; STOLF, R. 2016. Mapeamento methylotrophycus KE2 supports plant growth e tendência da alfacicultura brasileira. digital de atributos e classes de solo da UFSCar- and enhances nutritional metabolites and Horticultura Brasileira 30:187-194. Araras/SP. Revista Ciência, Tecnologia & food values of lettuce. Plant Physiology and Ambiente 3: 1-11. Biochemistry 109: 181-189. SARABIA, M; CAZARES, S; GONZÁLEZ- ZEFFA, DM; PERINI, LJ; SILVA, MB; SOUSA, RODRÍGUEZ, A; MORA, F; CARREÓN- NV; SCAPIM, CA; OLIVEIRA, ALM; REMANS, R; BEEBE, S; BLAIR, M; ABUD, Y; LARSEN, J. 2018. Plant growth AMARAL JUNIOR, AT; GONÇALVES, MANRIQUE, G; TOVAR, E; RAO, I; promotion traits of rhizosphere yeasts and LSA. 2019. Azospirillum brasilense promotes CROONENBORGHS, A; GUTIERREZ- their response to soil characteristics and crop increases in growth and nitrogen use efficiency TORRES, R; EL-HOWEITY, M; MICHIELS, cycle in maize agroecosystems.Rhizosphere of maize genotypes. PLoS ONE 14: e0215332. VANDERLEYDEN, J. 2008. Physiological 6: 67-73. doi:10.1371. and genetic analysis of root responsiveness to auxin-producing plant growth-promoting SHAO, J; XU, Z; ZHANG, N; SHEN, Q; bacteria in common bean (Phaseolus vulgaris ZHANG, R. 2015. Contribution of indole- 3-acetic acid in the plant growth promotion by the rhizosphere strain Bacillus amylo Hortic. bras., Brasília, v.37, n.3, July - September 2019 271

Research VALADARES, RN; NÓBREGA, DA; LIMA, LB; MENDES, AQ; SILVA, FS; MELO, RA; MENEZES, D. 2019. Genetic divergence among eggplant genotypes under high temperatures. Horticultura Brasileira 37: 272-277. DOI - http://dx.doi.org/10.1590/S0102-053620190304 Genetic divergence among eggplant genotypes under high temperatures Ricardo de N Valadares1ID; Danieli A Nóbrega1ID; Lilian B de Lima1ID; Adônis Q Mendes2ID; Fabian S Silva1ID; Roberto de A Melo1ID; Dimas Menezes2ID ¹Universidade Federal Rural de Pernambuco (UFRPE), Recife-PE, Brasil; [email protected] (corresponding author); dany.an@ hotmail.com.br; [email protected]; [email protected]; [email protected]; [email protected]. 2Instituto Federal de Pernambuco (IFPE), Vitória de Santo Antão-PE, Brasil; [email protected]. ABSTRACT RESUMO The aim of this study was to estimate the genetic divergence Divergência genética entre genótipos de berinjela sob altas among eggplant genotypes for agronomic traits in order to gather temperaturas information for the selection of genotypes in eggplant breeding programs for tolerance to high temperatures. Ten traits recommended O objetivo deste trabalho foi estimar a divergência genética entre by the International Board for Plant Genetic Resources were analyzed genótipos de berinjela para caracteres agronômicos, visando gerar in 24 genotypes, arranged in a randomized complete block design with informações para a escolha de genótipos em programas de melhora- four replicates. Data were submitted to analysis of variance (P<0.01) mento genético para tolerância a altas temperaturas. Foram analisados and later to the UPGMA and Tocher grouping methods, using the dez caracteres recomendados pelo International Board for Plant generalized Mahalanobis distance (D2) as dissimilarity measure. Genetic Resources em 24 genótipos, dispostos no delineamento de Three and six groups of similarity were obtained, respectively, for the blocos ao acaso, com quatro repetições. Os dados foram submetidos à multivariate techniques used, UPGMA and Tocher, with concordance análise de variância (P<0,01) e posteriormente aos métodos de agru- in the grouping of 87.50% of the genotypes. The characters fruit pamento de UPGMA e Tocher, utilizando-se a distância generalizada length (34.71%), fruit width (35.96%) and fruit length/width de Mahalanobis (D2) como medida de dissimilaridade. Obtiveram-se ratio (14.08%) were the main contributors to genetic divergence, três e seis grupos de similaridade, respectivamente, para as técnicas explaining 90.72% of total genetic dissimilarity. The genotypes multivariadas utilizadas, UPGMA e Tocher, havendo concordância presented considerable genetic variability for all agronomic traits no agrupamento de 87,50% dos genótipos. Comprimento do fruto analyzed and can be used in eggplant genetic breeding programs for (34,71%), largura do fruto (35,96%) e a relação comprimento/lar- high temperatures. gura do fruto (14,08%) foram os caracteres que mais contribuíram para a divergência genética, explicando 90,72% da dissimilaridade genética total. Os genótipos apresentaram considerável variabilidade genética para todos os caracteres agronômicos analisados e podem ser utilizados nos programas de melhoramento genético de berinjela para altas temperaturas. Keywords: Solanum melongena, genetic variability, protected Palavras-chave: Solanum melongena, variabilidade genética, cultivo cultivation. protegido, correlações genéticas. Received on October 18, 2018; accepted on May 8, 2019 I n Brazil, the area cultivated al., 2019ab). choice of parents which, when crossed, with eggplant (1550 ha/year) is The optimal temperature for crop result in high heterotic effect on concentrated mainly in the Center- progenies, maximizing the chances South region (Boiteux et al., 2016). growth and development is in the range of obtaining superior genotypes in In the Northeast, where temperatures of 22 to 30°C (Adamczewska-Sowińska segregating generations (Rotili et are relatively high, averaging around & Krygier, 2013). When the temperature al., 2012). These genotypes can be 28°C and peaking around 40°C exceeds 32°C, productivity is drastically obtained by biometric techniques based (Ramalho, 2013) crop yields have reduced (Baswana et al., 2006).Adoption on quantification of heterosis or by been unpredictable. This is mainly due of strategies for evaluation and selection predictive processes (Nardino et al., to flowering coinciding with warmer of eggplant genotypes and knowledge of 2017). periods of the year, increasing the the genetic variability involved in traits occurrence of malformation and/or fruit of agronomic importance are extremely Among the biometric techniques abortion. In greenhouse crops, where the important for the choice of genotypes to are diallel analyzes, which generate internal temperatures are higher than the compose eggplant breeding programs information about the specific combining outside, there is a considerable reduction for high temperature tolerance. ability and heterosis manifested in in crop yield in the region (Valadares et hybrids and in the prediction of genetic Genetic divergence studies provide divergence, also keeping in mind these parameters and allow the correct 272 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Genetic divergence among eggplant genotypes under high temperatures that several multivariate methods can MATERIAL AND METHODS Six quantitative traits were be applied, including agglomerative evaluated: fruit length (cm), fruit width methods. The experiment was conducted (cm), fruit length/width ratio, number between May and September 2016 of fruits per plant, yield per plant (g) Agglomerative methods (Cruz et al., at Universidade Federal Rural de and fruit mass (g); and four qualitative 2012) seek to genetically discriminate Pernambuco (UFRPE), Recife-PE. traits: fruit color at commercial maturity individuals and allow them to be (1= green; 2= white; 3= yellow; 4= light separated into groups by analyzing a set Seeds were sown in 128-cell red; 5= dark red; 6= grayish purple; of characters inherent to each individual, expanded polystyrene trays filled 7= purple; 8= dark purple; 9= black), grouping them by some classification with inert substrate (sifted coconut fruit color distribution at commercial criteria, so that there is homogeneity powder). Trays were kept in greenhouse maturity (1= uniform; 3= mottled; 5= within each group and heterogeneity in the hydroponic system by sub- lacy; 7= streaked), fruit curvature (1= between them. They also basically irrigation until reaching the point for none (straight fruit); 3= slightly curved; involve two stages, the first refers to the transplantation, plantlets with three 5= curved; 7= snake-shaped; 8= sickle- estimation of a similarity or dissimilarity definite leaves. Seedlings were shaped; 9= U-shaped) and the presence measure and the second refers to the individually transplanted to 5 L pots, of thorns in the fruit’s cup (0= none; adoption of a grouping technique. containing inert substrate (coconut 1= very few (<3); 3= few (~5); 5= powder), spaced 1.75 m between rows intermediate (~10); 7= many (~20); 9= As dissimilarity measures, we and 0.60 m between plants. very many (>30)) (IBPGR, 1990). can point out the Euclidean distance, the average Euclidean distance, the Plants were cultivated in open Quantitative data were initially average squared Euclidean distance, the hydroponics with substrate, under a 30 submitted to univariate analysis of weighted distance and the generalized m long, 14 m wide, 3 m ceiling height variance (p<0.01) and from the means Mahalanobis distance (D2) (Cruz et al., arch, with 50% shading side screens and residual variance and covariance 2012, 2014). and roof covered with a low-density matrix was obtained the genetic polyethylene film, 150 micrometers dissimilarity matrix based on the Genotype grouping can be done by thick. generalized Mahalanobis distance optimization and hierarchical clustering (D2). The genotype clustering was methods. Among the optimization Mineral nutrition and water obtained by the method of ascending clustering methods are the modified requirement of plants were supplied hierarchical classification algorithm Tocher and Tocher (Vasconcelos et al., by balanced nutrient solution at each UPGMA (Unweighted Pair-Grouped 2007; Cruz et al., 2014). Hierarchical plant development stage. A drip Method Average) and by the Tocher’s clustering methods include the methods irrigation system was used with 2 L h-1 optimization method. of the nearest neighbor, the farthest emitter, automatically controlled by a neighbor, UPGMA (Unweighted digital timer, with irrigation amounts The relative importance of traits in Pair-Group Method using Arithmetic and duration adjusted according to the prediction of genetic diversity was Averages), the centroid, the median (or environmental conditions of the region also studied through the participation WPGMC), and the Ward’s minimum and the amount of nutrient solution of D2 components, related to each trait variance (Cruz et al., 2012). absorbed by the plants. in the total dissimilarity observed, and the diversity between genotypes was Finally, we can adopt the cophenetic Throughout the experiment period, estimated by Mahalanobis distance. correlation analysis to increase the relative air temperature (average, (Singh, 1981). reliability of the conclusions regarding maximum and minimum) and relative air interpretation based on dendrograms. humidity were recorded using a HOBO To test the efficiency of the This establishes a correlation between mini datalogger. The environmental hierarchical clustering method, we the similarity or dissimilarity matrix conditions in which the experiment was estimated the cophenetic correlation with the generated dendrogram, i.e., performed are characterized by high coefficient, obtained with 1,000 compares the actual distances obtained temperatures, since in all phenological simulations, analyzed by the “t” test. between the accessions with the phases temperatures exceeded the The cutoff point (Cp) of the dendrogram distances graphically represented (Kopp optimum range of the culture. formed by the UPGMA method was et al., 2007). The higher the correlation defined as proposed by Mojema (1977), value, the smaller the distortion caused Eighteen eggplant accessions from following the formula Cp = m + ksd, by grouping. the Embrapa Hortaliças’ germplasm where m = the mean distance values of bank and six commercial cultivars the fusion levels corresponding to the Given the above, the present work (Ciça F1, Choryoku F1, Kokushi Onaga stadiums; k = 1.25 (Milligan & Cooper, aimed to estimate genetic divergence F1, Ajimurasaki F1, Ajishirakawa F1 1985); sd = standard deviation. between eggplant genotypes for and Florida Market) were evaluated, agronomic traits, aiming to generate coming to a total of 24 treatments All statistical analyzes were information for the choice of genotypes arranged in randomized block design performed using the GENES software, in eggplant breeding programs for high with four replications and four plants version 1990.2018.75 (Cruz, 2013). temperature tolerance. per experimental plot. 273 Hortic. bras., Brasília, v.37, n.3, July - September 2019

RN Valadares et al. RESULTS AND DISCUSSION breeding programs. that most contributed to the genetic divergence stood out (Table 3). In The micrometeorological data Dissimilarities (D2) between this sense, the fruits of this group had obtained during the experiment genotypes ranged from 1.07 to 728.53, an average length of 14.11 cm, with period showed that the maximum air with an average of 133.47. The largest averages ranging from 6.89 (CNPH temperature in the greenhouse ranged distances were recorded between CNPH 668) to 18.09 cm (CNPH 51). For fruit between 29.8 and 41.4°C and the 135 and Ajishirakawa F1 genotypes. width, the average was 5.84 cm, with minimum temperature between 18.6 On the other hand, genotypes CNPH values between 3.64 (CNPH 84) and and 23.7°C. The average temperature 47 and Florida Market were the least 8.55 cm (CNPH 135), reflecting in the ranged between 23.7 and 28.5°C. Thus, genetically distant (Figure 1). Thus, length/width ratio of the fruit, which the environment was classified as high crossings between the most divergent was between 1.48 (CNPH 668) and 4.91 temperature for eggplant cultivation. groups are indicated for formation of (CNPH 84) with a mean of 2.59 (Table Relative humidity ranged from 83.7 to segregating populations and with greater 1). Results similar to those were reported 95.4%. genetic variability for the analyzed by Valadares et al. (2019b). traits. Significant differences were verified In the morphological description of by F test (p<0.01) between genotypes for The dendogram obtained by UPGMA the genotypes of group 1, for qualitative all analyzed traits (Table 1). This result hierarchical method showed the traits (Table 1), considerable levels of refers to the existence of phenotypic formation of three groups, considering phenotypic variability were observed variability between genotypes, and it a significant cut of 44.32% (Mojena, only for fruit color at commercial is necessary to identify the superior 1977). Group 1 was composed of most maturity, with a predominance of dark genotypes to be crossed in eggplant genotypes, approximately 84% (Figure purple, followed by grayish purple, 1). Among quantitative traits, those Table 1. Description of eggplant genotypes under high temperatures. Recife, UFRPE, 2016. Genotypes LF (cm) FW (cm) FLWR NFP YP (g) CNPH 135 12.96 8.56 1.52 1.89 470.03 CNPH 60 13.51 6.77 2.00 2.14 301.03 CNHP 51 18.09 5.00 3.67 1.57 203.20 CNPH 410 15.29 5.48 2.80 1.39 149.72 CNPH 84 17.70 3.64 4.91 3.56 283.50 CNPH 71 16.01 4.09 3.94 1.85 161.08 CNPH 668 6.89 4.67 1.48 4.08 209.79 CNPH 146 12.63 5.85 2.17 2.35 249.95 CNPH 140 13.42 5.27 2.83 2.09 191.20 CNPH 93 13.82 4.61 2.99 1.97 173.23 CNPH 47 14.15 7.68 1.85 1.26 242.36 CNPH 141 11.56 5.86 1.97 3.83 383.69 CNPH 67 13.06 6.38 2.05 3.00 341.20 CNPH 107 15.56 5.58 2.80 2.24 317.69 CNPH 53 11.90 7.77 1.55 1.00 151.28 CNPH 109 14.47 6.18 2.34 1.72 225.65 CNPH 79 13.16 5.33 2.60 2.00 101.41 Ciça F1 16.59 6.21 2.68 1.42 242.56 CNPH 100 17.35 4.56 3.91 1.16 110.99 Florida Market 14.26 7.50 1.91 1.39 257.40 Ajishirakawa F1 23.65 3.21 7.41 1.30 130.94 Choryoku F1 30.02 3.99 7.51 1.13 154.54 Kokushi Onaga F1 27.95 4.42 6.39 1.67 223.60 Ajimurasaki F1 28.36 2.84 9.97 4.13 316.13 CV (%) 7.58 6.50 10.86 28.78 32.29 QM (treatments) 8.83** 19.82** 3.65** 32586.12** Mean 128.83** 5.48 3.47 2.08 233.01 16.35 274 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Genetic divergence among eggplant genotypes under high temperatures Table 1. Continuation Genotypes FM (g) FCCM DFCCM FC TFC CNPH 135 248.16 dark purple uniform none (straight fruit) intermediate CNPH 60 139.12 dark purple uniform none (straight fruit) CNHP 51 127.49 dark purple uniform none CNPH 410 105.68 uniform slightly curved none CNPH 84 77.69 purple uniform none (straight fruit) none CNPH 71 89.06 purple streaked none CNPH 668 51.47 purple streaked curved none CNPH 146 108.66 green uniform curved none CNPH 140 91.53 grayish purple uniform none (straight fruit) intermediate CNPH 93 77.35 grayish purple uniform none (straight fruit) few CNPH 47 174.82 grayish purple uniform none (straight fruit) none CNPH 141 98.41 dark purple uniform none (straight fruit) none CNPH 67 111.23 dark purple uniform none (straight fruit) few CNPH 107 140.49 grayish purple uniform none (straight fruit) none CNPH 53 167.53 dark purple uniform none (straight fruit) none CNPH 109 134.09 dark purple uniform none (straight fruit) none CNPH 79 47.84 purple uniform none (straight fruit) none Ciça F1 168.41 grayish purple uniform none (straight fruit) none CNPH 100 113.39 dark purple uniform none (straight fruit) none Florida Market 187.18 dark purple uniform none (straight fruit) none Ajishirakawa F1 101.27 dark purple uniform none (straight fruit) none Choryoku F1 138.04 white uniform none (straight fruit) none Kokushi Onaga F1 142.96 green uniform curved none Ajimurasaki F1 77.68 black uniform curved none CV (%) 24.60 purple snake-shaped none QM (treatments) 8472.63** - snake-shaped Mean 121.65 - - - - - - - - - - - LF= fruit length; FW= fruit width; FLWR= fruit length/width ratio; NFP= fruits per plant (number); YP= yield per plant; FM= fruit mass; FCCM= fruit color in commercial maturation; DFCCM= distribution of fruit color during commercial maturation; FC= fruit curvature; TFC= thorn in the fruit cup; **significant at 1% probability by F test. purple and green. However, the fruits alone group 3, consisting of fruits genotypes presented curved fruits and showed color distribution at commercial longer than 23.64 cm, fruit width less Kokushi Onaga F1 snake-shaped fruits maturation predominantly uniform with than 4.41 cm and length/width ratio (Table 1). No non-commercial genotype no curvature and no thorns in the fruit’s of the fruit greater than 6.38 (Table 1). showed considerable similarity with cup (Table 1). This distribution indicates Averages for fruit length in group 2 these commercial cultivars. that, in relation to the evaluated traits were between 23.65 (Ajishirakawa F1) (quantitative and qualitative), most and 30.01 cm (Choryoku F1) and for Group 3 included only the genotypes presented high levels of fruit width between 3.20 (Ajishirakawa Ajmurasaki F1 genotype with the similarity, including the commercial F1) to 4.41 cm (Kokushi Onaga F1). second longest fruit length among cultivars Ciça F1 and Florida Market, For length/width ratio of the fruit, the the evaluated genotypes (28.35 cm), contemplated in this group 1. variation ranged from 1.48 (CNPH smallest fruit width (2.83 cm) and 668) to 4.91 (CNPH 84) (Table 1). For highest fruit length/width ratio (9.96). According to Guedes et al. (2013), fruit color, Ajishirakawa F1 genotype (Table 1), similar to those reported by individuals are grouped in pairs, using presented white, Choryoku F1 green Valadares et al. (2019b). The fruits arithmetic means of dissimilarity, and the and Kokushi Onaga F1, black fruits. showed uniform purple coloration, dendrogram prioritizes genotypes with However, predominantly of uniform snake-shaped curvature and no thorns greater similarity. This explains why distribution and without any thorn in in the fruit cup (Table 1). the Kokushi Onaga F1, Ajishirakawa the fruit’s cup. About fruit curvature, F1 and Choryoku F1 genotypes formed Ajishirakawa F1 and Choryoku F1 Grouping of genotypes by the group 2 and the Ajmurasaki F1 genotype Tocher method was partially similar to the UPGMA method when grouping Hortic. bras., Brasília, v.37, n.3, July - September 2019 275

RN Valadares et al. Figure 1. Dendrogram obtained by UPGMA grouping method, using Mahalanobis distance (D²), resulting from the analysis of 24 eggplant genotypes, evaluated under high temperatures. Recife, UFRPE, 2016. Table 2. Grouping by Tocher method resulting from the analysis of 24 eggplant genotypes evaluated under high temperatures. Recife, UFRPE, 2016. Groups Genotypes 1 CNPH 47, Flórida Market, CNPH 53, CNPH 60, CNPH 67, CNPH 109, CNPH 146, CNPH 141, Ciça F1, CNPH 140, CNPH 107, CNPH 79, CNPH 410, CNPH 93, CNPH 51, CNPH 100, CNPH 71 2 AjishirakawaF1, ChoryokuF1, Kokushi Onaga F1 3 CNPH 84 4 Ajimurasaki F1 5 CNPH 668 6 CNPH 135 among the most divergent genotypes consequently increase genetic variability that fruit length, fruit width and fruit (Table 2). Similarity between the (Abreu et al., 2004). Disagreements length/width ratio presented the highest different clustering techniques can occurred in the formation of groups percentage of contribution to divergence be seen from the fact that genotypes 3 (CNPH 84), 5 (CNPH 668) and 6 among the 24 evaluated genotypes, belonging to Tocher’s group 1 were (CNPH 135) by Tocher’s method. explaining 90.72% of the total genetic mostly the same ones from the UPGMA dissimilarity (Table 3). grouping, around 71% of the genotypes, The association of clustering including Ciça F1 and Florida Market. techniques provides a more efficient High contribution of fruit length to support for determination of divergence, eggplant divergence has been reported There was also agreement in the since Tocher discriminates each group by Babu & Patil (2004) and Mehta et formation of group 2 which included and UPGMA discriminates each al. (2004), while average fruit weight genotypes Kokushi Onaga F1, genotype and can more safely infer the and number of fruits per plant traits Ajishirakawa F1 and Choryoku F1 and use of parents in breeding programs have lower contributions as reported the formation of group 4 composed (Bertan et al., 2006). by Prabakaran et al. (2015). Bashar only by genotype Ajmurasaki F1. et al. (2016) also cited contributions Agreement between multivariate The relative importance of the of length and width of fruit traits in techniques is important in the study analyzed traits in the genetic the genetic divergence of eggplant. of genetic divergence, as it allows the dissimilarity between genotypes was we observed that genotype clustering recommendation of crossing between detected by Singh’s method (1981). was predominantly influenced by fruit the most divergent parents possible, in This method considers that the most length, fruit width and fruit length/width order to broaden the genetic base and important characteristics express greater ratio, showing greater variability for variability. In this respect, we found 276 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Genetic divergence among eggplant genotypes under high temperatures Table 3. Relative contribution of six quantitative traits to genetic divergence among 24 GENETIC RESOURCES (IBPGR). 1990 eggplant genotypes, using the Singh method, evaluated in 24 eggplant genotypes under high Descriptors for eggplant. International Board temperatures. Recife, UFRPE, 2016. for Plant Genetic Resources. 23p. Traits Relative contribution (%) KOPP, MM; SOUZA, VQ; COIMBRA, JLM; LUZ, VK; MARINI, N; OLIVEIRA, AC. Fruit length (cm) 40.71 2007. Melhoria da correlação cofenética pela exclusão de unidades experimentais Fruit width (cm) 35.96 na construção de dendogramas. Revista da Faculdade de Zootecnia, Veterinária e Fruit length/ width ratio 14.08 Agronomia 14: 46-53. Number of fruits per plant 5.56 MEHTA, DR; GOLANI, IJ; PANDYA, HM; PATEL, RK; NALIYADHARA, MV.2004. Yield per plant (g) 2.88 Genetic diversity in brinjal (Solanum melongena L.). Journal of Vegetation Science Fruit mass (g) 0.81 31: 142-145. Total 100 MILLIGAN, GW; COOPER, MC.1985. An examination of procedures for determining the these traits (Table 3). field cultivated eggplant in relation to its number of clusters in a data set. Psychometrika According to Rohlf (2000), the cultivar and the degree of fruit maturity. Acta 50: 159-179. Scientiarum Polonorum-Hortorum Cultus adjustment of cophenetic correlation 12: 13-23. MOJEMA, R. 1977. Hierarchical grouping coefficient is considered good when methods and stopping rules: an evaluation. values are equal to or higher than (r) BABU, RB; PATIL, RV. 2004. Genetic divergence The Computer Journal 20: 359-363. 0.70. In this case, the greater the (r) in brinjal. Journal of Vegetation Science 31: the smaller the distortion of the cluster, 125-128. NARDINO, M; BARETTA, D; CARVALHO, presenting a good fit between the matrix IR; FOLLMANN, DN; FERRARI, M; and the formed dendrogram (Cruz et BASHAR, A; HOSSAIN, MK; HASAN, R; PELEGRIN, AJ; SZARESKI, VJ; al., 2012). ISLAM, S, HUQUE, AM; ALAM, N. 2016. KONFLANZ, VA; SOUZA, VQ. 2017. Breeding potential of common eggplant Divergência genética entre genótipos de milho Eggplant genotypes, under high (Solanum melongena L.) using divergence (Zea mays L.) em ambientes distintos. Revista temperatures, showed significant genetic analysis. Bangladesh Journal of Botany 45: de Ciências Agrárias 40: 164-174. divergence for all evaluated traits. 109-115. Tocher’s optimization methods and the PRABAKARAN, S; BALAKRISHNAN, hierarchical UPGMA agreed in 87.50% BASWANA, KS; DAHIYA, MS; KALLOO, S; KUMAR, SR; ARUMUGAM, T; of genotypes clustering. The traits that NK; SHARMA, BS; DHANKHAR, BS; ANANDAKUMAR, CR. 2015. Genetic the most contributed to divergence were DUDI, BS. 2006. Brinjal HLB-25: A high diversity, trait relationship and path analysis fruit length, fruit width and fruit length/ temperature tolerant variety. Haryana Journal in eggplant landraces. Electronic Journal of width ratio. The cophenetic correlation of Horticultural Sciences 35: 318-319. Plant Breeding 6: 831-837. coefficient (r) was 0.79. Most genotypes showed genetic similarity with Ciça F1 BERTAN, I; CARVALHO, FIF; OLIVEIRA, AC; RAMALHO, MFJL. 2013. A fragilidade ambiental and Florida Market cultivars. VIEIRA, EA; HARTWIG, I; SILVA, JAG; do Nordeste brasileiro: o clima semiárido e as SHIMIDT, DAM; VALÉRIO, IP; BUSATO, imprevisões das grandes estiagens. Sociedade ACKNOWLEDGEMENTS CC; RIBEIRO, G. 2006. Comparação de e Território 25: 104-115. métodos de agrupamento na representação da To Capes for sponsoring a distância morfológica entre genótipos de trigo. ROHLF, FJ. 2000. NTSYS-pc: numerical taxonomy scholarship to the first author and to Revista Brasileira de Agrociência 12: 279-286. and multivariate analysis system, version 2.1. Embrapa Hortaliças for providing the New York: Exeter Software. 98p. accesses. BOITEUX, LS; MENDONÇA, LJ; FONSECA, MEN; REIS, A; VILELA, NJ; GONZÁLEZ- ROTILI, EA; CANCELLIER, LL; DOTTO, REFERENCES ARCOS, M; NASCIMENTO, MN. 2016. MA; PELUZIO, JM; CARVALHO, EV. 2012. Melhoramento de berinjela. In: NICK, Divergência genética em genótipos de milho, ABREU, FB; LEAL, NR; RODRIGUES, R; C; BORÉM, A (eds). Melhoramento de no Estado do Tocantins. Revista Ciência AMARAL, JRAT; SILVA, DJH. 2004. Hortaliças. Viçosa: Editora UFV. p.158-192. Agronômica 43: 516-521. Divergência genética entre acessos de feijão- de-vagem de crescimento indeterminado. CRUZ, CD. 2013. Genes - a software package SINGH, D.1981. The relative importance of Horticultura Brasileira 22: 547-552. for analysis in experimental statistics and characters affecting genetic divergence. Indian quantitative genetics. Acta Scientiarum. Journal of Genetic and Plant Breeding 41: ADAMCZEWSKA-SOWIŃSKA, K; KRYGIER, Agronomy 35: 271-276. 237-245. M. 2013. Yield quantity and quality of CRUZ, CD; CARNEIRO, PCS; REGAZZI, AJ. VALADARES, RN; LIMA, LB; NÓBREGA, 2014. Modelos biométricos aplicados ao DA; SILVA, JAS; MENDES, AQ; COSTA, melhoramento genético. 3ª ed. Viçosa: Editora IJN; MENEZES, D. 2019a. Pollen viability UFV. 688p. in eggplant using colorimetric and in vitro techniques. Journal of Experimental CRUZ, CD; REGAZZI, AJ; CARNEIRO, PCS. Agriculture International 32: 1-7. 2012. Modelos biométricos aplicados ao melhoramento genético. 4ª ed. Viçosa: Editora VALADARES, RN; NÓBREGA, DA; MOREIRA, UFV. 514p. CS; SILVA, JAS; MENDES, AQ; SILVA, FS; COSTA, ÍJN; MENEZES, D. 2019b. GUEDES, JM; VILELA, DJM; REZENDE, JC; Selection of eggplant genotypes tolerant to SILVA, FL; BOTELHO, CE; CARVALHO, high temperatures. Journal of Experimental SP. 2013. Divergência genética entre cafeeiros Agriculture International 31: 1-10. do germoplasma Maragogipe. Bragantia 72: 127-132. VASCONCELOS, ED; CRUZ, CD; BHERING, LL; RESENDE JUNIOR, MFR. 2007. INTERNATIONAL BOARD FOR PLANT Alternative method for clustering analysis. Pesquisa Agropecuária Brasileira 42: 1421- 1428. Hortic. bras., Brasília, v.37, n.3, July - September 2019 277

Research XAVIER, LFS; PESTANA, JK; SEKIYA, A; KRAUSE, MD; MOREIRA, RMP; FERREIRA, JM. 2019. Partial diallel and potential of super sweet corn inbred lines bt2 to obtain hybrids. Horticultura Brasileira 37: 278-284. DOI - http://dx.doi.org/10.1590/S0102-053620190305 Partial diallel and potential of super sweet corn inbred lines bt2 to obtain hybrids Larissa Fernanda S Xavier1ID; Jéssica Kelly Pestana1ID; Alline Sekiya1ID; Matheus D Krause1ID; Rosângela Maria P Moreira1ID; Josué M Ferreira1ID 1Universidade Estadual de Londrina (UEL), Londrina-PR, Brasil; [email protected]; [email protected]; allinesekiya@gmail. com; [email protected]; [email protected]; [email protected] ABSTRACT RESUMO The aims of this study were to determine the potential of S4 super Dialelo parcial e o potencial de linhagens de milho superdoce sweet corn inbred lines for hybrid synthesis, identify the predominant bt2 para obtenção de híbridos types of gene action and correlations among different traits, significant for breeding programs. The 81 hybrids obtained from a partial diallel Os objetivos foram determinar o potencial de linhagens S4 de 9x9 and three checks were evaluated. A complete randomized block milho superdoce para síntese de híbridos, identificar os tipos de ações design, with three replicates, and two sowing seasons was used. We gênicas predominantes e as correlações para diferentes caracteres could notice significant hybrid effects, general combining ability importantes para o melhoramento. Os 81 híbridos obtidos em um (GCA) of GI and GII groups and specific combining ability (SCA) in dialelo parcial 9x9 e três testemunhas foram avaliados em blocos relation to evaluated traits, highlighting the existence of hybrids with completos casualizados, com três repetições, em duas épocas de superior performance and the expression of additive and non-additive semeadura. Houve efeitos significativos de híbridos, de capacidade effects. The inbred lines: L1, L3, L6 and L9 (GI) and L1’, L7’ and L9’ geral de combinação (CGC) dos grupos GI e GII e de capacidade (GII) showed the best GCA and SCA estimates, being present in the específica de combinação (CEC) para os caracteres avaliados, evi- nine selected hybrids with superior and competitive performance in denciando a existência de híbridos com desempenhos superiores e a relation to the checks. The estimated correlations indicate that, for a expressão de efeitos aditivos e não aditivos. As linhagens L1, L3, L6 e breeding program aiming to increase grain productivity, evaluating, L9 (GI) e L1’, L7’ e L9’ (GII) apresentaram as melhores estimativas de at least, the dehusked ears, prioritizing genotypes with larger ear CGC e CEC, estando presente nos nove híbridos selecionados com diameters and longer ear lengths is important. desempenhos superiores e competitivos em relação às testemunhas. As correlações estimadas indicam que, para o melhoramento visando o aumento de produtividade de grãos, é importante avaliar ao menos as espigas sem palha, priorizando genótipos com maiores diâmetros e comprimentos de espigas. Keywords: Zea mays var. saccharata, combining ability, correlations. Palavras-chave: Zea mays var. saccharata, capacidade de combinação, correlações. Received on December 14, 2018; accepted on June 4, 2019 Sweet corn is originated from in natura or processed by vegetable et al., 2014). In Brazil, these days, few recessive genetic mutations of canning industries in several countries cultivars of sweet and super sweet corn common corn, which block starch (Kwiatkowski & Clemente, 2007; seeds are available to farmers, only 65 synthesis, increasing endosperm sugar Teixeira et al., 2013; Luz et al., 2014). cultivars are registered by the Ministry of concentrations. Homozygous genotypes However, in Brazil, super sweet corn Agriculture, Livestock and Food Supply for shrunken (sh1 and sh2) or brittle is basically consumed industrialized, (Brazil, 2018). Therefore, developing genes (bt1 and bt2) present higher sugar commonly as canning corn grains, and new superior hybrid combinations is content, being classified as super sweet, the consumers themselves have no idea essential for expansion of super sweet whereas other mutant genotypes are that these grains are a special type of corn production in Brazil (Santos et classified as sweet corn (Teixeira et corn. al., 2014). al., 2013). Hybrids of super sweet corn inbred Breeding programs of super sweet Super sweet corn is considered a lines are cultivars which best meet corn, which aim to obtain hybrids, vegetable and it is dedicated exclusively canning industry demands, due to its develop many inbred lines, not all these for human consumption. It has a high uniformity and agronomic performance lines will produce hybrids with high nutritional value, being consumed (Kwiatkowski & Clemente, 2007; Luz agronomic potential, though. Thus, 278 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Partial diallel and potential of super sweet corn inbred lines bt2 to obtain hybrids agronomic and genetic evaluations of source population for gene introduction. level to the flag leaf insertion; c) ear these inbred lines based on their hybrid height (EH, in cm): average ear height combination performance is extremely The 81 hybrids and three checks of three plants of each plot, measured important (Kashiani et al., 2014). (the synthetics ST0509A and ST2109B, from ground level to the superior ear Diallel analysis is used as a tool which developed at Farm School of UEL, insertion; d) husked ear yield (HEY, in provides useful estimates to select more and the hybrid Tropical Plus, from t ha-1); e) dehusked ear yield (DEY, in t promising lines for synthesis of hybrids Syngenta Seeds), were evaluated at ha-1); f) grain yield at green corn stage and to understand the magnitude of the UEL, in the crop season 2013/2014, in (GY, in t ha-1); g) ear length (EL, in cm): effects which determine genetic traits two sowing dates (October 28, 2013 average length of five ears of each plot; (Cruz et al., 2004; Kwiatkowski et al., and November 28, 2013), both without h) ear diameter (ED, in cm); average 2011; Worrajinda et al., 2013). artificial irrigation. diameter of five ears of each plot; i) number of grain rows (NR): grain rows Estimates of combining ability of Climate data were collected at a local in five ears of each plot were counted; sweet corn inbred lines obtained using weather station. From the first sowing j) total soluble solids (TSS, in %): diallel analysis have been studied date until havest time, a total rainfall was measured with a digital refractometer, considering different agronomic traits, 305 mm, regular rainfall distribution and using a sample of 0.3 mL juice extracted allowing selecting superior hybrid maximum temperatures from 30 to 36oC from the grain mixture. combinations and understanding and minimum temperatures from 13.2 additive and non-additive genetic to 20.5oC. Total rainfall of the second In the first and second sowing dates, effects when determining these traits sowing date until harvest was 208 mm, stand averages of 20.55 and 20.16 plants (Kwiatkowski et al., 2011; Solomon being the last rain observed 6 days per plot were obtained, respectively, et al., 2012; Rice & Tracy, 2013; before flowering, with a total of only 5 being yields corrected to an optimum Worrajinda et al., 2013). mm, maximum temperatures from 30.8 stand of 20 plants per plot, using the to 38oC and minimum temperatures methodology suggested by Vencovsky Another important element for from 17 to 20.5oC. & Barriga (1992), and extrapolated to breeding is to understand correlation tons per hectare (t ha-1), with a stand of among agronomic traits of interest, since The experimental arrangement was 62500 plants per hectare. this knowledge can help out select more in complete randomized blocks, with efficient selection processes, allowing three replicates and simple row plots, The analyses of variance were selecting different traits simultaneously, 4.00 m long, spacing 0.80 m between performed using program SAS (2002) increasing genetic gains in relation to rows and 0.20 between plants, in two (Statistical Analysis System) and Scott low heritability traits (Entringer et al., sowing dates. & Knott clustering test was performed 2014; Kashiani et al., 2014). using GENES program (Cruz, 2013). Conventional soil preparation Given the above, the aims of this was carried out using plowing and Individual analyses of variance study were to determine potential of harrowing, and agronomic standard for each trait were done with the super sweet corn inbred lines which procedures were carried out according to decomposition of treatment effects on carry the gene brittle-2 for synthesis technical recommendations for the crop. effects of checks, hybrids and contrast of hybrids, identify predominant hybrids vs checks, considering treatment types of gene actions in agronomic In order to avoid possible effects as fixed. Degrees of freedom traits important for breeding and the contaminations by common corn pollen, were decomposed through diallel association among these traits. the experiments were isolated from analysis in general combining ability of other corn plantations. The check groups GI and GII (GCA-I and GCA-II), MATERIAL AND METHODS Tropical Plus, homozygous for the sh2 and specific combining ability (SCA). gene, had its tassels removed before Eighty one super sweet corn hybrids flowering, to avoid the conversion of Griffing method (1956), adapted to were produced, using partial dialled tested hybrids into common corn. partial diallel crosses involving only F1 crosses of two groups of nine S4 inbred generations, was used to obtain effect lines, developed by Universidade Harvest was done manually as the estimates of GCA-I, GCA-II and SCA, Estadual de Londrina (UEL) Corn ears reached kernel milky stage (green using minimum square method (Cruz Breeding Program, homozygous for corn), when the grains of the ear of each et al., 2004). brittle-2 gene. These inbred lines were plot presented 70 to 80% water content, obtained from the backcross among considered a suitable content for in Genotype averages for different elite common corn inbred lines with natura consumption and for canning traits, taken two by two (X and Y), two super sweet corn populations, (Kwiatkowski & Clemente, 2007). were used to estimate phenotypic to introduce bt2 gene, with later self- correlations and, significance of Pearson fertilization. Thus, the inbred lines were The evaluated traits were a) days correlation estimates were evaluated separated into two groups, according to a to flowering (DF, in days): considering using t statistics, at 5% significance. previous knowledge of the performance as flowered plot when 50% of plants of the elite crossbred lines and the showed stigma-style measuring at least RESULTS AND DISCUSSION 1-cm length and one third of tassels releasing pollen; b) plant height (PH, The trials showed adequate in cm): average height of three plants of each plot, measured from ground 279 Hortic. bras., Brasília, v.37, n.3, July - September 2019

LFS Xavier et al. experimental accuracy for most et al. (2012), Rice & Tracy (2013) and ear yield in the second sowing date evaluated traits, when compared to Suzukawa et al. (2018). However, for (Table 2). other experiments with super sweet ear height and ear diameter, Solomon corn (Kwiatkowski et al., 2011; Santos et al. (2012) reported that additive Contrasts between general averages et al., 2014) (Table 1). The average gene action had greater importance in of hybrids and averages of checks were squares for treatments, hybrids and their relation to non-additive effects, and for significant for dehusked ear yield, grain unfolding in GCA-I, GCA-II and SCA, TSS, the authors verified no significant yield, days to flowering, ear height and for the traits evaluated in two sowing difference for GCA and SCA in diallel number of grain rows, in both sowing dates, were significant, with exception crosses evaluated, whereas Yuwono et dates and, for total soluble solids, of “days to flowering” in the second al. (2017) verified significant difference length and diameter of the ears, only sowing date (Table 1). These results of SCA for TSS. in the second sowing date (Table 1). show different performances of the We could also verify superior average evaluated genotypes and that superior In the first sowing season, significant performance of hybrids in relation to hybrid combinations exist, with inbred differences of checks for days to the average of checks for these traits, lines contributing differently for the flowering, plant height and ear diameter with exception of number of grain rows performance of these hybrids, being were observed, but in the second sowing (Table 2). possible to observe superior specific season were significant for dehusked combinations of inbred lines, not just ear yield, total soluble solids, days to The hybrids which more frequently explained by their respective general flowering, ear height, ear diameter and presented better performance for combining abilities (Cruz et al., 2004). number of grain rows, indicating that the productivity and for other traits, in checks did not show uniform behavior relation to the hybrid control, were Significant effects found in GCA for these traits (Table 1). HS37’, HS47’, HS57’, HS64’, HS71’, HS76’, and SCA for all traits, in two sowing HS77’, HS94’ and HS95’ (Table 2). dates, show that both additive and Using Scott-Knott clustering non-additive effects were important for average test, we verified that synthetics Even without artificial irrigation genetic control of studied traits (Table ST0509A and ST2109B showed and lack of rain in the second sowing 1). Similar results for ear yield, grain potential for genetic breeding and season, which led to a sensitive yield, plant height and total soluble being also competitive in relation to the genotype performance reduction, the solids were obtained by Lemos et al. hybrid Tropical Plus for productivity. averages obtained by the selected (2002); Bordallo et al. (2005), Solomon This hybrid check exceeded ST0509A hybrids met the requirements presented for husked ear yield only in the first by Pereira Filho et al. (2002) and Souza sowing date and ST2109B for dehusked et al. (2013): husked ear yield above 12 t ha-1; minimum of 14 grain rows per Table 1. Analyses of variance with respective degrees of freedom (DF), average squares, significance F test and coefficient of variation [CV(%)], for different traits evaluated in two sowing seasons. Londrina, UEL, 2013/2014. Variation DF First sowing season source HEY DEY GY TSS DF PH EH EL ED NR ns ns * ns Checks (C) 2 ns ns ns ns * * ns ns ns * * * * * H vs C 1 * * ns * ns * 4.580* 0.414* 6.439* 36.92* 8.846* 0.153* 8.429* Hybrids (H) 80 39.97* *** * * * 1.583* 0.065* 1.454* 14.19* 0.677 0.027 0.595 GCA (GI) 8 5.324 31.55* 12.430* 10.740* 9.877* 628.4* 471.1* 4.3 3.4 5.5 GCA (GII) 8 11.4 28.72* 6.049* 5.017* 16.760* 3586.2* 1691.6* ns * SCA 64 ns 6.85* 2.207* 2.026* 2.923* 211.8* 137.7* * ns 8.071* Error 158 * 3.113 0.884 1.064 2.034 84.43 68.66 6.331* 16.170* 1.204* CV (%) 6.555* 12.4 20.9 6.0 2.6 4.2 7.6 0.702 4.902* 5.0 2.480 Second sowing season 11.8 Checks (C) 2 * ns * * ns * * * * * H vs C 1 * * * * ns * * 0.220* * Hybrids (H) 61 ** * ns * * 0.129* 0.044* 4.834* GCA (GI) 8 10.270* 2.820* 5.643* 0.0 785.0* 605.1* 0.022 8.348* 3.6 0.954* GCA (GII) 8 4.027* 2.018* 9.891* 0.0 2417.4* 1879.8* 0.541 SCA 45 2.518* 1.011* 1.733* 0.0 237.9* 159.4* 5.5 Error 128 1.041 0.433 1.019 0.036 96.50 65.76 CV (%) 11.2 14.3 5.7 0.4 4.7 7.7 *and ns= significant and non-significant at 0.05 probability using F test, respectively; HEY= husked ear yield (t ha-1); DEY= dehusked ear yield (t ha-1); GY= green corn grain yield (t ha-1); TSS= total soluble solids (%); DF= days to flowering; PH= plant height (cm); EH= ear height (cm); EL= ear length (cm); ED= ear diameter (cm); NR= number of grain rows. 280 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Partial diallel and potential of super sweet corn inbred lines bt2 to obtain hybrids ear; length and diameter of ears above yield and grain yield at green corn stage presented positive correlations with 15 and 3 cm, respectively. presented a strong positive association ear diameter, ear length and number among them. These yield traits also of grain rows (Table 2). Kashiani & Husked ear yield, dehusked ear Table 2. Averages of selected hybrids (HSij), check averages, general average of diallel hybrid, general averages of checks and coefficient of phenotypic correlation, in two sowing seasons (S1 and S2). Londrina, UEL, 2013/2014. Treatments HEY (t ha-1) DEY (t ha-1) GY (t ha-1) TSS (%) DF (days) S1 S2 S1 S2 S1 S2 S1 S2 S1 S2 55c 52b 56b 52b HS37’ 23.40a 15.57a 16.24a 10.53a 5.45b 5.57a 19.3a 17.9a 55c 52b HS47’ 20.99a 14.73a 54c 52b HS57’ 25.72a 14.32a 14.70a 10.53a 5.01b 4.69a 16.6b 17.0b 56b 52b HS64’ 21.82a 14.42a 55c 52b HS71’ 23.16a 15.50a 16.89a 9.33a 6.56a 4.87a 16.7b 17.3b 55c 52b HS76’ 20.83a 14.04a 54c 52b HS77’ 21.58a 13.95a 14.62a 9.94a 4.80b 5.42a 15.3c 16.2b 55c 52b HS94’ 23.89a 15.87a 58a 52b HS95’ 24.01a 15.64a 18.33a 11.86a 6.53a 6.35a 17.8a 18.9a 59a 52b 20.03b 12.47b 62a 59a ST0509A 16.20a 10.25a 4.92b 5.84a 17.7a 18.3a 55.7 52.0 59.4 54.4 15.65a 10.35a 5.30b 5.14a 16.8a 17.4b -0.28* 0.01 16.75a 11.00a 6.72a 5.57a 16.2b 15.9b -0.40* -0.14 -0.28* -0.26* 17.39a 10.73a 7.40a 5.58a 17.0a 17.2b 11.49b 7.10c 3.38c 3.32c 16.8a 18.3a ST2109B 20.59a 11.01b 12.12b 5.65d 3.63c 2.19c 17.6a 17.6b Tropical Plus 20.78a 13.39b 12.72b 7.77c 3.60c 3.02c 16.5b 14.3b Dialled average (m) 20.19 13.35 14.21 9.19 4.54 4.69 17.1 17.9 Check averages 20.47 12.29 12.11 6.84 3.54 2.84 17.0 16.7 Traits Correlations between yield and other traits HEY 1.00 1.00 0.90* 0.87* 0.76* 0.77* -0.16 -0.05 DEY 0.90* 0.87* 1.00 1.00 0.83* 0.90* -0.14 -0.01 GY 0.76* 0.77* 0.83* 0.90* 1.00 1.00 -0.26* 0.11 PH (cm) EH (cm) EL (cm) ED (cm) NR S1 S2 S1 S2 227b 222b S1 S2 S1 S2 S1 S2 15.7a 16.2a 233a 227a 13.7c 14.4a HS37’ 219b 207b 115a 111b 18.2c 16.5b 4.5b 4.2a 14.9b 13.8a HS47’ 225b 217b 15.1b 13.8a HS57’ 233a 233a 115a 110b 19.9a 17.8a 4.7b 4.3a 15.7a 14.9a HS64’ 202c 198c 14.1b 13.3b HS71’ 215b 204c 109b 103b 19.5a 16.1b 4.9a 4.1b 16.0a 13.8a HS76’ 228b 218b 12.7c 13.1b HS77’ 222b 212b 116a 111b 18.5b 15.9b 4.9a 4.4a 14.4b 13.1b HS94’ 232a 209b 14.6b 14.4a HS95’ 223b 218b 124a 127a 20.1a 16.7a 5.1a 4.3a 14.3b 12.9b ST0509A 209c 198c 15.6a 14.9a 216 209 116a 103b 20.3a 17.3a 4.7b 4.1b 14.0 13.4 ST2109B 221 208 14.8 14.1 108b 99c 18.7b 16.3b 4.8a 4.1b Tropical Plus 123a 214a 20.1a 17.5a 5.0a 4.3a Dialled average (m) 123a 104b 20.3a 17.5a 5.1a 4.3a Check averages 127a 121a 18.7b 16.4b 4.6b 4.1b Traits 118a 112b 18.5b 16.3b 4.8a 3.8b HEY 122a 129a 20.0a 15.3b 4.5b 4.0b DEY 108 105 19.1 16.7 4.7 4.1 GY 122 121 19.1 16.0 4.6 4.0 Correlations between yield and other traits 0.23* 0.07 0.26* -0.09 0.33* 0.43* 0.43* 0.56* 0.31* 0.32* 0.18 0.12 0.32* 0.31* 0.10 0.08 0.25* -0.06 0.46* 0.52* 0.50* 0.67* 0.36* 0.19 0.13 -0.08 0.39* 0.42* 0.66* 0.57* *significant at 0.05 probability by t test. Averages followed by same lowercase letters in the column belong to the same group by Scott- Knott test, at 0.05 probability. HEY= husked ear yield (t ha-1); DEY= dehusked ear yield (t ha-1); GY= green corn grain yield (t ha-1); TSS= total soluble solids (%); DF= days to flowering; PH= plant height (cm); EH= ear height (cm); EL= ear length (cm); ED= ear diameter (cm); NR= number of grain rows. Hortic. bras., Brasília, v.37, n.3, July - September 2019 281

LFS Xavier et al. Table 3. Estimates of general combining ability of inbred lines of groups GI (ĝi) and GII (ĝj) for different traits, evaluated in two sowing seasons (S1 and S2). Londrina, UEL, 2013/2014. Traits HEY (t ha-1) DEY (t ha-1) GY (t ha-1) TSS (%) DF (days) S1 S2 S1 S2 S1 S2 S1 S2 S1 General combining ability of inbred lines of group I (ĝi) ĝL1 1.84 0.30 1.34 0.45 0.82 0.17 -1.0 -0.6 -0.1 ĝL2 0.10 -0.10 -0.35 -0.53 0.03 -0.29 0.4 0.7 0.6 ĝL3 0.69 0.81 0.27 0.31 -0.75 0.20 0.9 0.6 -0.3 ĝL4 -1.85 -0.67 -1.83 -0.53 -0.82 -0.66 -0.4 0.0 1.0 ĝL5 -0.94 -1.29 -0.93 -1.18 -0.31 -0.42 0.3 0.1 0.4 ĝL6 0.21 0.03 0.45 0.30 0.39 0.19 -0.9 -0.8 -1.0 ĝL7 -0.04 -0.36 0.97 0.45 0.23 0.09 0.5 0.5 0.2 ĝL8 -1.17 -0.52 -0.96 -0.51 -0.63 -0.03 0.2 -0.4 -0.4 ĝL9 1.16 1.80 1.05 1.24 1.04 0.75 -0.0 -0.1 -0.4 General combining ability of inbred lines of group II (ĝj) ĝL1’ 2.09 0.51 1.88 0.69 0.61 0.36 -0.3 -0.5 0.2 ĝL2’ -0.98 -0.80 -0.35 -0.46 0.09 -0.42 0.3 0.6 1.8 ĝL3’ 0.03 -0.52 -0.07 -0.59 0.16 -0.52 0.2 -0.4 0.7 ĝL4’ -1.62 -0.72 -1.45 -0.58 -0.47 -0.25 -0.5 -0.7 -0.2 ĝL5’ -0.67 -0.06 -0.80 -0.07 -0.23 -0.17 -0.5 0.1 -0.8 ĝL6’ 0.00 0.11 0.31 0.20 -0.38 0.40 0.2 0.4 -0.3 ĝL7’ 1.45 1.03 0.87 0.59 0.80 0.30 -0.4 -0.1 -0.4 ĝL8’ -0.97 0.05 -0.96 -0.04 -0.58 0.20 0.8 1.3 -0.2 ĝL9’ 0.67 0.42 0.58 0.25 0.00 0.10 0.2 -0.6 -0.7 PH (cm) EH (cm) EL (cm) ED (cm) NR S1 S2 S1 S2 S1 S2 S1 S2 S1 S2 General combining ability of inbred lines of group I (gi) ĝL1 -1.8 -6.9 1.9 -4.4 -0.4 -0.1 0.2 0.1 0.7 0.8 ĝL2 2.9 -3.5 -0.7 -0.3 ĝL3 1.7 3.5 -6.3 -11.3 0.3 -0.1 -0.1 -0.1 0.1 0.5 ĝL4 11.2 18.8 -0.1 -0.3 ĝL5 -2.5 -4.6 2.0 2.3 -0.4 -0.3 -0.1 0.0 -0.4 -0.8 ĝL6 -3.3 -0.1 0.5 0.5 ĝL7 -2.2 -0.8 1.2 9.9 -0.2 0.4 -0.1 -0.0 0.5 0.0 ĝL8 -1.1 -2.4 -0.3 -0.2 ĝL9 -4.7 -4.0 -2.7 -3.4 -0.2 -0.8 -0.2 -0.2 -0.4 -0.3 ĝL1’ 22.0 21.9 -6.4 -2.4 -0.2 -0.8 0.0 0.1 0.1 0.3 ĝL2’ 2.0 3.7 0.3 0.4 ĝL3’ -19.8 -21.0 3.2 3.9 0.7 0.5 0.1 0.0 -0.6 -1.0 ĝL4’ 9.6 6.1 -0.6 -0.6 ĝL5’ 1.1 7.5 5.3 3.9 -0.2 -0.2 -0.1 -0.1 0.2 0.5 ĝL6’ -1.0 0.0 -0.3 -0.4 ĝL7’ -1.6 -0.6 1.9 1.5 0.6 1.3 0.2 0.2 1.2 1.2 ĝL8’ -8.6 -10.4 0.0 0.0 ĝL9’ -3.6 -7.1 General combining ability of inbred lines of group II (ĝj) -0.2 -0.5 15.0 18.0 0.4 0.5 0.1 0.0 0.8 3.8 0.3 0.2 0.1 0.1 -8.4 -10.6 0.5 -0.0 0.0 -0.1 9.5 8.1 -0.7 -0.7 -0.1 -0.1 -1.1 1.2 -0.8 -0.8 0.0 0.1 1.3 2.9 0.6 0.5 -0.1 -0.1 -3.0 -4.0 -0.3 -0.3 0.0 0.1 -5.6 -2.2 -0.4 -0.1 -0.0 0.1 -8.5 -17.0 0.5 0.8 -0.1 -0.1 HEY= husked ear yield (t/ha); DEY= dehusked ear yield (t/ha); GY= green corn grain yield (t/ha); TSS= total soluble solids (%); DF= days to flowering; PH= plant height (cm); EH= ear height (cm); EL= ear length (cm); ED= ear diameter (cm); NR= number of grain rows. 282 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Partial diallel and potential of super sweet corn inbred lines bt2 to obtain hybrids Saleh (2010), Entringer et al. (2014) individual hybrid performance (HSij) Science 9: 463-493. and Nardino et al. (2016) also observed (Table 2) and GCA estimations of each positive correlations between husked inbred line (Table 3). The best estimates KASHIANI P; SALEH G. 2010. Estimation of and dehusked ear yield and ear length, of SCA, in two sowing seasons, for genetic correlations on sweet corn inbred lines ear diameter and number of grain yield were observed in eight selected using SAS Mixed Model. American Journal rows per ear. Kashiani & Saleh (2010) hybrids, with an exception of HS77’ of Agricultural and Biological Sciences 5: reported similar results: yield traits which presented negative values of 309-314. were negatively associated with days SCA for yield in the first sowing season. to flowering, showing that higher yield Besides favorable estimates of SCA, for KASHIANI, P; SALEH, G; ABDULLA, NAP; of super sweet corn was associated hybrid seed yield, it is important that at SIN, MA. 2014. Evaluation of genetic with greater values of earliness of these least one hybrid of inbred lines presents variation and relationships among tropical genotypes. high estimates of favorable GCA for sweet corn inbred lines using agronomic traits. yield. Among selected hybrids, only Maydica 59: 275-282. Grain yield is more strongly related HS76’ did not show any inbred lines to dehusked ear yield, with coefficients containing favorable estimates of GCA KWIATKOWSKI, A; CLEMENTE, E. 2007. of determination of 69% and 81%, for yield. Características do milho doce (Zea mays L.) comparing with husked ear yield, para industrialização. Revista Brasileira de 58% and 59%, in the first and second ACKNOWLEDGEMENTS Tecnologia Agroindustrial 1: 93-103. sowing dates, respectively (Table 2). Therefore, as the Brazilian market of ToThe National Council for Scientific KWIATKOWSKI, A; CLEMENTE, E; SCAPIM, super sweet corn intended mainly for and Technological Development (CNPq) CA. 2011. Agronomic traits and chemical the industrialization and production Brazil, for the financial support for this composition of single hybrids of sweet corn. of canned green corn grains, the project; Araucaria Foundation for Social Horticultura Brasileira 29: 531-536. evaluations of yields should be done, Inclusion scholarship granted and to at least, with dehusked ears since they Universidade Estadual de Londrina LEMOS, MA; GAMA, EEG; MENEZES, present more coefficients of correlation, (UEL) for supporting the realization of D; SANTOS, VF; TABOSA, JN. 2002. favoring the indirect selection for grain this work. Avaliação de dez linhagens e seus híbridos yield. However, in order to produce de milho superdoce em um dialelo completo. sweet corn aiming in natura market, REFERENCES Horticultura Brasileira 20: 167-170. evaluation of husked ear yield would be already sufficient. BORDALLO, PN; PEREIRA, MG; AMARAL LUZ, JMQ; CAMILO, JS; BARBIERI, VHB; JÚNIOR, AT; GABRIEL, APC. 2005. Análise RANGEL, RM; OLIVEIRA, RC. 2014. The inbred lines with better estimates dialélica de genótipos de milho doce e comum Produtividade de genótipos de milho doce of general combining ability (ĝi and ĝj) para caracteres agronômicos e proteína total. e milho verde em função de intervalos de for yields were: L1, L3, L6 and L9 (GI) Horticultura Brasileira 23: 123-127. colheita. Horticultura Brasileira 32: 163-167. and L1’, L7’ and L9’ (GII) (Table 3). Among these inbred lines, favorable BRASIL - Ministério da Agricultura, Pecuária NARDINO, M; BARETTA, D; CARVALHO, estimates of GCA were observed in e Abastecimento. 2018. Registro Nacional IR; FOLLMANN, DN; KONFLANZ, VA; L3 for TSS; L1, L6, L9, L7’ and L9’ for de Cultivares – RNC. Available at: http:// SOUZA, VQ; OLIVEIRA, AC; MAIA, LC. flowering and height of plants; L1, L6, www.agricultura.gov.br. Accessed February 2016. Correlações fenotípica, genética e de L7’ and L9’ for ear height; L9, L1’ and 06, 2018. ambiente entre caracteres de milho híbrido da L9 for ear length; L1, L3, L6, L1’ and Região Sul do Brasil. Revista Brasileira de L7’ for number of grain rows (Table CRUZ, CD. 2013. Genes: a software package Biometria 34: 379-394. 3). These favorable estimates of GCA for analysis in experimental statistics and highlighted higher accumulation of quantitative genetics. Acta Scientiarum. PEREIRA FILHO, IA; CRUZ, JC; GAMA, EEG. favorable alleles for these traits (Cruz Agronomy 35: 271-276. 2002. Cultivares de milho para o consumo et al., 2004; Kwiatkowski et al., 2011). verde. In: PEREIRA FILHO, IA. (ed). O In their study on diallels of super sweet CRUZ, CD; REGAZZI, AJ; CARNEIRO, PCS. cultivo do milho verde. Brasília: Embrapa. corn inbred lines, Elayaraja et al. (2014) 2004. Modelos biométricos aplicados ao p.17-27. and Suzukawa et al. (2018) highlighted melhoramento genético. Viçosa: UFV. 315p. that it is difficult to obtain inbred lines RICE, RR; TRACY, WF. 2013. Combining with good general combining ability for ELAYARAJA, K; GADAG, RN; KUMARI, J; ability and acceptability of temperate productivity and total soluble solids, this SINGODE, A; PAUL, D. 2014. Analysis of sweet corn inbreds derived from exotic trend being observed in this study, with combining ability in experimental hybrids of germplasm. Journal of the American Society an only exception of L3 inbred line. sweet corn (Zea mays var. saccharata). Indian for Horticultural Science 138: 461-469. Journal of Genetics and Plant Breeding 74: SCA (sij) can be estimated for a 387-391. SANTOS, PHAD; PEREIRA, MG; TRINDADE, given trait through the model sij = HSij RS; CUNHA, KS; ENTRINGER, GC; - (m+gi+gj) using estimates of general ENTRINGER, GC; SANTOS, PHAD; VETTORAZZI, JCF. 2014. Agronomic average of diallel hybrids (m), average VETTORAZZI, JCF; CUNHA, KS; performance of super-sweet corn genotypes PEREIRA, MG. 2014. Correlação e análise in the north of Rio de Janeiro. Crop Breeding de trilha para componentes de produção de and Applied Biotechnology 14: 8-14. milho superdoce. Revista Ceres 6: 356-361. SAS INSTITUTE. 2002. Getting started with the GRIFFING, BA. 1956. Concept of general and SAS learning edition. Cary: SAS Institute. specific combining ability in relation to diallel 200p. crossing systems. Australian Journal Biology SOLOMON, KF; ZEPPA, A; MULUGETA, SD. Hortic. bras., Brasília, v.37, n.3, July - September 2019 2012. Combining ability, genetic diversity and heterosis in relation to F1 performance of tropically adapted shrunken (sh2) sweet corn lines. Plant Breeding 131: 430-436. SOUZA, RS; VIDIGAL FILHO, PS; SCAPIM, CA; MARQUES, OJ; QUEIROZ, DC; OKUMURA, RS; RECHE, DL; CORTINOVE, VB. 2013. Produtividade e qualidade do milho doce em diferentes populações de plantas. Semina: Ciências Agrárias 34: 995-1010. SUZUKAWA, AK; PEREIRA, CB; GARCIA, MM; CONTRERAS-SOTO, RI; ZEFFA, DM; COAN, AMD; SCAPIM, CB. 2018. Diallel 283

LFS Xavier et al. analysis of tropical and temperate sweet and VENCOVSKY, R; BARRIGA, P. 1992. Genética Journal of Breeding and Genetics 45: 468-477. supersweet corn inbred lines. Revista Ciência biométrica no fitomelhoramento. Revista Agronômica 49: 607-615. Brasileira de Genética 365p. YUWONO, PD; MURTI, RH; BASUNANDA, P. 2017. Heterosis and specific combining TEIXEIRA, FF; MIRANDA, RA; PAES, WORRAJINDA, J; LERTRAT, K; SURIHARN, ability in sweet corn and its correlation with MCD; SOUZA, SM; GAMA, EEG. 2013. B. 2013. Combining ability of super sweet genetic similarity of inbred lines. Journal of Melhoramento do milho-doce. Documentos/ corn inbred lines with different ear sizes for Agricultural Science 9: 246-253. Embrapa Milho e Sorgo 154: 12-15. ear number and whole ear weight. SABRAO 284 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Research AZEVEDO, CDO; RODRIGUES, R; SUDRÉ, CP. 2019. Microsatellites for detecting inconsistencies in Capsicum cultivars registration in Brazilian database: more than meets the eye. Horticultura Brasileira 37: 285-293. DOI - http://dx.doi.org/10.1590/S0102-053620190306 Microsatellites for detecting inconsistencies in Capsicum cultivars registration in Brazilian database: more than meets the eye Carlos Diego de O Azevedo 1ID; Rosana Rodrigues 1ID; Cláudia P Sudré 1ID 1Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos dos Goytacazes-RJ, Brasil; carlosdiego_oliveira@yahoo. com.br; [email protected]; [email protected] ABSTRACT RESUMO In Brazil, cultivars are registered by National Register of Microssatélites na detecção de inconsistências no registro de Cultivars (RNC), which besides enabling commercialization cultivares de Capsicum em banco de dados brasileiro: além do of cultivar propagative material, also guarantees the producers que o olho pode ver genetic purity and identity of propagules. However, it is possible that the information about registration and commercialization of No Brasil, o registro de cultivares é feito com cadastramento no some cultivars is inaccurate. This study aims to analyze the use of Registro Nacional de Cultivares (RNC), o qual, além de habilitar a microsatellite markers to detect inconsistencies in data of Capsicum comercialização do material propagativo da cultivar, garante ao pro- spp. cultivars obtained from the official database (CultivarWeb). dutor pureza e identidade genética dos propágulos. Mas, é possível Seven cultivars were evaluated, three of them were through genetic que as informações fornecidas para o registro e comercialização das identity analysis (Amarela Comprida, De Cayenne and Cayenne Long cultivares estejam imprecisas. Este trabalho relata o uso de marca- Slin) and the others were used as standard for the species C. annuum, dores microssatélites na detecção de inconsistências nos dados de C. frutescens and C. chinense. Thirty-three microsatellite loci were cultivares de Capsicum spp. no banco de dados oficial (CultivarWeb). polymorphic and presented 76 alleles (an average of 2.3 alleles/ Sete cultivares foram avaliadas, sendo três em análise de identidade locus). Fixation Index (F) showed high homozygosis and estimators genética (Amarela Comprida, De Cayenne e Cayenne Long Slin) e of genetic diversity (Ho and I) presented low genetic diversity among as demais foram referência para as espécies C. annuum, C. frutescens cultivars. The molecular analysis, represented in a dendrogram and e C. chinense. Trinta e três locos microssatélites foram polimórficos in Principal Coordinate Analysis Chart (PCOA), showed that the e apresentaram 76 alelos (média de 2,3 alelos/loco). O Índice de investigated cultivars belong to C. annuum, contrary to what is Fixação (F) apontou alta homozigose e os estimadores de diversida- registered in CultivarWeb, which indicates that such cultivars belong de genética (Ho e I) revelaram baixa diversidade genética entre as to the species C. frutescens. Thus, the authors recommend that the cultivares. A análise molecular, representada no dendrograma e no data in the CultivarWeb should be checked and enhanced. gráfico da Análise de Coordenadas Principais (PCOA), mostrou que as cultivares investigadas são da espécie C. annuum, ao contrário do que consta registrado no CultivarWeb, que informa a espécie das referidas cultivares como C. frutescens. Recomenda-se, portanto, que a checagem dos dados inseridos no CultivarWeb seja aprimorada. Keywords: Capsicum spp., microsatellites, registered cultivars. Palavras-chave: Capsicum spp., microssatélites, cultivares registradas. Received on November 16, 2018; accepted on July 5, 2019 Registro Nacional de Cultivares distinct, homogeneous and stable, have varietal quality of cultivars, protects the [(RNC) National Register of an identified value of cultivation and improved cultivars against degradation Cultivars] is responsible for, previously, use (VCU). due to mechanical mixing, crossbreeding, qualifying cultivars and species, for name or denomination changes and production and marketing of seeds and Registration of a cultivar is an other accidental occurrences (Carvalho seedlings in the Country, regardless of important tool to protect both farmers et al., 2009). the group to which they belong, such and breeders. Cultivar registration as forest, forage, fruit, large crops, ensures that farmers do not buy seeds RNC was established by the vegetables and ornamentals. RNC and seedlings which are not evaluated Ministerial Order No. 527, of December aims to regulate the use of cultivars according to edaphoclimatic conditions 31, 1997, by Ministério de Agricultura, with significant potential for national in Brazil. Considering breeders and Pecuária e Abastecimento [(MAPA) agriculture which, besides being breeding program, cultivar registration, Ministry of Agriculture, Livestock and besides ensuring the genetic identity and Food Supply]. Later, in the early 21st Hortic. bras., Brasília,v.37, n.3, July - September 2019 285

CDO Azevedo et al. century, RNC became governed by the agronomic traits indicate that such Then, leaf samples were collected for Law No. 10.711, of August 5, 2003, and cultivars actually belong to Capsicum DNA extraction. In order to check regulated by Decree No. 5,153, July 23, annuum. homozygous level of the sampled 2004. Ever since, RNC has been under cultivars and the genetic purity of the the responsibility of Coordenação de Molecular markers, mainly the seeds, each cultivar was represented by Sementes e Mudas [(CSM) Seeds and microsatellite markers, are useful tools to a bulk composed of five plants. Seedlings Coordination], Departamento characterize Capsicum spp. germplasm de Fiscalização de Insumos Agrícolas and other species of vegetables. DNA extraction [(DFIA) Department of Agricultural Moreover, an application of molecular Inputs Inspection], Secretaria de Defesa characterization, which is in expansion, For DNA extraction, leaf samples Agropecuária [(DAS) Secretariat of consists of using the characterization of each one of seven cultivars and, Agricultural Defense] of Ministério de to test or prove the identity and genetic approximately, 300 mg leaf tissue was Agricultura, Pecuária e Abastecimento purity of commercial cultivars for macerated and transferred into 1.5 μL (Ministry of Agriculture, Livestock and intellectual property and for advocacy tubes and immersed in liquid N2 for Supply). of breeder or maintainer. Regarding the DNA extraction according to Doyle & security and protection of intellectual Doyle protocol (1990). Therefore, according to the enactment property rights, studies of molecular of current legislation, to produce and characterization of pumpkin (Sim et al., DNA was quantified using Qubit 3.0 commercialize seeds, seedlings and 2015), potato (Favoretto et al., 2011), fluorometer (Invitrogen). Afterwards, other propagative structures in Brazil, pepper and sweet pepper (Kumar et al., samples were diluted and standardized the producer/breeder, duly registered 2001; Kwon et al., 2005) cultivars can at 5 ng μl-1 to be submitted to polymerase in RENASEM (National Register of be found. chain reactions (PCR). Seeds and Seedlings), should submit the cultivar to Value for Cultivation and The aim of this study was to use Amplification reactions Use (VCU) testing, before applying for microsatellite markers to characterize cultivar registration in RNC (Law No. Capsicum spp. genotypes, in order to Eighty microsatellite markers 10.711/2003). check at DNA level, which species available in literature (Lee et al., of genus Capsicum spp. belongs, 2004; Minamiyama et al., 2006; Yi Through a database maintained specifically the genotypes represented et al., 2006) were selected based on on its website, called CultivarWeb, by the cultivars Amarela Comprida, De information about polymorphism level, the Ministério de Agricultura, Cayenne and Cayenne Long Slin and, specificity for C. annuum and position Pecuária e Abastecimento [(MAPA) solve issues of available information in the genome (Table 1). Ministry of Agriculture, Livestock on Cultivarweb related to the species and Supply] allows to visualize the of these cultivars. The authors decided to use cultivars registered in Brazil according microsatellite markers due to constant to genus or species of interest. In MATERIAL AND METHODS recommendation in International Union June 2019, the system indicates that for the Protection of New Varieties of 39,331 cultivars were registered in the Germplasm Plants (UPOV, 2010). Country. However, as the available Seven cultivars were used in trials information is obtained by formal for molecular characterization: UENF Amplification reactions were declaration from the maintainer through Campista, Cascadura Ikeda, Amarela prepared in 13 µL final volume, the cultivar application documentation, Comprida, De Cayenne, Cayenne Long containing reagents: 0.12 μL Taq DNA some inaccuracies or inconsistencies Slin, Malagueta and UENF 2154. polymerase, 1.3 μL 10x buffer (500 mM may occur. KCl, 100 mM Tris-HCl, pH 8.3), 1.0 μL Cultivars UENF Campista and 25 mM MgCl2 1.5 μL dNTP (0.1 mM This study was carried out since a Cascadura Ikeda were used as standards of each of the deoxyribonucleotides), suspicion of inconsistency arose. This for Capsicum annuum species, since 1.0 μL of 5 Mm primer and 6.08 μL of was regarding the species information there is no doubt they belong to this ultrapure water. attributed to three cultivars: Amarela species. Cultivar Malagueta and UENF Comprida, De Cayenne and Cayenne 2154 were used as standards for C. Then, the reactions were conducted Long Slin, which would be used in a frutescens and C. chinense species, in a thermocycler model Veriti, Applied DNA fingerprinting assay with cultivars respectively. Biosystems, following: 4 min at 94°C developed by Capsicum spp. breeding for initial denaturation; 38 cycles program at Universidade Estadual Plants were grown for 45 days in including 94°C for 1 min, 52-60°C for do Norte Fluminense Darcy Ribeiro 500 mL pots in a greenhouse at Unidade 1 min (depending on primer used), 72°C (UENF). The suspicion is due to the de Apoio à Pesquisa of Campus Leonel for 3 min; and a final extension at 72ºC fact that both in seed packaging and in Brizola from Universidade Estadual for 7 min. official database (CultivarWeb) these do Norte Fluminense Darcy Ribeiro, cultivars are presented as belonging in the municipality of Campos dos Amplified DNA fragments were to Capsicum frutescens, however, the Goytacazes, Rio de Janeiro, Brazil. separated in high resolution agarose gel concentrated at 4% by a horizontal 286 electrophoresis system. The PCR products, before being electrophoresed, Hortic. bras., Brasília, v.37, n.3, July - September 2019

Microsatellites for detecting inconsistencies in Capsicum cultivars registration in Brazilian database: more than meets the eye were stained with Blue Juice and belong to autogamous species and are the carrier of the largest number of Gel Red (1:1) solution. Then, the genetically closely related. private alleles tends to be the most gels were submitted to ultraviolet genetically distant from the others of light photocumentation (Minibis Pro Considering the values of genetic the same species, genus or population. Photocumenter - Bio-imaging System). diversity estimates (Ho and I), the authors noticed that the genetic diversity Considering the analysis of private Afterwards, only polymorphic among the accessions can be considered alleles, we observed great genetic microsatellites markers for the material medium, which corroborates the fact divergence among cultivars which under evaluation were used for the that these evaluated genotypes are admittedly belong to the species C. elaboration of numerical spreadsheet autogamous species belonging to frutescens and C. chinense, respectively, based on the pattern of the bands the same gene complex (C. annuum ‘Malagueta’ and UENF 2154, cultivars observed in the gel images. complex). This complex comprises C. Amarela Comprida, De Cayenne and annuum, C. frutescens, C. chinense Cayenne Long Slin, as well as the Data analysis and C. chacoense. Therefore, loci cultivars used as standard for C. annuum were expected to tend to lower level of species (‘Cascadura Ikeda’ and ‘UENF At beginning, the authors used polymorphism and, as a result, to find Campista’). programs GenAlEx (Peakall & Smouse, low level of genetic diversity among 2012) and PowerMarker (Liu & Muse, cultivars of different species and among Due to an expressive number of 2005) for math determination of the cultivars of the same species. private alleles which were detected following genetic diversity estimators through genotype, these markers can be for the evaluated accessions: number The values observed in Fixation recommended for studies on molecular of alleles, number of effective alleles, Index (F) (F = -0.750 to 1.000) show characterization of Capsicum ssp. number of loci with private alleles medium to high homozygosis of accessions, or for other trials aiming to per access; fixation index; observed cultivars per se considering investigated obtain DNA fingerprints. heterozygosity and Shannon’s Index. loci. The authors highlight that Fixation Index (F) may show values from The analysis of genetic diversity Then, genetic diversity analysis -1 to +1. Values close to zero show among accessions generated among cultivars was performed using random crossings; negative values a dissimilarity matrix, in which a Genes program (Cruz, 2013), data show excess of heterozygosity, due correlation of 0.99 with cophenetic were processed by complement of the to heterozygous selection and biased value matrix was verified. The closer weighted similarity index. This analysis mating between similar phenotypes; the value of the cophenetic correlation generated a matrix with measures of finally, high positive values show high coefficient (CCC) is to 1, the smaller the dissimilarity between genotypes, which inbreeding (Peakall & Smouse, 2012). individual cluster distortion using the was used for clustering analysis by In addition, we might infer that Fixation UPGMA method (Silva & Dias, 2013). hierarchical method of medium group Index still corresponds to an estimate Thus, the high value of the cophenetic bonding [(UPGMA) Unweighted Pair of differentiation between and among correlation coefficient observed Group Method with Arithmetic Means] cultivars, as well as promote diagnosis corresponds to a high consistency and using Genes program and Principal of the variability of each locus in reliability of clusterings observed in the Coordinate Analysis in the GenAlEx terms of the level of homozygosis or dendrogram. Program. heterozygosis. Using the dissimilarity matrix, RESULTS AND DISCUSSION In another analysis, the authors a dendrogram was generated by the noticed private alleles (Ap) for each clustering analysis performed using Among 80 microsatellites markers cultivar among the evaluated loci. ‘De MEGA software applying UPGMA tested, only 33 showed polymorphism Cayenne’ showed the largest number method. Three groups of cultivars for the evaluated material; for this of private alleles (Ap = 18), whereas were formed (Figure 1) which are reason, only these markers were ‘Malagueta’ showed the lowest number reunited considering the species. computed and used for data analysis of private alleles (Ap = 6) (Table 3). The establishment of the groups was (Table 2). C. annuum cultivars showed a number done subjectively, based on the sharp of private alleles much superior to changes in levels, associated with prior These 33 analyzed microsatellites the observed for C. frutescens and C. knowledge of the material under study. markers generated 76 alleles (Na), chinense. showing an average of 2.3 alleles per The first group consisted of cultivars locus. This result is due to the fact that The detection of private alleles, related to C. annuum: UENF Campista, the evaluated genotypes are inbred lines besides being an indicator of the Cascadura Ikeda, Amarela Comprida, at a high level of homozygosis. The occurrence or not of gene flow, reflects De Cayenne and Cayenne Long Slin. number of effective alleles (Ne) ranged the level of genetic relationship between The composition of the first group from 1.153 (CAMS-451) to 3.000 the evaluated accessions or populations was expected, since cultivars UENF (Hpms E016), with an average of 1.691. (Szpiech & Rosenberg, 2011). Thus, the Campista and Cascadura Ikeda were These values are in accordance to what greater the number of private alleles, the used as standard for C. annuum and due is expected when investigated genotypes lower the gene flow and, consequently, to the hypothesis that cultivars Amarela Comprida, De Cayenne and Cayenne Hortic. bras., Brasília, v.37, n.3, July - September 2019 287

CDO Azevedo et al. Long Slin also belong to this species. Clustering analysis, specifically of these cultivars in CultivarWeb (data bank), but, in fact, they belong to C. Cultivar Malagueta was the only one regarding the composition of the first annuum. which represented the second group, used group, proves that cultivars Amarela In Principal Coordinate Analysis (PCOA) (Figure 2), cultivars were as standard for C. frutescens. The third Comprida, De Cayenne and Cayenne distributed and clustered in three group consisted only of cultivar UENF Long Slin do not belong to C. frutescens, 2154, belonging to C. chinense. as it can be found on information board Table 1. Microsatellite markers specific for Capsicum spp. used. Campos dos Goytacazes, UENF, 2017. Loci Forward primer (5’-3’) Reverse primer Linking Source group Lee et al. 2004 Hpms 1–1* F tcaacccaatattaaggtcacttcc R ccaggcggggattgtagatg 1 Lee et al. 2004 Lee et al. 2004 Hpms 1–3 F tgggaaataggatgcgctaaacc R aactttaagactcaaaatccataacc 9 Lee et al. 2004 Lee et al. 2004 Hpms 1–5 F ccaaacgaaccgatgaacactc R gacaatgttgaaaaaggtggaagac 6 Lee et al. 2004 Lee et al. 2004 Hpms 1–41 F gggtatcatccgttgaaagttagg R caagaggtatcacaacatgagagg 1 Lee et al. 2004 Lee et al. 2004 Hpms 1–43 F aaccagcaatcccatgaaaacc R gggctttggggagaatagtgtg 1 Lee et al. 2004 Lee et al. 2004 Hpms 1–62 F catgaggtctcgcatgatttcac R ggagaaggaccatgtactgcagag 1 Lee et al. 2004 Lee et al. 2004 Hpms 1–69 F cggtggcatgtagtttctggag R aagacatgaaatccacaagttttc 4 Lee et al. 2004 Lee et al. 2004 Hpms 1–117 F acccaaatttgccttgttgat R aatccataaccttatcccataaa 9 Lee et al. 2004 Lee et al. 2004 Hpms 1–139 F ccaacagtaggacccgaaaatcc R atgaaggctactgctgcgatcc 1 Lee et al. 2004 Lee et al. 2004 Hpms 1–148 F ggcggagaagaactagacgattagc R ccacccaatccacatagacg 1 Lee et al. 2004 Lee et al. 2004 Hpms 1–155 F acgaggcccaagctgttatgtc R ttgtcccgactctccattgacc 1 Lee et al. 2004 Lee et al. 2004 Hpms 1–165 F ggctatttccgacaaaccctcag R ccattggtgttttcactgttgtg 4 Lee et al. 2004 Lee et al. 2004 Hpms 1–168 F gccccgatcaatgaatttcaac R tgatttttgggtggagagaaaacc 16 Lee et al. 2004 Lee et al. 2004 Hpms 1–172 F gggtttgcatgatctaagcatttt R cgctggaatgcattgtcaaaga 11 Lee et al. 2004 Lee et al. 2004 Hpms 1–173 F tgctgggaaagatctcaaaagg R atcaaggaagcaaaccaatgc 3 Lee et al. 2004 Lee et al. 2004 Hpms 1–214 F tgcgagtaccgagttctttctag R ggcagtcctgggacaactcg 1 Lee et al. 2004 Lee et al. 2004 Hpms 1–216 F tgcttgttgtttttaccctcagc R agtgaaaggtgggcaacagc 7 Lee et al. 2004 Lee et al. 2004 Hpms 1–227 F cgtggcttcaagtatggactgc R ggggcggaacttttcttatcc 7 Lee et al. 2004 Lee et al. 2004 Hpms 1–274 F tcccagacccctcgtgatag R tcctgctccttccacaactg 7 Hpms 1–281 F tgaggcagtggtatggtctgc R cccgagttcgtctgccaatag 1 Hpms 2–2 F gcaaggatgcttagttgggtgtc R tcccaaaattaccttgcagcac 11 Hpms 2–13 F tcacctcataagggcttatcaatc R tccttaaccttacgaaaccttgg 1 Hpms 2–21 F tttttcaattgatgcatgaccgata R catgtcattttgtcattgatttgg 10 Hpms 2–23 F ccctcggctcaggataaatacc R ccccagactcccactttgtg 5 Hpms 2–24 F tcgtattggcttgtgatttaccg R ttgaatcgaatacccgcaggag 9 Hpms 2–26 F gggatgtaggaacaaccctaacc R tgcatcttttcttcatcccctttc 1,3,5 Hpms 2–45 F cgaaaggtagttttgggcctttg R tgggcccaatatgcttaagagc 5 HpmsAT2–14 F tttagggtttccaactcttcttcc R ctaaccccaccaagcaaaacac 4 HpmsAT2–20 F tgcactgtcttgtgttaaaatgacg R aaaattgcacaaatatggctgctg 6 HpmsCaSIG19 F catgaatttcgtcttgaaggtccc R aagggtgtatcgtacgcagcctta 7 HpmshpMADS F tgctttcaaaacaatttgcatgg R vgcgtctaatgcaaaacacacattac 1 CACCEL1 F ctctaataggcaatagctcacatgc R gcagtctcccagaacgttgtcc 1 AA840689 F gacaacataggcggacctttgg R tgctttaggtctacgtccttgcac 3 AA840692 F tggaagtgattactggaaaccatgc R ggggtttagtcatggaatcttttgc 3 AA840721 F cactttgatacgtgaacacttcc R agtttgcactggtcctgctc 7 AF242731 F gggctgacggccattaagaac R cagacagctagaaagagaggaattctg 16 AF244121 F tacctcctcgccaatccttctg R ttgaaagttctttccatgacaacc 1,3 288 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Microsatellites for detecting inconsistencies in Capsicum cultivars registration in Brazilian database: more than meets the eye Table 1. continuation Loci Forward primer (5’-3’) Reverse primer Linking Source group CAN010950 F gattttggtggcagaagaattgg R tgcactttcgaagcaaacaaacc 1 Lee et al. 2004 AF208834 F tgcaccaaggtccagtaaggttg R ccaaccaccatggttcatacaag 6 Lee et al. 2004 HpmsE001 F tgccacccataaaattcttaaacca R tgcaagatcccaaattgaaatga 2 Yi et al. 2006 HpmsE003 F tttctgcaattccccttgttca R cagcagagccttcagtagcagc 2 Yi et al. 2006 HpmsE004 F tgggaagagaaattgtgaaagca R caatgccaacaatggcatccta 1 Yi et al. 2006 HpmsE005 F tgcctcagtttcccaaccct R accaacaccgtaacgcaccc 3 Yi et al. 2006 HpmsE006 F gctgaccgttttcgttttggg R caaaattcaaccgcaccaaca 4 Yi et al. 2006 HpmsE007 F ccccatttccccttcccata R gaggggtcatgttgaaggcaa 9 Yi et al. 2006 HpmsE008 F ccccttaacttttaattctagatctgc R tcgttgttcctccatcacctca 3 Yi et al. 2006 HpmsE009 F tgcacaaacatcatacacctca R cccatgactgatagtccgggtc 2 Yi et al. 2006 HpmsE010 F ctgtttgccaatcaccatcagg R gctattttccggcgtgtgagag 3 Yi et al. 2006 HpmsE011 F gcagaagaccaaagccctagca R tggtttccattgtcactgtatgc 6 Yi et al. 2006 HpmsE012 F aaacgctgaaaaaggcgttgac R tgcaccaacttcttccatgcac 11 Yi et al. 2006 HpmsE013 F gcgccaagtgagttgaattgat R caccaatccgcttgctgttgta 10 Yi et al. 2006 HpmsE014 F ctttggaacatttctttggggg R gcggacgtagcagtaggtttgg 6 Yi et al. 2006 HpmsE015 F ttgtgagggtttgacactggga R ccgagctcgatgaggatgaact 5 Yi et al. 2006 HpmsE016 F ccaagttcaggcccaggagtaa R tgcagagaagactcaccagtcc 3 Yi et al. 2006 HpmsE019 F aagtcatcagctgcaaagacca R ttcaacatgcatccagcttctt 1 Yi et al. 2006 HpmsE020 F cccccgagaggaacagaatcat R ttccattttggtccagctacca 7 Yi et al. 2006 HpmsE021 F cacactaagcattctgctttcaca R ggagggaatagtagcggtttgga 1 Yi et al. 2006 HpmsE022 F gcaccagcatcaacatcagcat R cagcaggtgaaggacttgcaga 1 Yi et al. 2006 HpmsE023 F tttaacacctctctaaccgtcacc R gcgatttcagcccatcaacaat 11 Yi et al. 2006 HpmsE024 F cgagcctaaccacccaaatcag R aagggaacggagggacgactac 12 Yi et al. 2006 HpmsE025 F tgagcatcccgttatctcaaatca R cccaattcttcaggcaatctcc 9 Yi et al. 2006 HpmsE026 F ccaaagtccatcgacgtctcaa R atcaaatggcaaaccaggagga 1 Yi et al. 2006 HpmsE027 F tggagaattggtgttacatgaagg R ttcggacccttctccatcactt 1 Yi et al. 2006 HpmsE029 F gatggagaagatcgccgacaag R tacatcagcaggtttgcctcca 1 Yi et al. 2006 HpmsE030 F gaagcaggggccagagctaga R gcccccaattctcaaacagaga 3 Yi et al. 2006 HpmsE031 F ccctaaatcaaccccaaattcaa R cccccattacctgactgcaaaa 10 Yi et al. 2006 HpmsE033 F tggatcctcctttctacttcaaca R aagggtggtgaaaaggggattt 1 Yi et al. 2006 CAMS-156 F ccctatgctttcacaactcct R gacgtggttatgacgataggc 10 Minamiyama et al. 2006 CAMS-215 F cgtgggtggtctaggatgat R gctggcaagtcactctggat 7 Minamiyama et al. 2006 CAMS-311 F ggtgcgctagagatggagag R tttgagtgttcgggactggt 6 Minamiyama et al. 2006 CAMS-340 F tttatgcccattcacaaaataa R ggacgaattcaccgagtgc 10 Minamiyama et al. 2006 CAMS-398 F atggtccatggtcagcagat R gggcagaacagtggatgatt 7 Minamiyama et al. 2006 CAMS-405 F ttcttgggtcccacactttc R aggttgaaaggagggcaata 11 Minamiyama et al. 2006 CAMS-424 F tccacagcccacagtgtcta R gcttgtggttccgtgatttt 6 Minamiyama et al. 2006 CAMS-451 F tgcattggtgggctaacata R gctcttgacacaaccccaat 11 Minamiyama et al. 2006 CAMS-460 F cctttcacttcagcccacat R accatccgctaagacgagaa 7 Minamiyama et al. 2006 CAMS-606 F gactagtccccgttcaacca R tttgcgagaagatgcttcag 7 Minamiyama et al. 2006 CAMS-811 F gaagaaacgaaggatgaacaaaa R cctgtttcctcttcctcagc 9 Minamiyama et al. 2006 CAMS-844 F gcaaagaaaaagaaaagcctga R ctgcaactgctgcttcattc 1 Minamiyama et al. 2006 CAMS-855 F aagtgtcaaggaaggggaca R cctaaccacccccaaaagtt 8 Minamiyama et al. 2006 Hortic. bras., Brasília, v.37, n.3, July - September 2019 289

CDO Azevedo et al. groups according to genetic relationship because it is recognized in literature the misspelling in writing the word slim and, consequently, according to their that cayenne or cayenne peppers belong (thin in thickness, physically thin) in the respective species. Variation percentage exclusively to the species C. annuum name of cultivar Cayenne Long Slin. In explained by axes 1 and 2 were, (Barbero et al., 2014). Specifically, addition, cultivar Amarela Comprida, respectively, 83.70% and 11.96%. when comparing the Cayenne Long although registered as belonging to C. This result justifies that approximately Slin and Cayenne Long Slim cultivars, frutescens, is recognized and marketed 95% of all variability contained in the the question remains whether there is a as belonging to C. annuum (Pimentas evaluated genotypes can be explained difference between them or not, besides artesanais, 2017). by the two-dimensional plane with low level of information distortion. Cultivars Table 2. Data analysis of microsatellite loci for Capsicum spp. cultivars in relation to number Amarela Comprida, De Cayenne and of alleles (Na), number of effective alleles (Ne), Shannon Index (I), observed heterozygosity Cayenne Long Slin are genetically (Ho) and Fixation Index (F). Campos dos Goytacazes, UENF, 2017. closer than the cultivars used as standard for C. annuum than the cultivars which Loci Na Ne I Ho F represent C. frutescens and C. chinense Hpms 11 2.000 1.508 0.520 0.143 0.576 species (respectively, Malagueta and Hpms 13 2.000 1.690 0.598 1.000 UENF 2154). Hpms 15 3.000 1.342 0.509 0 0.440 Hpms 141 2.000 1.690 0.598 0.143 1.000 In some studies on morphological Hpms 143 2.000 1.960 0.683 1.000 characterization, a differentiation Hpms 162 2.000 1.849 0.652 0 0.689 among genotypes of different Capsicum Hpms 1117 3.000 1.556 0.656 0 0.600 species can be obtained (Campos et al., Hpms 1139 2.000 1.960 0.683 0.143 -0.750 2016). Thereunto, morphological and Hpms 1148 3.000 1.815 0.796 0.143 0.364 agronomic descriptors proposed for Hpms 1173 2.000 1.690 0.598 0.857 1.000 Capsicum by IPGRI (International Plant Hpms 1216 2.000 1.324 0.410 0.286 1.000 Genetic Resources Institute, renamed Hpms 1281 2.000 1.690 0.598 0 1.000 Biodiversity International) were used. Hpms 221 3.000 2.178 0.876 0 -0.585 However, this methodology requires Hpms AT214 2.000 1.690 0.598 0 1.000 more time and resources than the use Hpms AT220 2.000 1.690 0.598 0.857 1.000 of molecular markers. Hpms hpMADS 2.000 1.690 0.598 0 1.000 AA840692 2.000 1.324 0.410 0 1.000 Results obtained in these studies AF242731 2.000 1.960 0.683 0 1.000 show a probable inaccuracy in identifying Hpms E003 2.000 1.324 0.410 0 1.000 tested cultivars (Amarela Comprida, De Hpms E004 2.000 1.690 0.598 0 1.000 Cayenne and Cayenne Long Slin) in Hpms E007 2.000 1.690 0.598 0 1.000 relation to the species in CultivarWeb Hpms E009 2.000 1.324 0.410 0 1.000 database bank. And it is still worse Hpms E014 3.000 2.333 0.956 0 1.000 when one searched on the platform Hpms E016 3.000 3.000 1.099 0 1.000 CultivarWeb using the expression CAMS-215 3.000 1.412 0.566 0 0.429 “Cayenne long”, two different results CAMS-340 2.000 1.471 0.500 0 1.000 can be found, apparently, in relation CAMS-398 3.000 2.178 0.876 0.167 -0.585 to different cultivars: In one result, the CAMS-424 2.000 1.690 0.598 0 1.000 cultivar Cayenne Long Slin is associated CAMS-451 2.000 1.153 0.257 0.857 -0.077 with C. frutescens species (this cultivar CAMS-460 2.000 1.324 0.410 0 1.000 was evaluated in this study), whereas the CAMS-606 2.000 1.508 0.520 0.143 0.576 second result presents cultivar Cayenne CAMS-811 3.000 1.556 0.656 0 0.200 long Slim as related to C. annuum CAMS-855 3.000 1.556 0.656 0.143 0.600 species. When restricting the search Total 76.000 55.811 0.286 to keyword “Cayenne”, seven results Average 2.303 1.691 --- 0.143 --- are displayed; these are distributed 0.611 --- 0.681 in C. frutescens (cultivars Ardida 0.130 Cayenne, Ardida Vermelha Cayenne, Cayenne, Cayenne Long Slin and De Cayenne) and C. annuum (cultivares Cayenne Long Slim and Dedo de Moça – Cayenne). Search results on CultivarWeb, as considered in previous paragraphs, show incorrect information, principally 290 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Microsatellites for detecting inconsistencies in Capsicum cultivars registration in Brazilian database: more than meets the eye Table 3. Private alleles (Ap) detected by microsatellite for each C. anuum, C. frutescens and C. chinense cultivar. Campos dos Goytacazes, UENF, 2017. Cultivar Ap Private alleles per loci UENF Hpms 13; Hpms 141; Hpms 143; Hpms 162; Hpms 1148; Hpms 1173; Hpms 1281; Hpms Campista 16 221; Hpms AT214; Hpms AT220; Hpms hpMADS; AF242731; Hpms E004; Hpms E014; CAMS-398; CAMS-424. Cascadura Hpms 13; Hpms 141; Hpms 162; Hpms 1148; Hpms 1173;Hpms 1281; Hpms 221; Hpms Ikeda 15 AT214; Hpms AT220; Hpms hpMADS; AF242731; Hpms E004; Hpms E014; CAMS-398; CAMS-424. Amarela Hpms 13; Hpms 141; Hpms 162; Hpms 1148; Hpms 1173; Hpms 1281; Hpms 221; Hpms Comprida 16 AT214; Hpms AT220; Hpms hpMADS; AF242731; Hpms E004; Hpms E014; CAMS-340; CAMS-398;CAMS-424. De Hpms 13; Hpms 141; Hpms 143; Hpms 162; Hpms 1148;Hpms 1173; Hpms 1281; Hpms 221; Cayenne 18 Hpms AT214; Hpms AT220; Hpms hpMADS; Hpms E004; Hpms E007; Hpms E014; Hpms E016; CAMS-398; CAMS-424; CAMS-451. Cayenne Hpms 13; Hpms 141; Hpms 143;Hpms 162; Hpms 1148; Hpms 1173; Hpms 1281; Hpms 221; Long Slin 17 Hpms AT214; Hpms AT220; Hpms hpMADS; Hpms E004; Hpms E007; Hpms E014; Hpms E016; CAMS-398; CAMS-424. Malagueta 6 Hpms 15; Hpms 1117; CAMS-215; CAMS-398; CAMS-460; CAMS-855. UENF 8 Hpms 1117; Hpms 1216; Hpms 221; AA840692; Hpms E003; Hpms E009; CAMS-811; 2154 CAMS-855. Figure 1. Cluster dendrogram of Capsicum cultivars obtained by UPGMA method. Campos dos Goytacazes, UENF, 2017. These reports, and the results of genetic purity of propagative material uncommon to observe misnamed and this paper, are just a simple sample of to be marketed. identification of species. the confusion found in the seed market in Brazil. Identically, it is possible that We also highlight that many We suggest here that MAPA might other inconsistencies may exist in the cultivars of Capsicum and other establish stricter mechanisms for registered cultivar information provided vegetables registered in Platform checking and certifying the information by MAPA in CultivarWeb regarding CultivarWeb are imported from other provided by the applicant in the cultivar Capsicum cultivars, as well as for countries, not being the result of genetic registration application form, in order other genera and species. The detection breeding program carried out in the to avoid the disclosure of inaccurate of inconsistencies of this nature country. This would not be one of the information. We also recommend a undermines the confidence of both reasons for the inconsistencies in the thorough review of the information farmers and breeders in the guarantees available information, as this incorrect contained in all cultivar registration offered to them by government agencies, identification of the species could be processes which have already been namely: reliability of the cultivar’s a mistake from the country where the completed and whose information is genetic identity and quality, and the cultivar was developed. Especially in already available on the CultivarWeb the case of Capsicum plants, it is not platform. Hortic. bras., Brasília, v.37, n.3, July - September 2019 291

CDO Azevedo et al. Figure 2. Principal coordinates obtained using dissimilarity matrix resulting from genetic diversity analysis among Capsicum spp. cultivars. Campos dos Goytacazes, UENF, 2017. We know that monitoring this type application forms need to be reviewed Morphoagronomic and molecular profiling of of information is complex, since all in order to correct and avoid possible Capsicum spp. from southwest Mato Grosso, registration is based on information inconsistencies in the information Brazil. Genetics and Molecular Research 15: sent by public or private institution available for public consultation, the gmr.15038167. interested in registering a cultivar. For CultivarWeb. this reason, one proposal which may CARVALHO, C; KIST, BB; TREICHEL, M. improve this supervision would be the ACKNOWLEDGEMENTS 2016. Anuário brasileiro das hortaliças. Santa accreditation of research centers and Cruz do Sul: Editora Gazeta Santa Cruz. 64p. public universities as certifiers in order The authors thank to Fundação Carlos to provide accurate information about Chagas Filho de Amparo à Pesquisa do C A RVA L H O , S I C ; B I A N C H E T T I , LB; the cultivar with the Ministério de Estado do Rio de Janeiro (FAPERJ) and REIFSCHNEIDER, FJB. 2009. Registro e Agricultura, Pecuária e Abastecimento Conselho Nacional de Desenvolvimento proteção de cultivares pelo setor público: a [(MAPA) Ministry of Agriculture, Científico e Tecnológico (CNPq) for experiência do programa de melhoramento de Livestock and Food Supply]. Adopting financially supporting this study, in Capsicum da Embrapa Hortaliças. Horticultura some solutions such as the establishment the form of bench rate (processes Brasileira 27: 135-138. of partner certification institutions, E-26/202.985/2017 and 307569/2017- inconsistencies in information contained 9, respectively) granted to the second CRUZ, CD. 2013. GENES: software para in the official database for registered author. This study was supported by análise de dados em estatística experimental cultivars can be avoided and even Coordenação de Aperfeiçoamento de e em genética quantitativa. Acta Scientiarum disappear in the medium term. Pessoal de Nível Superior (CAPES) Agronomy 35: 271-276. Financing Code 001. Therefore, there is an inconsistency DOYLE, JJ; DOYLE, JL. 1990. Isolation of plant in relation to the information of species REFERENCES DNA from fresh tissue. Focus 12: 13-15. of Capsicum attributed to cultivars Amarela Comprida, De Cayenne and BARBERO, GF; RUIZ, AG; LIAZID, A; FAVORETTO, P; VEASEY, EA; MELO, PCT. Cayenne Long Slin in the official PALMA, M; VERA, JC; BARROSO, CG. 2011. Molecular characterization of potato database of the Registro Nacional de 2014. Evolution of total and individual cultivars using SSR markers. Horticultura Cultivares (National Cultivar Register), capsaicinoids in peppers during ripening of Brasileira 29: 542-547. CultivarWeb. Consequently, the the Cayenne pepper plant (Capsicum annuum accuracy of the information presented L.). Food Chemistry 153: 200-206. KUMAR, LD; KATHIRVEL, M; RAO, GV; for other cultivars is not reliable either. NAGARAJU, J. 2001. DNA profiling of CAMPOS, AL; MAROSTEGA, TN; CABRAL, disputed chilli samples (Capsicum annuum) Thus, it is clear that the procedures NSS; ARAÚJO, KL; SERAFIM, ME; using ISSR-PCR and FISSR-PCR marker currently employed for checking and SEABRA-JÚNIOR, S; SUDRÉ, C; assays. Forensic Science International 116: certifying the information provided by RODRIGUES, R; NEVES, LG. 2016. 63-68. the applicant in the cultivar registration KWON, YS; LEE, JM; YI, GB; YI, SI; KIM, KM; 292 SOH, EH; BAE, KM; PARK, EK; SONG, IH; KIM, BD. 2005. Use of SSR markers to complement tests of distinctiveness, uniformity, and stability (DUS) of pepper (Capsicum annuum L.) Varieties. Mol. Cells 19: 428-435. LEE, JM; NAHM, SH; KIM, YM; KIM, BD. 2004. Characterization and molecular genetic mapping of microsatellite loci in pepper. Theoretical and Applied Genetics 108: 619–627. LIU, K; MUSE, SV. 2005. PowerMarker: an Hortic. bras., Brasília, v.37, n.3, July - September 2019

Microsatellites for detecting inconsistencies in Capsicum cultivars registration in Brazilian database: more than meets the eye integrated analysis environment for genetic asp?produto=2511. Accessed November 10, alleles. Theoretical Population Biology 80: marker analysis. Bioinformatics 21: 2128- 2017. 100-113. 2129. MINAMIYAMA, Y; TSURO, M; HIRAI, M. SILVA, AR; DIAS, CTS. 2013. A cophenetic UPOV - International Union for the Protection 2006. An SSR-based linkage map of Capsicum correlation coefficient for Tocher’s method. of New Varieties of Plants. 2010. Guidelines annuum. Molecular Breeding 18:157-169. Pesquisa Agropecuária Brasileira 48: 589- for DNA-Pofiling: molecular marker PEAKALL, R; SMOUSE, PE. 2012. GenAlEx 596. selection and database construction (“BMT 6.5: genetic analysis in Excel. Population GUIDELINES”). UPOV/INF/17/1. Geneva, genetic software for teaching and research- an SIM, SC; HONG, JH; KWON, YS. 2015. DNA Switzerland. 13p. update. Bioinformatics 28: 2537-2539. profiling of commercial pumpkin cultivars using simple sequence repeat polymorphisms. YI, G; LEE, JM; LEE, S; CHOI, D; KIM, B. PIMENTAS ARTESANAIS. 2017. Horticulture Environment and Biotechnoogy. 2006. Exploitation of pepper EST-SSRs and Pimentas Artesanais. Available at http:// 56: 811-820. an SSR-based linkage map. Theoretical and pimentasartesanais.com.br/produtos. Applied Genetics 114: 113-130. SZPIECH, ZA; ROSENBERG, NA. 2011. On the size distribution of private microsatellite Hortic. bras., Brasília, v.37, n.3, July - September 2019 293

Research PÉREZ, MB; LIPINSKI, VM; FILIPPINI, MF; CHACÓN-MADRID, K; ARRUDA, MAZ; WUILLOUD, RG. 2019. Selenium biofortification on garlic growth and other nutrients accumulation. Horticultura Brasileira 37: 294-301. DOI - http://dx.doi.org/10.1590/S0102-053620190307 Selenium biofortification on garlic growth and other nutrients accumulation María B Pérez 1ID; Víctor Mario Lipinski 2ID; María Flavia Filippini 1ID; Katherine Chacón-Madrid 3ID; Marco Aurelio Z Arruda 3ID; Rodolfo G Wuilloud 1ID 1Laboratorio de Química Analítica para Investigación y Desarrollo (QUIANID) do Instituto Interdisciplinario de Ciencias Básicas, Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Cuyo, CONICET, Padre J. Contreras 1300, (5500), Mendoza, Argentina; 2EEA La Consulta INTA, Mendoza, Argentina; 3Universidade de Campinas (UNICAMP), Instituto de Química, Campinas-SP, Brasil; rwuilloud@ mendoza-conicet.gob.ar; [email protected] (corresponding author) ABSTRACT RESUMO Selenium (Se) is an essential element for humans and has anti- Biofortificação de selênio no crescimento de alho e avaliação cancer function. Garlic can accumulate Se, so it is an option to Se de acúmulo de outros elementos nutrientes supplementation in the human diet. The aim of this research was to study Se uptake and accumulation during garlic growth. Four doses O selênio (Se) é elemento essencial para os seres humanos e é of Na2SeO4 and Na2SeO3 solution were applied in the substrate (0, 5, considerado anticancerígeno. Alho pode acumular Se, sendo, por isso, 10 and 15 kg ha-1 Se) for one time in August 2014, with a random plot uma opção para a suplementação de Se na dieta humana. Assim, o design and 3 replicates on garlic clone Rubi INTA. Three harvests objetivo deste trabalho foi estudar a captação e acúmulo de selênio were made, in September, October and December 2014. After each durante o crescimento do alho e avaliar os efeitos da fortificação harvest, leaves, bulbs and roots were separated and conditioned de Se. Quatro doses da solução de Se, nas formas de Na2SeO4 e (peeled and chopped), lyophilized, and finally acid-digested prior Na2SeO3 foram aplicadas ao substrato em agosto de 2014 (0, 5, 10 to Se, Mg, Zn, Mn, Cu, Fe, P and S determination by inductively e 15 kg ha-1 de Se) de uma única vez, em delineamento de parcela coupled plasma mass spectrometry (ICP-MS). The Se accumulation aleatória e 3 repetições no clone de alho Rubi INTA. Três colheitas was proportional to Se doses and did not affect garlic growth. Also, foram feitas, em setembro, outubro e dezembro de 2014. Após cada Se distribution among different organs was related to the garlic colheita, as folhas, bulbos e raízes das amostras de alho resultantes growth cycle. The Se presence decreased accumulation of Mg, Mn, de cada tratamento foram separadas e acondicionadas (descascadas Cu, Fe, P and S but increased Zn accumulation in plants. Garlic can e picadas), liofilizadas, e, finalmente, digeridas com ácido antes da be an important Se source to humans but it is important to consider determinação de Mg, Zn, Mn, Cu, Fe, P e S por espectrometria de Se-doses for biofortification. massa com plasma indutivamente acoplado (ICP-MS). Os resultados confirmaram que o acúmulo de Se foi proporcional à magnitude das doses, e não afetou significativamente o crescimento do alho. Além disso, a distribuição de Se entre os diferentes compartimentos da planta foi relacionada ao ciclo de crescimento da planta de alho. A fortificação do alho com Se causou mudanças significativas, e induziu o acúmulo e distribuição de diferentes nutrientes, como Zn, Mg, Mn, Cu, Fe, P e S, mas aumentou o acúmulo de Zn nas plantas. O alho pode ser considerado fonte importante de Se para aumentar a ingestão deste elemento na dieta humana, mas é importante considerar as doses de Se para a biofortificação. Keywords: Allium gender sativum, selenium uptake, bioaccumulation, Palavras-chave: Allium gender sativum, captação de selênio, enriched crop. bioacumulação, colheita enriquecida. Received on December 20, 2018; accepted on August 6, 2019 Selenium (Se) is an essential function (Bodnar et al., 2016). Likewise, depends on the dose and the form of Se. microelement in human and animal Se can be a component of glutathione Moreover, Se is an inducer of apoptosis nutrition, due to its beneficial effects peroxidase, a biomolecule that protects and inhibitor of cell proliferation which on health; specially because it protects the organism from the negative actions can account for its cancer preventive the immune system and contributes to of free radicals by reducing hydrogen effect (Sinha & El-Bayoumy, 2004). The cardiovascular conditioning, proper peroxide and organic peroxides most important source of Se in human thyroid function, fertility in men and (Bodnar et al., 2016). The role of Se as diet is food. Thus, several foods have women, and above all, anti-cancer potent cancer chemopreventive agent been recognized as natural Se sources, 294 Hortic. bras., Brasília, v.37, n.3, July - September 2019

Selenium biofortification on garlic growth and other nutrients accumulation including yeast, onion, garlic and Brazil doses (Zhao et al., 2013). Moreover, an Selenium enrichment experiments nuts, among others (Ellis & Salt, 2003). optimal Se dose could play a positive of garlic were conducted at La role on plant yield and nutritional Consulta, Experimental Station INTA, The fortification of different plants quality, whereas a high dose can be Mendoza, Argentina (33°42′30″S, with Se has also been studied in order harmful to plant (Xue et al., 2001). 69°04′22″W, 958 m altitude) during to obtain Se-enriched foods that have Therefore, it is important to investigate the growing season between April potential functionality to promote the garlic tolerance to different Se doses 2014 and December 2014. The garlic health. In fact, it is well established and the best time for Se application to clone “Rubi INTA” was used in this that vegetables derived from Allium and obtain an optimum enrichment in the work and was fortified with a solution Brassica plant species, play an important plants without affecting their growth. at a concentration of 169 g L-1 of Se. role in Se supplementation because On the other hand, Se may influence Four doses were applied: 0, 5, 10 they have the ability of accumulating the accumulation of macronutrients and and 15 kg ha-1 of Se, with a random high amounts of Se even though Se is micronutrients involved in oxidative plot design and three replicates. The not a micronutrient for the plants, and regulation of cells, in a way that tested Se doses were similar to those hence, they could be used as natural biofortification is feasible only if the reported in other studies about the dietary Se supplements (Lavu et al., Se content has no negative influence Allium gender (Sharma et al., 2007; 2012). Among these, garlic (Allium on uptake of other essential elements Domokos-Szabolcsy et al., 2011; Lavu sativum) is highly important due to its (Longchamp et al., 2015). et al., 2012). Three samplings were multiple medicinal effects, for example, performed: at the beginning (September it reduces blood cholesterol levels The aim of the present research was 2014:103-BBCH), mid-term (October and antiplatelet aggregation, produces to study Se uptake and accumulation 2014; 203-BBCH scale) and end anti-inflammatory activity and inhibits in different moments of garlic growth, (December 2014; 409-BBCH scale) of cholesterol synthesis (Burba, 2013). evaluating its effects on the development the growth cycle (Lopez-Bellido et al., Besides, this crop is the most consumed of the plant, as well as on uptake and 2016). Garlic was planted in 10 L pots culinary seasoning in the world, 26.5 accumulation of other nutrients to a filled with a mixture of 90% sphagnum million tons of garlic are approximately better understand of Se influence on peat and 10% sandy loam soil (10% clay, consumed per year (Camargo et al., garlic plants. 60% fine sand, 25% silt and 5% calcium 2010). Garlic is also considered a Se bicarbonate). A single application of hyper-accumulator and uptakes this MATERIAL AND METHODS Se to garlic plants was performed in element effectively, up to 1000 µg g-1 August because garlic plants are in (Ghasemi et al., 2015; Kaur et al., Reagents the vegetative growth stage, i.e. an 2016). This large Se accumulation is specific time where assimilation and mainly because Se and S have some All reagents used were of analytical metabolization of nutrients are more chemical similarity (Kaur et al., 2016), grade and all solutions were prepared efficient (Burba, 2013). The Se dose which causes that Se can be metabolized in ultrapure water with a minimum was applied directly to the substrate. through the same assimilation pathways resistivity of 18.0 MΩ cm obtained Plants were irrigated daily during that than S. Furthermore, Se is metabolized from an Osmo ion-U-0.5 ultrapure stage with an automatic drip system by garlic into important Se-amino acids water equipment (APEME, Buenos operated with a timer and fertilized with like Se-methionine (SeMet), Se-cysteine Aires, Argentina). The Se solution a 10:1:10 (N:P:K) fertilizer solution (SeCys), Se-methylselenocysteine (169.89 g L-1) used in the different Se reaching the equivalent of 300 kg ha-1 of (Se-methylSeCyst) and γ-glutamyl- biofortifications was prepared with the N, 30 kg ha-1 of P and 300 kg ha-1 of K Se-methylselenocysteine (γ-glutamyl- following proportions: 284.59 g L-1 in the growth cycle. The environmental SemethylSeCyst) (Quinn et al., 2011). sodium selenate (Na2SeO4) 98% and conditions of the crop were: maximum These Se-amino acids are precursors 111.65 g L-1 sodium selenite (Na2SeO3) and minimum temperature between 15 of methylselenol, which has been 99% from Sigma (St Louis, USA). Sub and 30°C and -5 and 10°C respectively; demonstrated to be one of the most boiling nitric acid (HNO3) and hydrogen maximum and minimum relative active species for cancer prevention in peroxide (H2O2) 30% Merck (New humidity between 80 and 100% and 20 humans (Lü et al., 2016). Jersey, USA) were used for sample and 50% respectively and rainfall was decomposition. The standard solutions between 10 and 110 mm. Three useful Although Se-enriched garlic is an of Se, Mg, Zn, Mn, Cu, Fe, P and S were plants were used for each treatment. attractive option to naturally increase Se prepared from stock solutions (1000 intake by humans, there are few studies mg L-1) by simple dilution. Reagents The substratum and the water on the uptake and accumulation during from Merck were used in the stock used in these assays were analyzed the growth of garlic plant (Poldma et solutions. Rhodium (103Rh) mono- by inductively coupled plasma mass al., 2011; Ogra et al., 2015; Cheng et elemental standard solution from Perkin spectrometry (ICP-MS) before their use al., 2016). Additionally, the application Elmer Pure Plus Atomic Spectroscopy and Se was not detected. of Se can improve plant quality and Standards was used as internal standard. yield, given that, Se has an antioxidative Sample processing effect on plants which depends on Se Cultivation of Se enriched garlic After each sampling, leaves, bulb Hortic. bras., Brasília, v.37, n.3, July - September 2019 295